Salvia miltiorrhiza efficient guide editing system and application thereof

Abstract

The invention relates to an efficient guiding editing system for salvia miltiorrhiza and application of the efficient guiding editing system, and belongs to the technical field of gene editing. The invention provides a guided editing system suitable for salvia miltiorrhiza. The guided editing system comprises a U6complex promoter, a fusion protein and gRNA (guide Ribonucleic Acid), the fusion protein is a PEmax-MLH fusion protein; the nucleotide sequence for compiling the PEmax-MLH fusion protein is as shown in SEQ ID NO. 1; and the gRNA is pegRNA and sgRNA (small guide RNA). The constructed guided editing system realizes diversified and accurate editing in stable transformation of plants, the single-base replacement efficiency reaches 61.0%, the complex insertion replacement efficiency reaches 2.2%, the six-base replacement efficiency reaches 11.6%, and meanwhile, experiments prove that after the guided editing system is adopted to edit salvia miltiorrhiza, the accuracy of the edited salvia miltiorrhiza is greatly improved. The content of tanshinone and salvianolic acid of the edited plant is obviously improved.

Description

Technical Field

[0001] The present invention relates to the technical field of gene editing, and in particular to an efficient guided editing system for Salvia miltiorrhiza and applications thereof. Background Art

[0002] Salvia miltiorrhiza is a traditional Chinese medicinal herb and an important model plant for studying medicinal biosynthesis. Although CRISPR / Cas9-mediated gene knockout technology has been successfully applied in Salvia miltiorrhiza, precise genome editing remains challenging, and reports on related technologies are limited. Although base editors (BEs) based on cytosine (C) or adenine (A) deaminases fused to Cas9 can achieve base conversion from C to T or A to G, their editing range is limited to specific base types and a narrow activity window. Prime editor (PE) technology can precisely design target site sequences without introducing double-strand breaks or exogenous DNA templates, and has been used to achieve editing in various plants. However, its applicability in Salvia miltiorrhiza has not been reported.

[0003] Based on this, the present invention is proposed. Summary of the Invention

[0004] The purpose of the present invention is to provide an efficient guide editing system for Salvia miltiorrhiza and its application, so as to solve the problem in the prior art that the editing range of gene editors is limited to specific base types and a narrow activity window.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a guide editing system suitable for Salvia miltiorrhiza, the guide editing system comprising a U6 composite promoter, a fusion protein and a gRNA;

[0007] The fusion protein is PEmax-MLH fusion protein;

[0008] The nucleotide sequence of the compiled PEmax-MLH fusion protein is shown in SEQ ID NO.1;

[0009] The gRNA is pegRNA and sgRNA.

[0010] Preferably, the nucleotide sequence of the U6 composite promoter is shown in SEQ ID NO.2;

[0011] The U6 composite promoter includes a CaMV 35S enhancer, a CmYLCV promoter, and an AtU6-26 promoter;

[0012] The nucleotide sequence of the CaMV 35S enhancer is shown in SEQ ID NO.3;

[0013] The nucleotide sequence of the CmYLCV promoter is shown in SEQ ID NO.4;

[0014] The nucleotide sequence of the AtU6-26 promoter is shown in SEQ ID NO.5.

[0015] Preferably, the PEmax-MLH fusion protein comprises nSpCas9 protein, M-MLV reverse transcriptase, SmEF1α promoter and SmMLH1 dominant negative mutant;

[0016] The nucleotide sequence of the nSpCas9 protein is shown in SEQ ID NO.6;

[0017] The nucleotide sequence of the M-MLV reverse transcriptase is shown in SEQ ID NO.7;

[0018] The nucleotide sequence of the SmEF1α promoter is shown in SEQ ID NO.8;

[0019] The nucleotide sequence of the SmMLH1 dominant negative mutant is shown in SEQ ID NO.9.

[0020] Preferably, the 3' end of the pegRNA is connected to a tevopreQ1 element, and the nucleotide sequence of the tevopreQ1 element is shown in SEQ ID NO.10.

[0021] Preferably, the nucleotide sequence of the pegRNA is any one of SEQ ID NOs. 11 to 16.

[0022] Preferably, the nucleotide sequence of the sgRNA is any one of SEQ ID NOs. 17 to 22.

[0023] The present invention provides the application of the guide editing system in transforming Salvia miltiorrhiza genes.

[0024] The present invention provides the application of the guided editing system in cultivating high-quality Salvia miltiorrhiza plants.

