Micro-ecological preservative composition suitable for sensitive skin

Abstract

The invention provides a micro-ecological preservative composition suitable for sensitive skin. The preparation method comprises the following steps: firstly, carrying out reflux extraction on artemisia apiacea through 60% ethanol, then adding lactobacillus plantarum and saccharomyces cerevisiae for fermentation to obtain artemisia apiacea fermentation liquor powder, and then compounding phenoxyethanol and gluconolactone to obtain the micro-ecological preservative composition. Experiments prove that the micro-ecological preservative composition does not excessively inhibit / promote proliferation of propionibacterium acnes, disturbance and damage to resident bacterial colonies of skin are reduced, and the micro-ecological preservative composition has a certain repairing effect on a micro-ecological barrier. Phenoxyethanol and natural preservatives (sweet wormwood herb fermentation liquor powder and gluconolactone) have a certain synergistic preservative effect, so that the dosage of phenoxyethanol can be reduced, and the irritation and scorching risks of high use concentration of phenoxyethanol to sensitive skin are reduced.

Description

Technical Field

[0001] The present invention belongs to the technical field of cosmetics, and in particular relates to a microecological preservative composition suitable for sensitive skin. Background Art

[0002] Because cosmetics are rich in water and nutrients, they are highly susceptible to microbial contamination. Preservatives are often added to prevent microbial contamination (especially pathogenic bacteria) to ensure the stability and safety of cosmetics. The most common method for evaluating the effectiveness of preservatives in final cosmetic formulations is the preservative challenge test, using strains such as Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Aspergillus niger, and Candida albicans. While preservatives in cosmetics inhibit and kill pathogenic bacteria, they inevitably disrupt and damage the resident skin microbiome, thereby affecting the skin's surface microecological environment. In severe cases, they may even cause skin infections or various skin diseases. Research and development of skin-friendly cosmetics, using cosmetics to protect and beautify the skin, should not kill or significantly inhibit the resident skin microbiome during short-term or long-term use. This poses new challenges to the use of preservatives in cosmetics.

[0003] HSP20, a member of the small heat shock protein family (sHSPs, molecular weight approximately 12-43 kDa), plays a unique role in skin stress response, barrier function, and the aging process. It holds particular potential in regulating inflammation and protecting cells in sensitive skin. HSP20 possesses antioxidant properties in skin cells, mitigating oxidative stress by activating the Nrf2-NQO-1 pathway and protecting airway epithelial and skin cells from free radical damage. Furthermore, HSP20 expression and activity can modulate inflammatory responses, reducing the release of inflammatory mediators and thereby alleviating skin inflammation and damage. As an "endogenous protective factor" for sensitive skin, promoting its production can improve symptoms of allergies and signs of aging. The key lies in using gentle activation (such as low-concentration plant polyphenols and non-invasive physical stimulation) rather than forced induction to avoid secondary damage to sensitive skin caused by excessive stress. With the development of targeted delivery technologies, precisely enhancing HSP20 activity is expected to become a key anti-aging strategy for sensitive skin.

[0004] Phenoxyethanol, a common preservative in skincare products, has a certain inhibitory effect on Propionibacterium acnes on the face. In addition to inhibiting its own proliferation and disrupting the balance of the skin's flora, it also affects P. acnes' metabolism, significantly reducing the expression of the heat shock protein HSP20 gene. To address these issues, the development of a microbiome-friendly preservative composition suitable for sensitive skin remains an unresolved issue. Summary of the Invention

[0005] To address the shortcomings of the existing technology, the present invention provides a microecological preservative composition suitable for sensitive skin. The method involves first extracting Artemisia annua with 60% ethanol under reflux, then adding Lactobacillus plantarum and Saccharomyces cerevisiae for fermentation to obtain an Artemisia annua fermentation broth powder. Phenoxyethanol and gluconolactone are then added to the mixture to produce the microecological preservative composition. Experimental verification has shown that this microecological preservative composition does not excessively inhibit or promote the proliferation of Propionibacterium acnes, reduces disturbance and damage to the skin's resident bacterial flora, and has a certain repairing effect on the microecological barrier. Phenoxyethanol and the natural preservatives (Artemisia annua fermentation broth powder and gluconolactone) exhibit synergistic preservative effects, reducing the dosage of phenoxyethanol and the risk of irritation and burning on sensitive skin caused by high phenoxyethanol concentrations. The natural preservative composition can improve the inhibitory effect of phenoxyethanol on HSP20 gene expression while synergistically promoting HSP20 gene expression, achieving excellent anti-aging efficacy.

