Application of animal bifidobacterium subspecies F1-3-2 in preparation of medicine for preventing or treating sarcopenia

Abstract

The invention discloses application of a bifidobacterium animalis subspecies F1-3-2 in preparation of a medicine for preventing or treating sarcopenia, belongs to the technical field of microorganism application, and provides application of the bifidobacterium animalis subspecies F1-3-2 in preparation of the medicine for preventing or treating sarcopenia. The invention relates to an application of bifidobacterium animalis subspecies F1-3-2 in preparation of a medicine for correcting intestinal flora imbalance caused by sarcopenia. The invention finds that the bifidobacterium animalis subspecies F1-3-2 can effectively improve the skeletal muscle quality of mice with sarcopenia, improve the condition of tension reduction, improve the level of serum markers in sarcopenia, regulate the homeostasis of intestinal flora so as to relieve muscular atrophy, prepare freeze-dried bacterial powder and enrich products for improving sarcopenia.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial application, and in particular relates to the application of animal Bifidobacterium subspecies F1-3-2 in the preparation of a drug for preventing or treating sarcopenia. Background Art

[0002] Sarcopenia, also known as sarcopenia, is a syndrome of age-related progressive decline in skeletal muscle mass and function, characterized by a decrease in the number of muscle fibers, a reduction in cross-sectional area, and an imbalance in protein metabolism, which leads to a decrease in muscle synthesis capacity and an increase in the rate of breakdown. This disease not only significantly increases the risk of falls and fractures, but may also cause physical weakness and impaired exercise ability, thereby affecting the quality of life and increasing mortality. At present, there is no specific drug for sarcopenia, and the main means of intervention rely on exercise training and reasonable nutritional supplements. However, due to factors such as individual differences and compliance, simple exercise and diet adjustments have certain limitations in improving sarcopenia. Therefore, functional foods based on nutritional intervention are explored.

[0003] In recent years, the "gut-muscle axis" hypothesis has gradually become a hot topic in sarcopenia research. Numerous studies have confirmed that the occurrence of sarcopenia is closely related to intestinal flora imbalance, manifested by a decrease in beneficial bacteria, an enrichment of harmful bacteria, and a disorder in the structure of the intestinal microbiome. This imbalance not only exacerbates the breakdown of muscle protein but may also further accelerate muscle atrophy through chronic inflammation and metabolic disorders. Therefore, regulating intestinal microbial homeostasis is considered one of the important strategies to alleviate sarcopenia. In this context, probiotics or their derivative functional products with good safety and no toxic side effects have become a highly sought-after intervention method.

[0004] However, the specific mechanism of action of animal bifidobacteria in sarcopenia remains unclear, and its impact on muscle protein metabolism requires further exploration. Therefore, screening and evaluating probiotic strains that can improve sarcopenia has important research value and application prospects for developing sarcopenia prevention and treatment strategies based on intestinal microbial regulation. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention proposes the use of animal Bifidobacterium subspecies F1-3-2 in the preparation of drugs for preventing or treating sarcopenia. Animal Bifidobacterium subspecies F1-3-2 can effectively improve the skeletal muscle mass of sarcopenic mice, improve the decline in tensile strength, and at the same time improve the levels of serum markers in sarcopenia. It can also regulate the homeostasis of intestinal flora and thus alleviate muscle atrophy. It can be used to prepare probiotic products such as freeze-dried bacterial powder, enriching the products for improving sarcopenia.

[0006] To achieve the above objectives, the present invention provides the use of Bifidobacterium animalis subsp F1-3-2 in the preparation of a medicament for preventing or treating sarcopenia.

[0007] Preferably, the 16S rDNA nucleotide sequence of the animal Bifidobacterium subspecies F1-3-2 is shown in SEQ ID NO.1; the animal Bifidobacterium subspecies F1-3-2 was deposited in the China Center for Type Culture Collection on December 2, 2020, and the preservation address is Wuhan University, Wuhan, China, and the preservation number is: CCTCC NO: M2020832.

[0008] Preferably, the Bifidobacterium animalis subspecies F1-3-2 improves the phenotype of sarcopenia by alleviating the loss of skeletal muscle mass, thereby achieving the effect of preventing or treating sarcopenia.