[0025] The present invention has the following technical effects and advantages:

[0026] This study analyzed the feasibility of guide editing technology in Salvia miltiorrhiza and constructed an efficient guide editing system through a multi-level optimization strategy. The stacking of feasible strategies included: upgrading the basic PE2 architecture to PEmax (containing nSpCas9R221K / N394K / H840A mutations and optimized nuclear localization signals); introducing the tevopreQ1 element structural motif at the 3' end of the pegRNA to enhance stability; using the composite promoter U6composite to drive pegRNA expression, and regulating the PEmax fusion protein with the endogenous SmRPS5A promoter of Salvia miltiorrhiza; and co-expressing the dominant negative mutant SmMLH1Δ733-735 to inhibit the DNA mismatch repair (MMR) pathway. The constructed pU6 composite-PEmax-MLH dn guide editing system achieved diverse and precise editing in stably transformed plants: single-base transversion efficiency reached 61.0%, complex insertion substitution efficiency was 2.2%, and six-base substitution efficiency was 11.6%. In particular, the double amino acid substitution mutant TTEGCLVA→TTEGCKRA in the coding region of the SmHMGR3 gene (Tan I content increased by 2.1 times to 0.0291 mg / g, and DFSB increased by 1.5 times to 72.14 mg / g) confirmed the ability of guided editing to precisely regulate the metabolic network of tanshinone and salvianolic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a block diagram of the pSmU6-PE2 boot editing system;

[0028] Figure 2 Diagram of the editing process of the pSmU6-PE2 boot editing system;

[0029] Figure 3 This is a block diagram of the U6 composite-PE2 boot editing system;

[0030] Figure 4 is the structural diagram of pegRNA-tevopreQ1;

[0031] Figure 5 The editing efficiency of the pSmU6-PE2 and pU6 composite-PE2 guide editing systems;

[0032] Figure 6 is the structural diagram of PEmax fusion protein;

[0033] Figure 7 is the structural diagram of the ePPE-PEmax fusion protein;

[0034] Figure 8 is the structural diagram of PEmax-MLH fusion protein;

[0035] Figure 9 The editing efficiency of different guide editing systems at the pegRNA-11-tevopreQ1 and pegRNA-12-tevopreQ1 target sites;

[0036] Figure 10 The structural diagram of the pU6 composite-PEmax-MLH dn guided editing system;

[0037] Figure 11 Diagram of the editing process of different genes using the pU6 composite-PEmax-MLH dn-guided editing system;

[0038] Figure 12 Metabolite analysis results of SmHMGR3 gene-edited plants #19 and #39;

[0039] Figure 13 Phenotypic observation results of SmHMGR3 gene-edited plants. DETAILED DESCRIPTION

[0040] The present invention provides a guide editing system applicable to Salvia miltiorrhiza, wherein the guide editing system comprises a U6 composite promoter, a fusion protein and a gRNA;

[0041] The fusion protein is PEmax-MLH fusion protein;

[0042] The nucleotide sequence of the compiled PEmax-MLH fusion protein is shown in SEQ ID NO.1;

[0043]

[0044] The gRNA is pegRNA and sgRNA.

[0045] In the present invention, the nucleotide sequence of the U6 composite promoter is shown in SEQ ID NO.2;

[0046]

[0047] The U6 composite promoter includes a CaMV 35S enhancer, a CmYLCV promoter, and an AtU6-26 promoter;

[0048] The nucleotide sequence of the CaMV 35S enhancer is shown in SEQ ID NO.3;

[0049] The SEQ ID The nucleotide sequence of NO.3 is: ATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGG AAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAT;

[0050] The nucleotide sequence of the CmYLCV promoter is shown in SEQ ID NO.4;

[0051] The SEQ ID The nucleotide sequence of NO.4 is: TGGCAGACATACTGTCCCACAAATGAAGATGGAATCTGTAAAAGAAAACGCGTGAAATAATGCGTCTGACAAAGGTTAGGTCGGCTGCCTTTAATCAATACCAAAGTGGTCCCTACCACGATGGAAAAACTGTGCAGTCGGTTTGGCTTTTTCTGACGAACAAATAAGATTCGTGGCCGACAGGTGGGGGTCCACCATGTGAAGGCATCTTCAGACTCCAATAATG GAGCAATGACGTAAGGGCTTACGAAATAAGTAAGGGTAGTTTGGGAAATGTCCACTCACCCGTCAGTCTATAAATACTTAGCCCCTCCCTCATTGTTAAGGGAGCAAAATCTCAGAGAGATAGTCCTAGAGAGAGAAAGAGAGCAAGTAGCCTAGAAGTAGTCAAGGCGGCGAAGTATTCAGGCACGTGCCAGGAAGAAGAAAAGCCAAGACGACGAAAACAGGTAAGAGCTAAGC;

[0052] The nucleotide sequence of the AtU6-26 promoter is shown in SEQ ID NO.5.

[0053] The nucleotide sequence of SEQ ID NO.5 is: ATCTAGGTAAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTAGTGATTG;

[0054] In the present invention, the PEmax-MLH fusion protein includes nSpCas9 protein, M-MLV reverse transcriptase, SmEF1α promoter and SmMLH1 dominant negative mutant;

[0055] The PEmax-MLH fusion protein is composed of a nuclear localization sequence NLS-1, a nSpCas9 protein, a Linker-1 sequence, a nuclear localization sequence NLS-2, a Linker-2 sequence, an M-MLV reverse transcriptase, a nuclear localization sequence NLS-3, a Linker-3 sequence, a c-mycNLS sequence, a Linker-4 sequence, a rbcS-E9T sequence, a SmEF1α promoter, and a SmMLH1 dominant negative mutant connected in sequence;