[0006] The first object of the present invention is to provide a microecological preservative composition suitable for sensitive skin, which is characterized in that it is compounded by phenoxyethanol, Artemisia annua fermentation broth powder and gluconolactone; wherein, by mass ratio, phenoxyethanol: Artemisia annua fermentation broth powder: gluconolactone = 1:0.5~2:1~2, and the total amount added in cosmetics is ≤0.5%.

[0007] The preparation method of the artemisia annua fermentation broth powder comprises the following steps: firstly crushing the artemisia annua and then extracting it with 55-65% ethanol by refluxing, concentrating the extract and removing the ethanol to obtain the artemisia annua extract, adding the artemisia annua extract to a TSB culture medium (the weight ratio of the TSB culture medium to the artemisia annua extract (calculated on a dry matter basis) is 5:1), and inoculating 2-5% of a mixed strain of Lactobacillus plantarum and Saccharomyces cerevisiae; fermenting the mixture aerobically at 28-32°C for 10-15 hours, then transferring the mixture to anaerobic fermentation at 22-28°C for 40-55 hours, during which the pH value is monitored to be reduced to 4.2-4.5; after the fermentation is completed, centrifuging, vacuum-low-temperature concentrating, and freeze-drying to obtain the artemisia annua fermentation broth powder; in the mixed strain of Lactobacillus plantarum and Saccharomyces cerevisiae, the OD values ​​of the two strains are the same. 600 Both are 0.45-0.55, and the volume ratio of Lactobacillus plantarum to Saccharomyces cerevisiae is 1.8-2.2:1.

[0008] The second object of the present invention is to provide the use of the above composition as a preservative in the preparation of cosmetics for sensitive skin.

[0009] In the present invention, the cosmetics should be understood in a broad sense, including but not limited to cleansing cream (ointment), facial cleanser, bath lotion, facial cream, lotion, facial mask, etc.

[0010] The present invention uses phenoxyethanol, Artemisia annua fermentation broth powder, and gluconolactone to prepare a microecological preservative composition. After fermentation, the Artemisia annua extract is more conducive to alleviating the irritation of phenoxyethanol, reducing the disturbance and damage caused to the skin's resident flora, and is more conducive to achieving repair of the skin's microecology. The addition of gluconolactone has a synergistic anti-aging effect with the Artemisia annua fermentation broth powder. Furthermore, the synergistic antiseptic effect of phenoxyethanol, Artemisia annua fermentation broth powder, and gluconolactone can reduce the amount of phenoxyethanol used, reduce the irritation and burning risk of sensitive skin caused by high phenoxyethanol concentrations, reduce the disturbance and damage caused to the skin's resident flora, and achieve repair of the skin's microecology.

[0011] The beneficial technical effects of the present invention are: 1. The microecological preservative composition provided by the present invention, which is suitable for anti-aging of sensitive skin, does not excessively inhibit or promote the proliferation of Propionibacterium acnes, reduces disturbance and damage to the resident bacterial flora of the skin, and has a certain repair effect on the microecological barrier; 2. Phenoxyethanol, Artemisia annua fermentation broth powder and gluconolactone have a certain synergistic preservative effect, which can reduce the dosage of phenoxyethanol and reduce the risk of irritation and burning to sensitive skin caused by the use of high concentrations of phenoxyethanol.

[0012] 3. The combination of Artemisia annua fermentation broth powder and gluconolactone can improve the inhibition of HSP20 gene expression by phenoxyethanol. At the same time, Artemisia annua fermentation broth powder and gluconolactone can synergistically promote the expression of HSP20 gene, achieving good anti-aging effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 is the growth curve of Propionibacterium acnes CCSM0331 in each treatment group; Figure 2 For RT-qPCR analysis, the expression level of heat shock protein gene HSP20 in the treated group relative to the untreated group; Figure 3 Graphs showing the gradient dilution of bacteria and fungi. DETAILED DESCRIPTION

[0014] The present invention is further described below by examples and drawings, but the present invention is not limited to the scope of the embodiments described. Based on the embodiments in the present invention, any variation of the present invention without creativeness by those skilled in the art falls within the scope of protection of the present invention. Meanwhile, in the examples of the present invention, unless otherwise specified, all raw materials for preparation are commercially available products well known to those skilled in the art.