[0009] Further preferably, the alleviation of skeletal muscle mass reduction is to reduce the intermuscular gap and alleviate the decline in fast muscle content, thereby alleviating the reduction in systemic muscle mass by reducing the elevated levels of prostaglandin E2 and C-reactive protein and alleviating the decreased level of irisin.

[0010] Further preferably, the phenotype of improving sarcopenia is to alleviate the decline in exercise capacity.

[0011] Further preferably, the pathway of action of Bifidobacterium animalis subspecies F1-3-2 in preventing or treating sarcopenia is to reduce the expression of skeletal muscle atrophy markers, thereby beneficially regulating muscle protein metabolism and alleviating muscle tissue atrophy.

[0012] The present invention also provides a method for preparing a freeze-dried powder containing the animal Bifidobacterium subspecies F1-3-2, comprising the following steps: centrifuging a bacterial membrane concentrate of the animal Bifidobacterium subspecies F1-3-2 to obtain bacterial mud; mixing the bacterial mud with a freeze-drying protective agent in a volume ratio of 1:1 to 2 to obtain a mixture, quickly pre-freezing the mixture to -30 to -45°C at -70°C, maintaining the mixture for 30 minutes, heating the mixture to -28°C at a rate of 5°C / 30min, and maintaining the temperature until the vacuum degree reaches 0.05MPa, heating the mixture to 10°C and maintaining the temperature until the vacuum degree reaches 0.03MPa, and crushing the mixture to obtain the freeze-dried powder.

[0013] The present invention also provides use of the freeze-dried powder prepared by the preparation method in preparing a drug for preventing or treating sarcopenia.

[0014] The present invention also provides the use of animal Bifidobacterium subspecies F1-3-2 in the preparation of a drug for improving the sarcopenia phenotype. The 16S rDNA nucleotide sequence of the animal Bifidobacterium subspecies F1-3-2 is shown in SEQ ID NO.1; the animal Bifidobacterium subspecies F1-3-2 was deposited in the China Center for Type Culture Collection on December 2, 2020, and the preservation address is Wuhan University, Wuhan, China, and the preservation number is: CCTCC NO: M2020832.

[0015] The present invention also provides the use of animal Bifidobacterium subspecies F1-3-2 in the preparation of a drug for correcting intestinal flora imbalance caused by sarcopenia. The 16S rDNA nucleotide sequence of the animal Bifidobacterium subspecies F1-3-2 is shown in SEQ ID NO.1; the animal Bifidobacterium subspecies F1-3-2 was deposited in the China Center for Type Culture Collection on December 2, 2020, and the preservation address is Wuhan University, Wuhan, China, and the preservation number is: CCTCC NO: M2020832; the animal Bifidobacterium subspecies F1-3-2 corrects the intestinal flora imbalance caused by sarcopenia by increasing the relative abundance of Enterococcus and Bifidobacterium in the intestine and reducing the relative abundance of Dunaliella and Desulfovibrio.

[0016] Compared with the prior art, the present invention has the following advantages and technical effects:

[0017] The present invention discovered that animal Bifidobacterium subspecies F1-3-2 improves muscle health by improving the levels of prostaglandin E2 (PGE2), irisin, and C-reactive protein (CRP), serum markers of sarcopenia; and improves muscle protein metabolism by promoting the downregulation of gene expression of muscle atrophy markers Atrogin-1 and MuRF1, thereby alleviating muscle atrophy in sarcopenia. Animal Bifidobacterium subspecies F1-3-2 can correct the intestinal flora imbalance caused by sarcopenia, increase the relative abundance of Enterococcus and Bifidobacterium in the intestine, and reduce the relative abundance of Dunaliella and Desulfovibrio. Animal Bifidobacterium subspecies F1-3-2 can be prepared into a freeze-dried bacterial powder probiotic product, enriching the products for improving sarcopenia. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1Figure 3 shows the effect of Bifidobacterium animalis subspecies F1-3-2 intervention on skeletal muscle mass and exercise capacity in sarcopenic mice, where (a) is the weight measurement of extensor digitorum longus (EDL), tibialis anterior (TA), gastrocnemius (GA) and soleus (SOL), (b) is the muscle mass index measurement, and (c) is the grip strength measurement. In the figure, different letters a, b and c represent statistical differences. HM represents the normal mouse group, SM represents the sarcopenic mouse model group, and F1-3-2 represents the Bifidobacterium animalis subspecies F1-3-2 intervention group.