[0056] The nucleotide sequence of the nuclear localization sequence NLS-1 is shown in SEQ ID NO.23;

[0057] The nucleotide sequence of SEQ ID NO.23 is: ATGAAGAGGACAGCCGATGGCAGCGAGTTCGAGAGCCCTAAGAAGAAGAGGAAGGTGGGATCC;

[0058] The nucleotide sequence of the nSpCas9 protein is shown in SEQ ID NO.6;

[0059]

[0060] The nucleotide sequence of the Linker-1 sequence is shown in SEQ ID NO.24;

[0061] The nucleotide sequence of SEQ ID NO.24 is: TCAGGCGGCTCATCTGGCGGGTCAAAGCGCACAGCCGACGGCTCTGAGTTCGAGAGC;

[0062] The nucleotide sequence of the nuclear localization sequence NLS-2 is shown in SEQ ID NO.25;

[0063] The nucleotide sequence of SEQ ID NO.25 is: CCTAAGAAGAAGCGCAAGGTG;

[0064] The nucleotide sequence of the Linker-2 sequence is shown in SEQ ID NO.26;

[0065] The nucleotide sequence of SEQ ID NO.26 is: TCAGGCGGCTCTTCAGGCGGCAGC;

[0066] The nucleotide sequence of the M-MLV reverse transcriptase is shown in SEQ ID NO.7;

[0067]

[0068] The nucleotide sequence of the nuclear localization sequence NLS-3 is shown in SEQ ID NO.27;

[0069] The nucleotide sequence of SEQ ID NO.27 is: TCTGGCGGCTCTAAGCGGACTGCGGATGGGTCTGAGTTCGAGTCACCAAAGAAGAAGAGGAAGGTG;

[0070] The nucleotide sequence of the Linker-3 sequence is shown in SEQ ID NO.28;

[0071] The nucleotide sequence of SEQ ID NO.28 is: GGCTCTGGC;

[0072] The nucleotide sequence of the c-myc NLS sequence is shown in SEQ ID NO.29;

[0073] The nucleotide sequence of SEQ ID NO.29 is: CCTGCTGCTAAGCGCGTGAAGCTCGAT;

[0074] The nucleotide sequence of the Linker-4 sequence is shown in SEQ ID NO.30;

[0075] The nucleotide sequence of SEQ ID NO.30 is: ACTAGT;

[0076] The nucleotide sequence of the rbcS-E9T sequence is shown in SEQ ID NO.31;

[0077] The nucleotide sequence of SEQ ID NO.31 is as follows: AGAGCTTTCGTTCGTATCATCGGTTTCGACAACGTTCGTCAAGTTCAATGCATCAGTTTCATTGCGCACACACCAGAATCCTACTGAGTTTGAGTATTATGGCATTGGGAAAACTGTTTTTCTTGTACCATTTGTTGTGCTTGTAATTTACTGTGTTTTTTATTCGGTTTTCGCTATCGAACTGTGAAATGGAAATGGATGGAGAAGAGTTAATGAATGATATGGTCCTTTTGTTCATTCTCAAATTAATATTATTTGTTTTTTCTCTTATTTGTTGTGTGTTGAATTTGAAATTATAAGAGATATGCAAACATTTTGTTTTGAGTAAAAATGTGTCAAATCGTGGCCTCTAATGACCGAAGTTAATATGAGGAGTAAAACACTTGTAGTTGTACCATTATGCTTATTCACTAGGCAACAAATATATTTTCAGACCTAGAAAAGCTGCAAATGTTACTGAATACAAGTATGTCCTCTTGTGTTTTAGACATTTATGAACTTTCCTTTATGTAATTTTCCAGAATCCTTGTCAGATTCTAATCATTGCTTTATAATTATAGTTATACTCATGGATTTGTAGTTGAGTATGAAAATATTTTTTAATGCATTTTATGACTTGCCAATTGATTGACAAC;

[0078] The nucleotide sequence of the SmEF1α promoter is as shown in SEQ ID NO.8;

[0079]

[0080] The nucleotide sequence of the dominant negative mutant of SmMLH1 is shown in SEQ ID NO.9;

[0081]

[0082] In the present invention, the 3' end of the pegRNA is connected to a tevopreQ1 element, and the nucleotide sequence of the tevopreQ1 element is shown in SEQ ID NO.10;

[0083] The nucleotide sequence of SEQ ID NO.10 is: CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA.

[0084] In the present invention, the nucleotide sequence of the pegRNA is any one of SEQ ID NOs. 11 to 16.

[0085] The nucleotide sequence of SEQ ID NO.11 is: CGCCGTCGCCGCCCTGGTTAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGGATATCCACAACCAGGGCG;

[0086] The nucleotide sequence of SEQ ID NO.12 is: CCAGCAACATAAACAGAGCCGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTGATTCCAGGCTCTGTTTATGTT;

[0087] The nucleotide sequence of SEQ ID NO.13 is: AATGGCAGTAACTTAACTGTGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCATCATCTTCCAAACGTTAAGTTACTG;

[0088] The nucleotide sequence of SEQ ID NO.14 is: TCCATCGAGGTCGGCACCGTGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTGCCGCCTCCCCTGGGTGCCGACCT;

[0089] The nucleotide sequence of SEQ ID NO.15 is: GGCGACGACGGAGGGGTGCTGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGT CGGTGCTTGTGCTCGCTCTCTTGCACCCCTCCG;

[0090] The nucleotide sequence of SEQ ID NO.16 is: CTTTAGCTCTGGGGCGGCGGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTC GGTGCGCCTGGAATAGCAGCCGTGACCGCCCCA.