[0015] The method for preparing the Artemisia annua fermentation broth powder used in this embodiment is as follows: (1) After crushing Artemisia annua, reflux extract with 60% ethanol was performed three times, each time for 40 minutes; the mass ratio of solid to liquid was 1:5; the extracts were combined and ethanol was removed by rotary evaporation to obtain Artemisia annua extract; (2) TSB medium was added with Artemisia annua extract (the weight ratio of TSB medium to Artemisia annua extract (dry matter) was 5:1) and inoculated with 3% mixed strains of Lactobacillus plantarum and Saccharomyces cerevisiae (Lactobacillus plantarum OD 600 = 0.5, Saccharomyces cerevisiae OD 600 =0.5, volume ratio 2:1); after aerobic fermentation at 30°C for 12 hours, it was transferred to anaerobic fermentation at 25°C for 48 hours, during which the pH was monitored to drop to 4.2-4.5; (3) After the fermentation is completed, the mixture is centrifuged at 8000 rpm for 15 minutes, sterilized by filtration with a 0.22 μm membrane, and finally concentrated at 40°C in a vacuum oven and freeze-dried to obtain the Artemisia annua fermentation broth powder.

[0016] The Artemisia annua extract powder used in this example is the powder obtained by reflux extraction with 60% ethanol, concentration and drying according to the above step (1).

[0017] Examples 1-3: Antiseptic compositions The formulations (weight ratio) of the antiseptic compositions of Examples 1-3 and Comparative Examples 1-10 are shown in Table 1. The raw materials used were mixed uniformly to obtain an antiseptic composition.

[0018] Table 1 Formulations of Examples 1-3 and Comparative Examples 1-10

[0019] Application Examples 1-3: Preparation of Emulsion The antiseptic compositions of Examples 1-3 and Comparative Examples 1-10 were used to prepare emulsions to obtain Application Examples 1-3 and Comparative Application Examples 1-10. The formulas of the emulsions are as follows: Phase A: A165 (emulsifier) ​​1%, GTCC (caprylic / capric triglyceride) 3%, white oil 3%, cetostearyl alcohol 0.5%, silicone oil 5%; Phase B: Glycerin 4%, Butylene Glycol 4%, EMT-10 (emulsifier) ​​0.4%, Xanthan Gum 0.1%, Soy Lecithin 0.2%, Deionized Water TO 100%; Phase C: the antiseptic composition provided by the present invention (added according to the percentages provided in Table 1).

[0020] The above emulsion preparation steps are as follows: 1) Preparation of Phase B: Disperse EMT-10, xanthan gum, and soy lecithin in glycerol and butylene glycol. Then, add deionized water and heat in an 80°C water bath while stirring to fully dissolve to obtain Phase B. 2) Preparation of Phase A: Melt A165, GTCC, white oil, cetostearyl alcohol, and silicone oil in a water bath at 83°C to obtain Phase A. 3) Heat phases A and B simultaneously in a water bath at 83°C. When the two phases reach the same temperature, slowly add phase A to phase B while stirring phase B at 500 r / min. After mixing phases B and A, cool the mixture while stirring at 430 r / min to obtain an emulsion. 4) adding the antiseptic composition provided by the present invention into deionized water and stirring to fully dissolve it to obtain phase C; 5) When the emulsion temperature drops to 40-45°C, add phase C and stir at 60 r / min to cool; when the temperature drops to 35°C, cool the mixture to obtain the emulsion products.

[0021] The blank example is an emulsion without active ingredient.