[0020] Figure 2 The figure shows the effect of Bifidobacterium animalis subspecies F1-3-2 intervention on muscle pathological damage in sarcopenic mice, where (a) is the normal mouse group, (b) is the sarcopenic mouse model group, and (c) is the Bifidobacterium animalis subspecies F1-3-2 intervention group. The scale bar is 100 μm.

[0021] Figure 3 The figure shows the effect of Bifidobacterium animalis subspecies F1-3-2 intervention on the fast and slow muscle tissues of sarcopenic mice. (a) is the normal mouse group, (b) is the sarcopenic mouse model group, and (c) is the Bifidobacterium animalis subspecies F1-3-2 intervention group. In the figure, red represents fast muscle, green represents slow muscle, and the scale bar is 100 μm.

[0022] Figure 4 Figure 3 shows the effect of Bifidobacterium animalis subspecies F1-3-2 intervention on serum markers in sarcopenic mice, where (a) is the prostaglandin E2 (PGE2) level in mice, (b) is the irisin level in mice, and (c) is the C-reactive protein (CRP) level in mice. Different letters in a, b, and c in the figure represent statistical differences. HM represents the normal mouse group, SM represents the sarcopenic mouse model group, and F1-3-2 represents the Bifidobacterium animalis subspecies F1-3-2 intervention group.

[0023] Figure 5 Figure 3 shows the effect of Bifidobacterium animalis subspecies F1-3-2 intervention on the expression levels of the muscle atrophy markers MuRF-1 and Atrogin-1 genes, where (a) is the expression level of the MuRF-1 gene, and (b) is the expression level of the Atrogin-1 gene. In the figure, different letters a, b, and c represent statistical differences. HM represents the normal mouse group, SM represents the sarcopenia mouse model group, and F1-3-2 represents the Bifidobacterium animalis subspecies F1-3-2 intervention group.

[0024] Figure 6This is a graph showing the effect of animal Bifidobacterium subspecies F1-3-2 intervention on intestinal flora at the genus level. In the figure, HM represents the normal mouse group, SM represents the sarcopenia mouse model group, F1-3-2 represents the animal Bifidobacterium subspecies F1-3-2 intervention group, Bifidobacterium represents the genus Bifidobacterium, Lachnoclostridium represents the genus Lachnoclostridium, Enterococcus represents the genus Enterococcus, Dubosiella represents the genus Ducrofil, and desulfovibrio represents the genus Desulfovibrio. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] The source of materials used in the present invention: Bifidobacterium animalis subsp F1-3-2 comes from healthy infant feces. Bifidobacterium animalis subsp F1-3-2 was deposited in the China Center for Type Culture Collection on December 2, 2020. The preservation address is Wuhan University, Wuhan, China, and the preservation number is: CCTCC NO: M2020832.

[0031] The nucleotide sequence of 16S rDNA of Bifidobacterium animalis subsp. F1-3-2 is shown in SEQ ID NO. 1: SEQ ID NO. 1: AGTTTGATCATGGCTCAGGATGAACGCTGGCGGCGTGCTTAACACATGCAAGTCG.

[0032] Example 1

[0033] 1. Effect of Bifidobacterium animalis subspecies F1-3-2 on improving sarcopenia in mice

[0034] 1. Experimental Animals: 8-week-old male C57BL / 6J mice were purchased from Jinan Pengyue Laboratory Animal Breeding Co., Ltd. and housed under a 12-h light-dark cycle with free access to water and other amenities. All mice were housed in the animal husbandry facility at the Marine Bioresource Development Center of Ocean University of China. This experiment was approved by the Laboratory Animal Ethics Committee of the College of Food Science and Engineering of Ocean University of China, with the ethics review number being SPXY2024032601.