[0091] In the present invention, the nucleotide sequence of the sgRNA is any one of SEQ ID NOs. 17 to 22;

[0092] The nucleotide sequence of SEQ ID NO.17 is: CCTCCTCCCCTAAAGCCTCTGAT;

[0093] The nucleotide sequence of SEQ ID NO.18 is: CCTTCAACCCGGCAGCCACCGCT;

[0094] The nucleotide sequence of SEQ ID NO.19 is: CCCTGCCTATTTGGACAGTTGA;

[0095] The nucleotide sequence of SEQ ID NO.20 is: CCTCAACCTGCTGGGAGTCAAGG;

[0096] The nucleotide sequence of SEQ ID NO.21 is: CCCTCTACAGGGACGCCATGACC;

[0097] The nucleotide sequence of SEQ ID NO.22 is: CCGGCAGCCACCGCTTTCTCCGG.

[0098] The present invention provides the application of the guide editing system in transforming Salvia miltiorrhiza genes.

[0099] The present invention provides the application of the guided editing system in cultivating high-quality Salvia miltiorrhiza plants.

[0100] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0101] Example 1: Construction of a guided editing system for Salvia miltiorrhiza

[0102] 1. Guide the construction of editing system

[0103] The guide editing system consists of three parts: nCas9-MMLV fusion protein, prime editing guide RNA (pegRNA) and nicking sgRNA (single-guide RNA). To verify the feasibility of guide editing in Salvia miltiorrhiza, the mammalian PE system was reconstructed into a plant binary vector. The endogenous promoter SmRPS5A of Salvia miltiorrhiza was used to drive the expression of plant codon-optimized nSpCas9 (H840A)-MMLV fusion protein, and the SmU6 promoter was used to drive the expression of pegRNA and sgRNA. The SmU6 promoter, pegRNA, sgRNA and PE2 fusion protein were combined to construct the pSmU6-PE2 guide editing system. Its structure is shown in the figure. Figure 1 shown.

[0104]

[0105]

[0106]

[0107] 2. Effect verification

[0108] To verify the editing effect of the guide system, a dual-luciferase reporter system (Dual-LucM) was constructed: the ultra-sensitive NanoLuc luciferase was transformed into an inactive NanoLucM by introducing a 10-nucleotide deletion (causing a frameshift mutation). NanoLuc activity can only be restored when the guide editor accurately repairs the frameshift mutation; firefly luciferase is used as an internal reference for data normalization.

[0109] The dual-luciferase reporter system (Dual-LucM) consists of a polyA sequence, fLUC, SIEF1α, 35s, NanoLuc containing a 10-nucleotide deletion, and NOS sequences;

[0110]

[0111]

[0112] The nucleotide sequence of 35s is: AGCTTGCATGCCTGCAGGTCCCCAGATTAGCCTTTTCAATTTCAGAAA GAATGCTAACCCACAGATGGTTAGAGAGGCTTACGCAGCAGGTCTCATCAAGACGATCTACCCGAGCAATAATCTCCAGGAAATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGATTCAGGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATCAGAAGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAGATTGGAGTCTCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGAACACGGGGGAC (SEQ ID NO.37);

[0113] The nucleotide sequence of NanoLuc with a 10-nucleotide deletion is: ATGGTCTTCACACTCGAAGATTTCGTTGGG GACTGGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAA(SEQ ID NO.38);

[0114] The complete nucleotide sequence of NanoLuc is: ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCC GTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCC TGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTG TAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAA(SEQ ID NO.39).

[0115] Two sets of gRNAs (pegRNA-11 and specific nicking sgRNA11, pegRNA-12 and specific nicking sgRNA12) were designed for the inactivated NanoLucM target, containing 9-nucleotide and 8-nucleotide primer binding sites (PBS), and a 22-nucleotide reverse transcription template (RT template), and matched with specific sgRNA to produce a cut 34-nt or 77-nt downstream of the pegRNA cutting site. The guide editing system composed of pSmU6-PE2, pegRNA11, and sgRNA A11 and the guide editing system composed of pSmU6-PE2, pegRNA12, and sgRNA11 were co-transfected into Salvia miltiorrhiza protoplasts with the Dual-LucM fluorescent reporter system, and the non-inactivated Dual-LucM fluorescent system was used as a positive control. The guide editing process is as follows Figure 2 shown.

