Phytophthora capsici development and pathopoiesis regulation microRNA and application thereof

Abstract

The invention discloses six kinds of microRNAs (microRNA, miRNA), namely miR2, miR3, miR8, miR53, miR117 and miR157 capable of regulating and controlling the development and pathopoiesis of Phytophthora capsici, and application of the six kinds of microRNAs, namely miR2, miR3, miR8, miR53, miR117 and miR157. The miRNAs have a ribonucleic acid sequence as shown in any of SEQ ID NO.1-6. The invention also discloses a preparation method of the miRNAs. The miRNAs involved in the invention can participate in the development and pathopoiesis of the phytophthora capsici, after the expression of the miRNAs is influenced, the capability of producing sporangium and zoospore of the phytophthora capsici is greatly reduced, the pathopoiesis capability is almost lost, and the miRNAs conservatively exist in different phytophthora capsici. The gene provided by the invention has a very high application value in preventing and treating crop epidemic diseases caused by phytophthora pathogenic bacteria such as phytophthora capsici, and the miRNAs are taken as targets to develop nucleic acid pesticides, so that the miRNAs have important significance in controlling the occurrence and prevalence of the crop epidemic diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to six microRNAs (miR2, miR3, miR8, miR53, miR117 and miR157) identified from Phytophthora capsici and conserved in different Phytophthora species that can regulate the development and pathogenicity of Phytophthora capsici, and their applications. Background Art

[0002] Phytophthora capsici is a typical plant pathogenic oomycete of the genus Phytophthora in the family Pythium, with a widespread distribution worldwide. As an important soil-borne pathogen, it has a broad host range, infecting over 70 vegetable crops from 26 families, including peppers and tobacco in the Solanaceae family, as well as leguminous and cucurbitaceae families. P. capsici causes plant diseases from the seedling stage to the fruiting stage, leading to rot of the rhizomes and fruits. In severe cases, it can cause plant wilting and even sudden death, significantly impacting crop yield and quality, resulting in significant economic losses. Zoospores produced by P. capsici sporangia are a significant source of secondary infection and can be transported through rain, soil, and air currents. Upon attaching to the surface of the host plant, zoospores become resting spores, which then germinate and produce hyphae to infect the host. Heterothallic mating can also occur when two mating types are present in the field, producing oospores. Oospores are resilient and, under suitable environmental conditions, can germinate and produce hyphae to infect the host.

[0003] RNA interference (RNAi), a gene silencing phenomenon triggered by double-stranded RNA, is a ubiquitous phenomenon in organisms and can be categorized into transcriptional and post-transcriptional mechanisms. Hairpin-shaped or double-stranded RNA can be enzymatically cleaved to form small RNAs (20-30 bp). These RNAs then form gene silencing complexes with the protein Argonaute (AGO), thereby exerting their gene silencing function. One evolutionarily conserved class of small RNAs, called microRNAs (miRNAs), plays an irreplaceable role in mediating RNAi. RNAi is crucial for biological growth, development, and pathogenicity, and miRNAs are essential for catalyzing RNAi by specifically recognizing their target RNAs. Disrupting the production of zoospores and oospores in P. capsici and reducing hyphal growth, further inhibiting the pathogenicity of the pathogen, could disrupt the normal disease cycle of P. capsici and control the prevalence of plant diseases caused by P. capsici. In addition, miRNAs are usually highly conserved among closely related species, and the genus Phytophthora includes many important plant pathogens. Therefore, regulation based on these miRNAs is expected to simultaneously prevent and control multiple crop diseases. Summary of the Invention

[0004] Based on this, the inventors' research has discovered six miRNAs with important biological functions in P. capsici. These conserved miRNAs within the Phytophthora genus are closely associated with mycelial growth rate, sporangium production and morphology, and the number of zoospores and oospores. They also influence the pathogenicity of P. capsici. Therefore, by controlling growth and development-regulating miRNAs, it is possible to block the normal infection of P. capsici, thereby controlling (inhibiting or blocking) the large-scale spread and epidemic of P. capsici.

[0005] Therefore, the present invention provides six miRNAs identified from Phytophthora capsici, whose nucleotide sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6.

[0006] A second object of the present invention is to provide a small RNA molecule having a reverse complementary sequence to the miRNAs, wherein the nucleotide sequence of the small RNA molecule is SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.19 or SEQ ID No.20.

[0007] A third object of the present invention is to provide an application of the RNA molecule; characterized in that the application is any one or more of the following A1)-A5):

[0008] A1) Application in regulating (increasing or decreasing) the growth rate of Phytophthora mycelium;

[0009] A2) Application in regulating (increasing or decreasing) the yield of Phytophthora sporangium;

[0010] A3) Application in regulating (increasing or decreasing) the production of zoospores inhibited by Phytophthora;

[0011] A4) Application in regulating (increasing or decreasing) the pathogenicity of Phytophthora to hosts;

[0012] A5) Use in inhibiting and / or killing Phytophthora. Preferably, the Phytophthora is Phytophthora capsici, most preferably Phytophthora capsici LT1534.