[0022] Experimental Example 1: Growth curve determination Freshly prepared TSB medium was used to dilute the bacterial suspension of Propionibacterium acnes CCSM0331 (Propionibacterium acnes CCSM0331 was isolated from healthy facial skin, see CN116904332A, a strain of Propionibacterium acnes with good antioxidant effect and its application, deposit number: CCTCC No: M 2022781) to 1×10 8 CFU / mL, set aside. The experimental group consisted of 100 mL of TSB culture medium, which contained the preservative compositions of Examples 1 to 3, Comparative Examples 1 and 7 (added according to the percentages provided in Table 1), and the control group consisted of 100 mL of TSB culture medium. The diluted bacterial suspension was inoculated into the experimental and control groups at a concentration of 1% (volume fraction), and 100 mL of TSB culture medium was used as the blank control group. The culture was anaerobically cultured at 37°C, and the OD was measured every 4 hours using a microplate reader. 600 The growth curves of Propionibacterium acnes CCSM0331 in each treatment group are shown in Figure 2. Figure 1 shown.

[0023] Depend on Figure 1It can be seen that treatment with phenoxyethanol (Comparative Example 1) inhibits the growth of P. acnes CCSM0331, suppressing its proliferation and affecting the natural balance of facial flora. However, the antiseptic composition for sensitive skin anti-aging provided by the present invention (Examples 1-3) does not excessively inhibit or promote the proliferation of P. acnes, reducing disturbance and damage to the skin's resident flora. Furthermore, replacing the Artemisia annua fermented broth with Artemisia annua extract powder inhibited the proliferation of P. acnes and the natural balance of facial flora. This demonstrates that the Artemisia annua fermented broth provided by the present invention is more advantageous, not excessively inhibiting or promoting the proliferation of P. acnes, and reducing disturbance and damage to the skin's resident flora.

[0024] Experimental Example 2: Real-time quantitative PCR (RT-qPCR) The expression of DEGs in P. acnes CCSM0331 (HSP20) was analyzed. The primer sequences used for RT-qPCR analysis of the genes are shown below.

[0025] O2A76_RS03905 (gene) HSP20 primers (5'→3'): Forward: TGGACCTTCCAGGAGTTGAT; Reverse: GGTGTACTCGGCGGTGAT.

[0026] Total RNA was extracted from P. acnes cells using TRIzol reagent and cDNA was synthesized using reverse transcriptase. Gene expression was analyzed using the comparative threshold cycle (Ct) method (2 -ΔΔCt ) quantified. The expression level was normalized using 16S rRNA as an internal reference. The expression levels of the heat shock protein gene HSP20 in the treated group (Example 1) and the untreated group (Comparative Examples 1, 4, 5, 7, and 9) were calculated and compared. The results are shown in FIG. Figure 2 shown.

[0027] Depend on Figure 2It can be seen that after treatment with phenoxyethanol, the expression of the heat shock protein gene HSP20 was significantly reduced. When phenoxyethanol was compounded with a single ingredient (Artemisia annua fermentation broth powder or gluconolactone) (Comparative Examples 4 and 5), the expression of the heat shock protein gene HSP20 was significantly reduced. However, when phenoxyethanol was combined with two ingredients (Artemisia annua fermentation broth powder + gluconolactone), not only did the decrease in the heat shock protein gene HSP20 be significantly reduced, but the expression of this gene was actually promoted. This indicates that there is a certain synergistic effect between the two substrates, with certain anti-aging effects, and is suitable for anti-aging products for sensitive skin. Comparing Comparative Examples 4 and 9, and comparing Examples 1, 5, and 7, it was found that the addition of Artemisia annua extract powder had no promoting effect on HSP20 expression, while the fermented Artemisia annua fermentation broth powder had a certain effect on HSP20 expression. This shows that the Artemisia annua fermentation broth of the present invention is superior to conventional Artemisia annua extract.

[0028] Experimental Example 3: Irritation Evaluation Experiment The experiment recruited 30 subjects with sensitive skin, both male and female, aged 23 to 50 years old, and used Application Examples 1 to 3 and Comparative Application Examples 4, 5, 7 and 9 as test substances, and blank as negative control. The test method was to select an area not exceeding 50mm 2 Using a closed patch test method, approximately 0.020-0.025g of the test substance was applied to a suitable patch tester with a depth of approximately 1mm. Hypoallergenic tape was applied to the back of the subject. Each subject tested eight samples, including a blank group, Application Examples 1-3, and Comparative Application Examples 4, 5, 7, and 9. After 24 hours, the test substance was removed. Skin reactions were observed 0.5, 24, and 48 hours after removal. Results were recorded according to the skin reaction grading standards in the "2015 Cosmetic Safety Technical Specifications" (Table 2). The results of the irritation evaluation test are shown in Table 3.