[0116] The nucleotide sequence of the pegRNA-11 is: AGCCGGCTGTCTGTCGCCAGTCCCCAACGAA (SEQ ID NO. 40);

[0117] The target sequence of pegRNA-11 is: TCGAAGATTTCGTTGGGGACTGG (SEQ ID NO.41);

[0118] The nucleotide sequence of the sgRNA11 is: CCTTGAACAGGGAGGTGTGTCCA (SEQ ID NO.42);

[0119] The nucleotide sequence of pegRNA-12 is: CTGGCGACAGACAGCCGGCTACAACCTGGA (SEQ ID NO. 43);

[0120] The target sequence of pegRNA-11 is: CCGGCTACAACCTGGACCAAGTC (SEQ ID NO. 44);

[0121] The nucleotide sequence of the sgRNA11 is: TGTCCGTAACTCCGATCCAAAGG (SEQ ID NO.45);

[0122] After co-culturing the transfected Salvia miltiorrhiza protoplasts for 24 hours, the detection showed that the pSmU6-PE2-guided editing system produced editing effects at both the pegRNA11 and pe gRNA12 target sites, successfully restoring NanoLuc activity, but its average editing efficiency was only 1.08%, which has no application prospects.

[0123] Example 2: Improvement of the Guided Editing System

[0124] 1. Promoter Improvement

[0125] The present invention optimizes pegRNA expression through promoter engineering: the original SmU6 promoter is replaced with a composite U6 composite promoter (SEQ ID NO.2) composed of a CaMV 35S enhancer (SEQ ID NO.3), a CmYLCV promoter (SEQ ID NO.4) and an AtU6-26 promoter (SEQ ID NO.5), the U6 composite promoter (SEQ ID NO.2) is used to drive the expression of pegRNA and sgRNA, and the SmRPS5A promoter is used to drive the expression of the PE2 fusion protein (SEQ ID NO.34), thereby obtaining a U6compo site-PE2 guide editing system with the following structure: Figure 3 shown.

[0126] Based on the Dual-LucM fluorescent reporter system, protoplast transient transformation experiments were performed at the pegRNA-11 and pegRNA-12 target sites. Furthermore, to address the problem that the 3' end of pegRNA is susceptible to nuclease degradation, resulting in functional defects, the tevopreQ1 element (SE Q ID NO.10) structure was introduced. This is an optimized element derived from the preQ1 riboswitch aptamer (obtained by deleting non-essential bases). After fusion with pegRNA, it can form a pseudoknot secondary structure at the 3' end to enhance stability. TevopreQ1 was integrated into the 3' end of pegRNA to obtain pegRNA-tevopreQ1, whose structure is shown in the figure. Figure 4 As shown, the nucleotide sequence of tRNA is: GCACCAG TGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA (SEQ ID NO.46); the nucleotide sequence of HDV is: GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGC TGGGCAACATGCTTCGGCATGGCGAATGGGAC (SEQ ID NO.47).

[0127] TevopreQ1 was integrated into the 3' end of pegRNA-11 and pegRNA-12, respectively, to construct pegRNA-11-tevopreQ1 and pegRNA-12-tevopreQ1, and their editing efficiencies were tested in the pSmU6-PE2 and pU6 composite-PE2 guide editing systems. The editing efficiency results of the pSmU6-PE2 and pU6 composite-PE2 guide editing systems are shown in Figure 2. Figure 5 shown.

[0128] according to Figure 5 The addition of the tevopreQ1 element to the pegRNA increased the editing efficiency of the SmU6-PE2-guided editing system to 1.85%, compared to 1.08% without it. This represents a 1.98-fold increase in efficiency, but there was no significant difference in efficiency compared to the pU6 composite-PE2-guided editing system. In contrast, the introduction of the tevopreQ1 element to the pU6 composite-PE2-guided editing system increased the editing efficiency by 2.61-fold compared to the initial version. These improvements are consistent with findings in rice studies that tevopreQ1 and composite promoters synergistically enhance PE efficiency, demonstrating the synergistic effect of different pegRNA structure optimization methods.

[0129] 2. Improvement of fusion protein structure.

[0130] Although the optimized pegRNA improves the guide editing (PE) efficiency in Salvia miltiorrhiza protoplasts, its editing efficiency is still at a low level. In order to break through this bottleneck, the present invention systematically optimizes the molecular structure of the PE fusion protein. First, the PE2 fusion protein is upgraded to the PEmax fusion protein: the R221K / N394K mutation is introduced into nSpCas9 (H840A) to form the nSpCas9 protein (SEQ ID NO.6), and the SV40 nuclear localization signal (nuclear localization sequence NLS-1, SEQ ID NO.23) is inserted between nSpCas9 and M-MLV reverse transcriptase (SEQ ID NO.48), and the c-Myc NLS sequence (SEQ ID NO.29) is added to the C-terminus to obtain the PEmax fusion protein. The results are as follows: Figure 6

[0131]

[0132] The PEmax fusion protein was used to drive the expression of pegRNA and sgRNA using the U6 composite promoter (SEQ ID NO.2), and the SmRPS5A promoter was used to drive the expression of PEmax fusion protein (SEQ ID NO.48) to obtain the guide editing system pU6 composite-PEmax; through the Dual-LucM reporter system test, it was found that the pU6 composite-PEmax guide editing system achieved an average editing efficiency of 3.88% at the pegRNA-11-tevopreQ1 and pegRNA-12-tevopreQ1 target sites, which was 3.60 times higher than the initial pSmU6-PE2 guide editing system (1.08%) and 1.38 times higher than the promoter-optimized pU6 composite-PE2 guide editing system (2.82%).