[0035] 2. Experimental method: Dexamethasone was used to construct a 10-day sarcopenia model in mice and the model was verified. During the modeling period, the sarcopenia mouse model group (SM group) and the animal Bifidobacterium subspecies F1-3-2 intervention group (F1-3-2 group) were intraperitoneally injected with 10 mg / kg / d dexamethasone injection every day, and the normal mouse group (HM group) was only given an intraperitoneal injection of normal saline corresponding to the body weight, and the subcutaneous administration volume was 0.1 mL / 10 g for 10 consecutive days. After the successful construction, the mice were gavage-intervention. Each mouse in the F1-3-2 group was gavaged with 0.1 mL of 1×10 9 The HM and SM groups were gavaged with an equal volume of PBS (purchased from Beijing Solaibao Biotechnology Co., Ltd.) containing a suspension of Bifidobacterium animalis subspecies F1-3-2 at a concentration of 100 CFU / mL. The mice were then gavaged for 5 weeks. Weekly body weights were recorded, and exercise capacity was tested. After the intervention, all mice were fasted for 12 hours but not water. After weighing, they were anesthetized and sacrificed with 2% sodium pentobarbital (0.25 mL / 100 g, intraperitoneal injection). Blood was collected from the ophthalmic venous plexus, and serum was separated for biochemical analysis. Muscle tissue was isolated, part of which was fixed in 4% paraformaldehyde for pathological analysis, and part was used to prepare muscle homogenate. Ileal and colonic tissues and colonic contents were isolated and stored at −80°C for subsequent testing.

[0036] (1) After killing mice, the tibialis anterior (TA), extensor digitorum longus (EDL), gastrocnemius (GA), and soleus (SOL) muscles were quickly dissected and weighed, and the skeletal muscle index (skeletal muscle index = muscle wet weight / fasting body weight × 100%) was calculated. The motor ability of the mice was analyzed by monitoring the tensile force during the experiment.

[0037] (2) Muscle histology was observed by H&E staining of the tibialis anterior and extensor digitorum longus muscle tissues of mice.

[0038] (3) Myofascial histology was observed by immunostaining the tibialis anterior and extensor digitorum longus muscles of mice with MyHC antibodies.

[0039] (4) Measure the levels of sarcopenia markers in mouse serum by ELISA.

[0040] 3. Test results:

[0041] The improvement effect of mouse muscle mass was obtained by weighing the mouse muscle mass and calculating the skeletal muscle index, such as Figure 1 (a) Figure 1 (b) and Figure 1 As shown in (c), compared with the HM group, the F1-3-2 group, namely the animal Bifidobacterium subspecies F1-3-2, significantly reduced the decline in muscle mass caused by sarcopenia; by analyzing the changes in athletic ability through the changes in the pulling force of mice, it was found that after intervention with the F1-3-2 group, namely the animal Bifidobacterium subspecies F1-3-2, the decline in athletic ability of sarcopenic mice was significantly improved, and muscle strength was significantly improved.

[0042] The muscle morphology of each group of mice was observed under an optical microscope for muscle histological analysis. Figure 2 (a) Figure 2 (b) and Figure 2 As shown in (c), the muscle fiber structure of the mice in the HM group was intact, and the muscle fibers were arranged neatly and tightly. In contrast, the skeletal muscle fibers of the mice in the SM group became thinner, the gaps between the muscle fibers increased, and the muscle fibers were arranged irregularly. After intervention with Bifidobacterium animalis subspecies F1-3-2, the muscle fibers of the F1-3-2 group were denser, the gaps between the muscle fibers were reduced, and the muscle quality was improved compared with the SM group.

[0043] The muscle histological analysis was performed by observing the fast and slow muscle ratios of each group of mice under an optical microscope. Figure 3 (a) Figure 3 (b) and Figure 3 As shown in (c), the fast muscle content of mice in the SM group was significantly decreased compared with that in the HM group, while the decrease in fast muscle content of mice in the F1-3-2 group, i.e., after intervention with animal Bifidobacterium subspecies F1-3-2, was alleviated, and muscle quality was improved.

[0044] The levels of prostaglandin E2 (PGE2), irisin and C-reactive protein (CRP) in mice were measured using a kit (purchased from Shanghai Jianglai Biotechnology Co., Ltd.). Figure 4 (a) Figure 4 (b) and Figure 4 As shown in (c), compared with the SM group, the F1-3-2 group, i.e., Bifidobacterium animalis subspecies F1-3-2, significantly reduced the elevated PGE2 and CRP levels caused by sarcopenia, alleviated the decline in irisin levels, alleviated the loss of whole-body muscle mass, and improved the sarcopenia phenotype.