[0029] Table 2 Skin reaction grading standards

[0030] Table 3 Results of irritation evaluation test

[0031] As shown in Table 3, phenoxyethanol (Comparative Application Example 1) is a relatively irritating preservative for people with sensitive skin and is not suitable for use. When phenoxyethanol is combined with a specific ingredient (Comparative Application Examples 4 and 5), the irritation caused by phenoxyethanol is somewhat reduced, but some sensitive skin still experiences irritation. When phenoxyethanol is combined with two ingredients (Application Examples 1-3), 30 people with sensitive skin experience no irritation. This indicates that the soothing effect of the two fermentation substrates is significantly improved after fermentation, possibly exhibiting a synergistic effect that addresses the irritation problem of phenoxyethanol for people with sensitive skin. Comparing Comparative Application Example 1 with Comparative Application Example 7, the Artemisia annua extract powder is less effective in alleviating phenoxyethanol-induced irritation than the fermented Artemisia annua fermentation broth powder, indicating that the Artemisia annua fermentation broth of the present invention is superior.

[0032] Experimental Example 4: Anticorrosion Performance Evaluation 1. Experimental strains: 1) Bacteria: Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa, all of which are third-generation cultures; 2) Fungi: Aspergillus niger and Candida albicans, both are third generation cultures.

[0033] 2. Experimental steps: 1) Preparation of bacterial suspension: The above-mentioned standard stock strains of Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa were inoculated into tryptic soy broth (TSB medium), cultured at 30-35°C for 24-48 hours, and then diluted with 0.85% saline. -6 , 10 -7 , 10 -8 For three gradient dilutions, take 2 ml of dilution for each gradient and inject them into two sterilized plates, 1 ml per plate. Pour the melted and cooled tryptic soy agar medium to 45-50°C into the plates, about 15 ml per plate. Then rotate the plates to mix the bacterial solution and the medium thoroughly. After the agar solidifies, turn the plates over and incubate at 30-35°C for 48±2h, then count. Based on the above counting results, dilute the original bacterial solution into 10 8 CFU / ml bacterial suspension, the prepared bacterial suspensions were mixed in equal volumes and set aside for use.

[0034] 2) Preparation of Candida albicans suspension: Inoculate the frozen preserved strain of Candida albicans mentioned above into Sabouraud dextrose liquid medium (SDB medium), culture at 20-25°C for 2-3 days, and perform gradient dilution with 0.85% saline. Take 6 plates and pipette 10 -5 , 10 -6 , 10 -7For three gradient dilutions, take 2 ml of dilution for each gradient and inject it into two sterilized plates, 1 ml per plate. Pour the melted and cooled Sabouraud dextrose agar medium to 45-50°C into the plates, about 15 ml per plate. Then rotate the plates to mix the bacterial solution and the medium thoroughly. After the agar solidifies, turn the plates over and incubate at 20-25°C for 5 days, then count. Based on the above counting results, dilute the original bacterial solution into 10 6 CFU / ml bacterial suspension, the prepared bacterial suspension is ready for use.

[0035] 3) Preparation of Aspergillus niger spore suspension: Inoculate the frozen and preserved spore suspension of Aspergillus niger onto Sabouraud glucose agar slant and incubate at 20-25°C for 5-7 days or until abundant spores are obtained. Rinse the bacterial moss with an appropriate amount of 0.85% saline solution containing 0.05% (ml / ml) polysorbate 80 to prepare a spore suspension. Perform gradient dilutions with 0.85% saline solution containing 0.05% (ml / ml) polysorbate 80. Take 6 plates and pipette 10 -5 , 10 -6 , 10 -7 For three gradients of dilution, take 2 ml of dilution for each gradient and inject them into two sterilized plates respectively, 1 ml for each plate. Pour the melted and cooled Sabouraud glucose agar medium to 45-50°C into the plates, about 15 ml for each plate. Then rotate the plates to mix the bacterial solution and the culture medium thoroughly. After the agar solidifies, turn the plates over, culture at 20-25°C for 5 days, and count. If Aspergillus niger spreads and grows, in order to avoid affecting the counting results, the plate should be taken out and counted every day starting from 48±2h, and the counting result on the 5th day is the final counting result. According to the above counting results, 0.85% saline containing 0.05% (ml / ml) polysorbate 80 is used to dilute the original spore solution to 10 6 CFU / ml spore suspension, the prepared bacterial suspension is ready for use.