[0133] Furthermore, the present invention also carried out a dual transformation of M-MLV: (1) its RNase H domain was deleted to stabilize the RNA-DNA heteroduplex in the sgRNA-DNA and nCas9-RT-pegRNA complexes; (2) the viral nucleocapsid (NC) protein was fused to the N-terminus of M-MLV via the SV40 NLS and the XTEN-32 amino acid linker peptide, and the nucleic acid annealing activity of NC was used to enhance the reverse transcription process, thereby obtaining the transformed M-MLV reverse transcriptase (SEQ ID NO. 8) and constructing the enhanced ePPE-PEmax fusion protein, the structure of which is shown in FIG. Figure 7

[0134] The U6 composite promoter (SEQ ID NO.2) was used to drive the expression of pegRNA and sgRNA, and the SmRPS5A promoter was used to drive the expression of ePPE-PEmax fusion protein (SEQ ID NO.50) to obtain the guide editing system pU6 composite-ePPE-PEm ax; through the Dual-LucM reporter system test, it was found that the average editing efficiency of the pU6 composite-ePPE-PEmax guide editing system at the pegRNA-11-te vopreQ1 and pegRNA-12-tevopreQ1 targets was 3.84%, which was not significantly improved compared with the average editing efficiency of the pU6composite-PEmax guide editing system (3.88%). This shows that due to the complexity of the Salvia miltiorrhiza genome, the optimization strategies that are effective in monocotyledons (such as rice and wheat) may not be fully applicable to medicinal plants.

[0135] To explore universal synergistic strategies, the present invention further studied the regulation of the DNA mismatch repair (MMR) pathway, which is highly conserved across different plants. First, a dominant negative mutant of the endogenous SmMLH1 (a core effector of the MMR pathway) in Salvia miltiorrhiza, SmMLH1Δ733-735 (missing amino acids 733-735 to disrupt its function), was constructed. This dominant negative mutant (SEQ ID NO. 9) was then expressed. To avoid repeated use of the same promoter to trigger gene excision, the endogenous SmEF1α promoter (SEQ ID NO. 8) was used to replace Sm RPS5A (SEQ ID NO. 32) to drive expression of the dominant negative SmMLH1 mutant.

[0136] Finally, the nuclear localization sequence NLS-1 (SEQ ID NO.23), nSpCas9 protein (SEQ ID NO.6), Linker-1 sequence (SEQ ID NO.24), nuclear localization sequence NLS-2 (SEQ ID NO.25), Linker-2 sequence (SEQ ID NO.26), modified M-MLV reverse transcriptase (SEQ ID NO.7), nuclear localization sequence NLS-3 (SEQ ID NO.27), Linker-3 sequence (SEQ ID NO.28), c-myc NLS sequence (SEQ ID NO.29), Linker-4 sequence (SEQ ID NO.30), rbcS-E9T sequence (SEQ ID NO.31), SmEF1α promoter (SEQ ID NO.8) and SmMLH1 dominant negative mutant (SEQ ID NO.9) were sequentially connected to obtain PEmax-MLH fusion protein (SEQ ID NO.1), whose structure is as shown. Figure 8 shown.

[0137] The U6 composite promoter (SEQ ID NO. 2) was used to drive the expression of pegRNA and sgRNA, and the SmRPS5A promoter was used to drive the expression of PEmax-MLH fusion protein (SEQ ID NO. 1) to obtain the pU6 composite-pPEmax-MLH dn guide editing system. The editing efficiency of the pSmU6-PE2, pU6 composite-PEmax, pU6composite-ePPE-PEmax, and pU6 composite-pPEmax-MLH dn guide editing systems at the pegRNA-11-tevopreQ1 and pegRNA-12-tevopreQ1 target sites was tested using the Dual-LucM reporter system. The editing efficiency of different guide editing systems at the pegRNA-11-tevopreQ1 and pegRNA-12-tevopreQ1 target sites is shown in Figure 2. Figure 9 shown.

[0138] according to Figure 9 It can be seen that the average editing efficiency of the pU6 composite-pPEmax-MLH dn-guided editing system reaches 5.92%, which is 5.49 times, 1.53 times and 1.54 times higher than that of the pS mU6-PE2, pU6 composite-PEmax and pU6 composite-ePPE-PEmax-guided editing systems, respectively.

[0139] In summary, through a multi-level strategy of promoter optimization, protein engineering, and MMR pathway inhibition, the pU6 co-expression-pPEmax-MLH dn-guided editing system was finally constructed, which showed the highest editing activity in Salvia miltiorrhiza. Figure 10 The above results demonstrate that the synergistic effect of genome repair pathway regulation is significantly better than the pegRNA stability enhancement strategy, and this result is consistent with the conclusions of monocotyledonous plant research.