[0045] 2. Mechanism of Bifidobacterium animalis subspecies F1-3-2 in improving sarcopenia in mice

[0046] 1. Experimental animals and methods: Based on the above experimental animals, the gene expression of skeletal muscle atrophy markers ubiquitin protein ligase Atrogin-1 and MuRF-1 in mouse muscle tissue was analyzed by qRT-PCR. Total muscle RNA was extracted using Trizol reagent. According to the instructions, a reverse transcription kit (purchased from Shanghai Aibimeng Biotechnology Co., Ltd.) was used to synthesize cDNA, and the levels of Atrogin-1 and MuRF-1 genes expressed in muscle were detected using a fluorescent quantitative PCR instrument. The relative amount of mRNA transcripts was calculated by the 2-ΔΔCT method and normalized by the control β-actin. The primers used are detailed in Table 1.

[0047] Table 1 Primers for qRT-PCR

[0048]

[0049] 2. Test results:

[0050] By detecting the mRNA expression levels of Atrogin-1 and MuRF-1 in muscle, the specific improvement pathway of Bifidobacterium animalis subspecies F1-3-2 on sarcopenia can be effectively reflected. Figure 5 (a) and Figure 5 As shown in (b), sarcopenia can cause the upregulation of the expression of muscle atrophy markers, while Bifidobacterium animalis subspecies F1-3-2 can significantly reduce the expression levels of Atrogin-1 and MuRF-1, thereby improving muscle atrophy.

[0051] 3. Regulatory Effects of Bifidobacterium animalis Subspecies F1-3-2 on Intestinal Microflora

[0052] 1. Experimental Animals and Methods: Based on the experimental animals described above, fecal samples were collected at the end of the experiment and immediately placed in liquid nitrogen and then stored at -80°C. Changes in the intestinal flora were analyzed by 16S rRNA microbiome gene sequencing.

[0053] 2. Test results:

[0054] The results of 16S rRNA microbiome gene sequencing analysis of fecal samples are as follows Figure 6 As shown, Bifidobacterium animalis subspecies F1-3-2 increased the relative abundance of Enterococcus and Bifidobacterium while decreasing the relative abundance of Dubosiella.

[0055] 4. Preparation of Freeze-dried Powder of Bifidobacterium animalis Subspecies F1-3-2

[0056] The activation, purification and freezing of the animal Bifidobacterium subspecies F1-3-2 strain are all based on MRS broth medium. The glycerol cryopreserved tube of the strain to be tested is inoculated into fresh MRS medium at a volume fraction of 2%, placed in an upright culture bag, and cultured anaerobically at 37°C for 48 hours. Repeat the activation, and the third generation of bacterial solution is used for subsequent experiments. Take 1mL of bacterial solution in a sterile centrifuge tube and centrifuge at 4000r / min for 5 minutes to remove the culture medium. Subsequently, the bacteria are washed twice with sterile PBS solution, collected by centrifugation, and resuspended, and the concentration of the strain is adjusted to 1×10 8 CFU / mL, and obtain the bacterial suspension of Bifidobacterium animalis subspecies F1-3-2 for use in subsequent experiments.

[0057] The bacterial suspension of animal Bifidobacterium subspecies F1-3-2 was centrifuged at 12000 rpm for 15 minutes in a tubular centrifuge to obtain bacterial sludge; the bacterial sludge was thoroughly mixed with a special freeze-drying protective agent (Shanghai Yuanye Biotechnology Co., Ltd.) at a volume ratio of 1:1.5 to obtain a mixture, which was placed in a freezing tray of a -70°C freezer for rapid pre-freezing to -30 to -45°C and maintained for 30 minutes; the temperature was raised to -28°C at a rate of 5°C / 30min, and this temperature was maintained until the vacuum reached 0.05MPa to complete the main drying stage; the temperature was raised to 10°C and this temperature was maintained until the vacuum reached 0.03MPa to complete the analytical drying stage; after taking out, the mixture was crushed with a granulator, then packaged in a sterile aluminum foil box and stored in an environment of -20°C, thereby completing the preparation of animal Bifidobacterium subspecies F1-3-2 freeze-dried powder.