[0036] Gradient dilution diagram of bacteria and fungi Figure 3 shown.

[0037] 4. Sample preparation: Take 3 portions of each sample, weigh 120 g or measure 120 ml of each portion into a sterile conical flask and set aside.

[0038] 5. Sample inoculation: Take the above three samples and inoculate 1.2 ml of the bacterial mixed suspension, 1.2 ml of the Candida albicans suspension and 1.2 ml of the Aspergillus niger spore suspension respectively. Mark them, mix them evenly and store the samples at room temperature.

[0039] 6. Sample testing: Take samples prepared as above on days 0, 1, 3, 7, 14, 21, and 28, and test them according to the cosmetic microbiological testing procedures. Record the number of colonies in the samples to determine the preservative efficacy of the cosmetics.

[0040] 7. Experimental results: 1) Bacterial suspension count results: The counting results of the bacterial suspension, Candida albicans suspension and Aspergillus niger spore suspension are shown in Tables 4, 5 and 6, respectively.

[0041] Table 4 Bacterial suspension count results

[0042] The initial inoculation concentration of the sample was 1.5×10 6 CFU / g (ml) (initial log value 6.18) Table 5 Candida albicans suspension counting results

[0043] The initial inoculation concentration of the sample was 1.5×10 4 CFU / g (ml) (initial log value 4.18) Table 6 Count results of Aspergillus niger spore suspension

[0044] The initial inoculation concentration of the sample is: 1.6×10 4 CFU / g (ml) (initial log value 4.20) 2) Determine the number of colonies in different samples at different times Evaluation Criteria: The logarithmic reduction value is used as the evaluation index for the preservative effect of cosmetics. The calculation formula for this index is shown below.

[0045] R X =lgN0-lgN X Where: N0: initial concentration of bacterial solution in the sample; N X : The colony counts of samples at different detection times.

[0046] The evaluation criteria for cosmetics antiseptic effect are shown in Table 7-8, and R x The results are shown in Table 9.

[0047] Table 7 Evaluation criteria for cosmetics antiseptic effect

[0048] Table 8 Additional conditions for the evaluation criteria of cosmetics antiseptic effect

[0049] Table 9 Anticorrosion evaluation results (R x )

[0050] As shown in Table 9 above, the samples in Application Examples 1-3 showed a continuous decrease in bacteria, white schizolinone, and black koji within 28 days, demonstrating acceptable preservative capabilities, meeting Standard A. However, the preservative capabilities of the samples in combination with either a single component or each component alone (Comparative Application Examples 1-6) were not effective on day 28, failing to meet any of the standards. Therefore, it can be concluded that the preservative composition of the present invention possesses considerable preservative capabilities. The Artemisia annua fermentation broth powder, when combined with gluconolactone, can replace a certain amount of phenoxyethanol and exhibit a certain synergistic preservative effect with phenoxyethanol. However, when the Artemisia annua fermentation broth powder was replaced with Artemisia annua extract powder (Comparative Application Examples 7-10), the preservative effects were inferior to those of the sample in Application Example 1. This indicates that the preservative efficacy of Artemisia annua extract powder is far inferior to that of Artemisia annua fermentation broth powder, and that the Artemisia annua fermentation broth powder provided by the present invention is superior.

[0051] Experimental Example 5: Microbial Barrier Repair Effect Test The effects of the samples provided in Example 1 and the samples provided in Comparative Examples 1-10 on repairing the microbial barrier were tested by experiments on the restoration effect of skin microecology and the inhibition effect of Staphylococcus aureus.

[0052] Principle: The plate culture count method is commonly used to determine the number of viable microorganisms. This method involves preparing a sample into a series of uniform dilutions of varying degrees. A specific dilution is then inoculated, evenly distributed within a specific culture medium in a petri dish. The number of viable bacteria per gram (or per milliliter) of sample is calculated based on the number of colonies grown on the plate. In this test, an inactivated cotton swab is used to collect skin colonies from a fixed area of ​​the skin. After collection, the swab is immersed in inactivated saline and shaken to disperse the bacteria before determining the number of viable microorganisms.