[0140] Example 3: Verification of the Boot Editing System

[0141] To validate the ability of the optimized pU6 composite-PEmax-MLH dn guide editing system to edit endogenous genes in stably transformed Salvia miltiorrhiza plants, this study selected five key genes in the tanshinone and phenolic acid metabolism pathway—SmHMGR1 (ID: EU680958.1), Sm KSL1 (ID: EF635966.2), SmCPS1 (ID: KC814639.1), SmHMGR2 (ID: FJ747636.1), and SmHMGR 3 (ID: JN831102.1)—as targets. Six pegRNAs (containing 8-12 nucleotides, a PBS with a Tm of ≈30°C, and an 11-20 nucleotide RT template) and accompanying sgRNAs were designed for these genes, as shown below:

[0142] pegRNA1 (SEQ ID NO. 11) and sgRNA1 (SEQ ID NO. 17) for editing the SmHMGR1 gene;

[0143] The target sequence corresponding to pegRNA1 is: CGCCGTCGCCGCCCTGGTTATGG (SEQ ID NO. 51);

[0144] pegRNA2 (SEQ ID NO. 12) and sgRNA2 (SEQ ID NO. 18) for editing the SmKSL1 gene;

[0145] The target sequence corresponding to pegRNA2 is: CCAGCAACATAAACAGAGCCTGG (SEQ ID NO. 52);

[0146] pegRNA3 (SEQ ID NO. 13) and sgRNA3 (SEQ ID NO. 19) for editing the SmCPS1 gene;

[0147] The target sequence corresponding to pegRNA3 is: AATGGCAGTAACTTAACTGTTGG (SEQ ID NO. 53);

[0148] pegRNA4 (SEQ ID NO. 14) and sgRNA4 (SEQ ID NO. 20) for editing the SmHMGR2 gene;

[0149] The target sequence corresponding to pegRNA4 is: TCCATCGAGGTCGGCACCGTCGG (SEQ ID NO. 54);

[0150] pegRNA5 (SEQ ID NO. 15) and sgRNA5 (SEQ ID NO. 21) for editing the SmHMGR3 gene;

[0151] The target sequence corresponding to pegRNA5 is: GGCGACGACGGAGGGGTGCTTGG (SEQ ID NO. 55);

[0152] pegRNA6 (SEQ ID NO. 16) and sgRNA6 (SEQ ID NO. 22) for editing the SmKSL1 gene;

[0153] The target sequence corresponding to pegRNA6 is: CCGCCGCCGCCCCAGAGCTAAAG (SEQ ID NO.56).

[0154] The designed pegRNA and sgRNA combinations were combined with the SmRPS5A promoter, PEmax-MLH fusion protein (SEQ ID NO. 1), and U6 composite promoter (SEQ ID NO. 3) to construct the pU6 composite-PEmax-MLH dn guide editing system for editing different genes. Purple flowered Salvia miltiorrhiza was transformed by Agrobacterium GV3101 and selected with hygromycin to obtain edited plants. The editing results of the pU6 composite-PEmax-MLH dn guide editing system on different genes were determined by Sanger sequencing and subcloning analysis. The results are shown in Table 1. The editing process of different genes by the pU6 composite-PEmax-MLH dn guide editing system is shown in Table 1. Figure 11 As shown, Figure 11 Figure A in the middle represents the editing process of SmKSL1-pegRNA2, Figure B represents the editing process of SmCPS1-pegRNA3, Figure C represents the editing process of SmHMGR3-pegRNA5, and Figure D represents the editing process of SmKSL1-pegRNA6.

[0155] Table 1 Editing results of different genes using the pU6 composite-PEmax-MLH dn-guided editing system

[0156]

[0157] According to Table 1 and Figure 11 The pU6 composite-PEmax-MLH dn-guided editing system successfully detected precise editing at pegRNA 2 of the SmKSL1 gene, pegRNA 3 of the SmCPS1 gene, pegRNA 5 of the SmHMGR3 gene, and pegRNA 6 of the SmKSL1 gene. Among them, SmKSL1-pegRNA2 achieved a CA(+7) transversion with an editing efficiency of 61.0% (50 / 82); SmC PS1-pegRNA3 completed a TG-GT(+1) double base substitution in one strain (1 / 45, 2.2%); and SmKSL1-pegRNA6 achieved a complex insertion substitution of ATCACCGCCG→AATAGCAGCCGTGA(+1) in two strains (2 / 90, 2.2%). It is worth noting that the TTEGCLVA domain of SmH MGR3 (encoding HMG-CoA reductase, the rate-limiting enzyme in the mevalonate pathway) was designed with pegRNA5 to undergo a six-base substitution of TTG GTC→AAGAGA(+3) (corresponding to the amino acid mutation TTEGCLVA→TTEGCKRA), and 5 (5 / 43, 11.6%) edited plants were successfully obtained, of which 4 were precise replacements and 1 (SmHMGR3-pegRNA5#41) was a partial replacement of GTC→AGA.