[0058] The present invention provides the use of animal Bifidobacterium subspecies F1-3-2 in the preparation of a freeze-dried powder for alleviating sarcopenia. Animal Bifidobacterium subspecies F1-3-2 can effectively improve the decline of muscle mass, and can also regulate the intestinal flora to alleviate muscle atrophy. It can be widely used in the preparation of probiotic products such as freeze-dried bacterial powder, and enrich the probiotic library for the development of foods that improve sarcopenia.

[0059] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of Bifidobacterium animalis subsp F1-3-2 in the preparation of a medicament for preventing or treating sarcopenia.

2. The application according to claim 1, characterized in that The 16S rDNA nucleotide sequence of the animal Bifidobacterium subspecies F1-3-2 is shown in SEQ ID NO.1; the animal Bifidobacterium subspecies F1-3-2 was deposited in the China Center for Type Culture Collection on December 2, 2020, and the preservation address is Wuhan University, Wuhan, China, and the preservation number is: CCTCCNO: M2020832.

3. The application according to claim 1, characterized in that The animal Bifidobacterium subspecies F1-3-2 alleviates the loss of skeletal muscle mass and improves the phenotype of sarcopenia, thereby achieving the effect of preventing or treating sarcopenia.

4. The application according to claim 3, characterized in that The alleviation of skeletal muscle mass reduction is to reduce the intermuscular space and alleviate the decline in fast muscle content, thereby alleviating the reduction in whole body muscle mass by reducing the elevated levels of prostaglandin E2 and C-reactive protein and alleviating the decline in irisin levels.

5. The application according to claim 3, characterized in that: The improved phenotype of sarcopenia is to alleviate the decline in exercise capacity.

6. The application according to claim 3, characterized in that The pathway by which animal Bifidobacterium subspecies F1-3-2 prevents or treats sarcopenia is to reduce the expression of skeletal muscle atrophy markers, thereby beneficially regulating muscle protein metabolism and alleviating muscle tissue atrophy.

7. A method for preparing a freeze-dried powder comprising the Bifidobacterium animalis subspecies F1-3-2 of claim 1, characterized in that: The following steps are involved: The bacterial suspension of animal Bifidobacterium subspecies F1-3-2 was centrifuged to obtain bacterial sludge; the bacterial sludge was mixed with a freeze-drying protective agent in a volume ratio of 1:1 to 2 to obtain a mixture, which was quickly pre-frozen to -30 to -45°C at -70°C, maintained for 30 minutes, heated to -28°C at a rate of 5°C / 30 minutes, and maintained at this temperature until the vacuum reached 0.05 MPa, heated to 10°C and maintained at this temperature until the vacuum reached 0.03 MPa, and pulverized to obtain freeze-dried powder.

8. Use of the freeze-dried powder prepared by the preparation method according to claim 7 in preparing a drug for preventing or treating sarcopenia.

9. Use of Bifidobacterium animalis subspecies F1-3-2 in the preparation of a medicament for improving the phenotype of sarcopenia, characterized in that: The 16S rDNA nucleotide sequence of the animal Bifidobacterium subspecies F1-3-2 is shown in SEQ ID NO.1; the animal Bifidobacterium subspecies F1-3-2 was deposited in the China Center for Type Culture Collection on December 2, 2020, and the preservation address is Wuhan University, Wuhan, China, and the preservation number is: CCTCC NO: M2020832.

10. Use of Bifidobacterium animalis subspecies F1-3-2 in the preparation of a medicament for correcting intestinal flora imbalance caused by sarcopenia, characterized in that: The 16S rDNA nucleotide sequence of the animal Bifidobacterium subspecies F1-3-2 is shown in SEQ ID NO.1; the animal Bifidobacterium subspecies F1-3-2 was deposited in the China Center for Type Culture Collection on December 2, 2020, and the preservation address is Wuhan University, Wuhan, China, and the preservation number is: CCTCC NO: M2020832; the animal Bifidobacterium subspecies F1-3-2 corrects the intestinal flora imbalance caused by sarcopenia by increasing the relative abundance of Enterococcus and Bifidobacterium in the intestine and reducing the relative abundance of Dunaliella and Desulfovibrio.

Images