[0053] Experimental methods: (1) Mark 3×3cm on the inside of the left and right arms during the experiment 2 Multiple test areas can be marked on the same arm, with intervals of 1 cm. The test product and blank control are randomly distributed on the left and right arms.

[0054] (2) Select 16 areas. Each area is swabbed 50 times with a sterile cotton swab dipped in a small amount of saline. The cotton swab is then immersed in the same volume of saline and vortexed. After the vortex is dispersed, the number of living microorganisms is measured. This sample is used as the initial skin colony count and is recorded as A0.

[0055] (3) After 6 hours and 12 hours, wipe the skin 50 times with a sterile cotton swab dipped in a small amount of saline. Then, soak the cotton swab in the same volume of saline and vortex the solution. After the solution is dispersed, the number of living microorganisms is measured. This sample is used as the recovery value of the skin colony count and is recorded as A1.

[0056] Recovery rate of skin colonies = [(A0-A1) / A0] x 100% The recovery rates of bacterial colonies in skins with different treatments are shown in Table 10.

[0057] Table 10 Recovery rate of bacterial colonies on skin treated with different methods

[0058] The test results in Table 10 show that the sample provided in Application Example 1 restored the skin's bacterial colony count to over 80% six hours after microecological disruption, and after 12 hours, the skin's bacterial colony count had essentially returned to pre-disruption levels. Phenoxyethanol (Comparative Application Example 1) has a certain destructive effect on the skin's microbiome. A combination of Application Example 1, Comparative Application Example 4, and Comparative Application Example 5 revealed a synergistic effect between the Artemisia annua fermentation broth powder and gluconolactone on the recovery rate of skin microbiome, significantly alleviating the damage caused by phenoxyethanol. However, when Artemisia annua fermentation broth powder was replaced with Artemisia annua extract powder, it was found that the Artemisia annua extract powder had little effect on the recovery of the skin's microbiome, and no synergistic effect with gluconolactone was observed, demonstrating that the Artemisia annua fermentation broth powder provided by the present invention is a superior choice. The antiseptic composition provided by the present invention restores the skin's microbiome, achieving a beneficial balance in the resident bacterial population and enabling the skin to maintain healthy metabolism.

Claims

1. A microecological preservative composition suitable for sensitive skin, characterized in that It is prepared by compounding phenoxyethanol, Artemisia annua fermentation broth powder and gluconolactone; wherein, by mass ratio, phenoxyethanol: Artemisia annua fermentation broth powder: gluconolactone = 1:0.5~2:1~2.

2. The microecological preservative composition according to claim 1, wherein: The preparation method of the artemisia annua fermentation broth powder comprises the following steps: firstly crushing the artemisia annua and then extracting it with 55-65% ethanol under reflux, concentrating the extract and removing the ethanol to obtain the artemisia annua extract; adding the artemisia annua extract to a TSB culture medium, inoculating 2-5% of a mixed strain of Lactobacillus plantarum and Saccharomyces cerevisiae; aerobically fermenting the mixture at 28-32°C for 10-15 hours, then transferring the mixture to anaerobic fermentation at 22-28°C for 40-55 hours, during which the pH value is monitored to decrease to 4.2-4.5; after the fermentation is completed, centrifuging, vacuum-low-temperature concentrating, and freeze-drying to obtain the artemisia annua fermentation broth powder; in the mixed strain of Lactobacillus plantarum and Saccharomyces cerevisiae, the OD values ​​of the two strains are the same. 600 The concentrations of Lactobacillus plantarum and Saccharomyces cerevisiae are both 0.45-0.55, the volume ratio of Lactobacillus plantarum to Saccharomyces cerevisiae is 1.8-2.2:1, and the mass ratio of the TSB culture medium to the Artemisia annua extract is 4-6:

1.

3. Use of the microecological preservative composition according to claim 1 or 2 as a preservative in the preparation of cosmetics for sensitive skin.

4. The use according to claim 3, characterized in that: The preservatives also have an anti-aging effect.

5. The use according to claim 3, characterized in that: The cosmetic is any one of cleansing cream, cleansing paste, facial cleanser, bath lotion, facial cream, lotion, and facial mask.

6. The use according to claim 5, characterized in that: The total amount of the microecological preservative composition added to the cosmetic is ≤0.5%.

Images