[0158] The metabolites of SmHMGR3 gene-edited plants #19 and #39 were analyzed by UPLC-TQ-MS, and the phenotype of SmHMGR3 gene-edited plant #19 was observed. The metabolite analysis results of SmHMGR3 gene-edited plants #19 and #39 are as follows: Figure 12 As shown in Figure 2, the phenotypic observation results of SmHMGR3 gene-edited plants are as follows: Figure 13 shown.

[0159] according to Figure 12 and Figure 13 It can be seen that the tanshinone I (Tan I) content of mHMGR3-pegRNA5#19 is 0.0291 mg / g, and the salvianolic acid B (DFSB) content is 63.86 mg / g, which are 2.1 times and 1.3 times higher than those of the wild-type plants, respectively, and the plant phenotype is normal; the Tan I content of SmH MGR3-pegRNA5#39 is 0.014 mg / g, the dihydrotanshinone I (DHT) content is 0.029 mg / g, and the salvianolic acid B (DFSB) content is 72.14 mg / g, which are 1.6 times, 1.8 times, and 1.5 times higher than those of the wild-type plants, respectively.

[0160] In summary, the present invention realizes the pU6 composite-PEmax-MLH dn guide editing system to achieve multi-type precise editing in stable Salvia miltiorrhiza plants, and verifies the application potential of guide editing for enhancing the metabolism of medicinal ingredients through the SmHMGR3 target.

[0161] As can be seen from the above embodiments, the present invention provides a guide editing system suitable for Salvia miltiorrhiza, wherein the guide editing system includes a U6 composite promoter, a fusion protein and a gRNA; the fusion protein is a PEmax-MLH fusion protein. The present invention analyzes the feasibility of guide editing technology in Salvia miltiorrhiza, and constructs an efficient guide editing system through a multi-level optimization strategy. The feasible strategies include: upgrading the basic PE2 architecture to PEmax (containing nSpCas9 R221K / N394K / H840A mutations and nuclear localization signal optimization); introducing the tevopreQ1 element structural motif at the 3' end of pegRNA to enhance stability; using the composite promoter U6 composite to drive peg RNA expression, and using the endogenous SmRPS5A promoter of Salvia miltiorrhiza to regulate the PEmax fusion protein; co-expressing the dominant negative mutant SmMLH1Δ733-735 to inhibit the DNA mismatch repair (MMR) pathway. The constructed pU6 composite-PEmax-MLH dn guide editing system achieved diverse and precise editing in stably transformed plants: single-base transversion efficiency reached 61.0%, complex insertion substitution efficiency 2.2%, and hexabase substitution efficiency 11.6%. In particular, a double amino acid substitution mutant in the coding region of the SmHMGR3 gene, TTEGCLVA→TTEGCKRA (Tan I content increased 2.1-fold to 0.0291 mg / g and DFSB increased 1.5-fold to 72.14 mg / g), demonstrated the ability of guide editing to precisely regulate the tanshinone and salvianolic acid metabolic networks.

[0162] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A guided editing system suitable for Danshen, characterized in that: The guide editing system includes a U6 composite promoter, a fusion protein, and a gRNA; The fusion protein is PEmax-MLH fusion protein; The nucleotide sequence of the compiled PEmax-MLH fusion protein is shown in SEQ ID NO.1; The gRNA is pegRNA and sgRNA.

2. The guide editing system according to claim 1, characterized in that The nucleotide sequence of the U6 composite promoter is shown in SEQ ID NO.2; The U6 composite promoter includes a CaMV 35S enhancer, a CmYLCV promoter, and an AtU6-26 promoter; The nucleotide sequence of the CaMV 35S enhancer is shown in SEQ ID NO.3; The nucleotide sequence of the CmYLCV promoter is shown in SEQ ID NO.4; The nucleotide sequence of the AtU6-26 promoter is shown in SEQ ID NO.

5.

3. The guide editing system according to claim 1, characterized in that The PEmax-MLH fusion protein includes nSpCas9 protein, M-MLV reverse transcriptase, SmEF1α promoter and SmMLH1 dominant negative mutant; The nucleotide sequence of the nSpCas9 protein is shown in SEQ ID NO.6; The nucleotide sequence of the M-MLV reverse transcriptase is shown in SEQ ID NO.7; The nucleotide sequence of the SmEF1α promoter is shown in SEQ ID NO.8; The nucleotide sequence of the SmMLH1 dominant negative mutant is shown in SEQ ID NO.

9.

4. The guide editing system according to claim 1, wherein: The 3' end of the pegRNA is connected to a tevopreQ1 element, and the nucleotide sequence of the tevopreQ1 element is shown in SEQ ID NO.

10.

5. The guide editing system according to claim 4, characterized in that: The nucleotide sequence of the pegRNA is any one of SEQ ID NOs. 11 to 16.

6. The guide editing system according to claim 1, characterized in that: The nucleotide sequence of the sgRNA is any one of SEQ ID NOs. 17 to 22.

7. Use of the guide editing system according to any one of claims 1 to 6 in modifying Salvia miltiorrhiza genes.

8. Use of the guided editing system according to any one of claims 1 to 6 in cultivating high-quality Salvia miltiorrhiza plants.

Images