[0013] Preferably, the applications described in A1) to A5) are achieved by combining multiple miRNAs involved in this patent individually or simultaneously.

[0014] The applications described in A1) to A5) can be achieved by knocking out the genes encoding the miRNAs shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, or SEQ ID No. 6, or inhibiting their expression. Knocking out the gene sequences containing the miRNAs described above by homologous recombination or CRISPR gene editing technology can weaken the pathogenicity of Phytophthora, and such applications are also included in the invention of this patent.

[0015] A fourth object of the present invention is to provide the use of the above-mentioned RNA molecules or biomaterials as antibacterial or fungicide targets for screening antibacterial and / or fungicide agents for Phytophthora; the antibacterial or fungicide can inhibit or inactivate the miRNAs shown in SEQ ID Nos. 1-6 of Phytophthora, thereby changing the morphology of Phytophthora colonies and / or slowing hyphal growth, inhibiting the production of sporangia and zoospores, and / or reducing hyphal growth rate, and / or reducing the ability to infect the host and / or pathogenicity (virulence) to the host, thereby inhibiting or killing Phytophthora. The use of antisense RNA of the above-mentioned miRNA in the above-mentioned A1)-A5) also falls within the scope of protection of the present invention.

[0016] Experiments have shown that the miRNAs provided by the present invention play a role in the growth and development of pepper phytophthora itself. The miRNA silencing or overexpression mutants obtained by using PEG-CaCl2-mediated protoplast transformation technology combined with the use of antisense RNA or the transformation of miRNA mimics have significant changes in their growth and development compared to the wild-type parent strain, mainly including: after the miRNA content is imbalanced, the colony morphology of pepper phytophthora changes, the hyphae growth slows down, sporangia and zoospores are not produced, and it cannot cause disease to tobacco leaves; therefore, the six miRNAs in pepper phytophthora can play an important role in the asexual reproduction, sexual reproduction and infection of pepper phytophthora. Based on the conservation of the six miRNAs involved in the present invention in the genus Phytophthora, the present invention provides technical support for further exploring the growth and development process and pathogenic mechanism of pepper phytophthora, and provides a technical basis for the prevention and control of plant diseases caused by various phytoplanktons including pepper phytophthora and the development of new fungicides. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The expression levels of 6 miRNAs in the mycelial stage of Phytophthora capsici with sporangium.

[0018] Note: ** indicates significant difference, P<0.01.

[0019] Figure 2 The phenotypic changes in the growth and development of pepper phytophthora after silencing 6 miRNAs respectively.

[0020] Note: Different letters indicate significant differences, P<0.05.

[0021] Figure 3 The changes in pathogenicity of tobacco leaves inoculated with Phytophthora capsici after silencing six miRNAs respectively.

[0022] Note: Different letters indicate significant differences, P<0.05. DETAILED DESCRIPTION

[0023] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The materials and reagents used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0024] The wild-type strain LT1534 of Phytophthora capsici was donated by Professor Kurt Lammour of Tennessee State University. Information on the LT1534 strain is published in "Jason ES, Andrea LV, Howard SJ, Gregory MV, Michael AG, Maryn OC, Nicholas D., Jennifer J., Joann M., Kurt H.L., and Christine DS (2021). High-Quality Reference Genome Sequence for the Oomycete Vegetable Pathogen Phytophthora capsici Strain LT1534. Plant Microbiol. 10, 21." and is publicly available from China Agricultural University. The above strains are only used in the examples of the present invention. In fact, when applying the selection markers described in the present invention, any commercially available source can be used to obtain Phytophthora strains.

[0025] The above strains have been identified by existing morphological and molecular biological methods.

[0026] The culture medium and reagent formula used in this study are as follows:

[0027] Commonly used V8 medium: 340 mL V8, 4.76 g CaCO3, dilute to 3.4 L with deionized water, then add 51 g agar to prepare a solid medium, and sterilize with high pressure moist heat at 121°C for 20 min.

[0028] PM medium (Pea Mannitol): Add 125 g of peas to 1 L of deionized water and sterilize at 121°C for 20 min. Filter the pea soup with gauze. Add 91.1 g of Mannitol, 2 g of CaCO3, and 1 g of CaCl2 to the pea soup. Dose distilled water to 1 L. For solid culture medium, add 15 g of agar powder and sterilize at 121°C for 20 min.

[0029] The culture medium used for protoplast transformation or gene knockout experiments is as follows:

[0030] NPB medium (Nutrient pea broth): Add 125g of peas to 1L of deionized water, sterilize at 121°C for 20 minutes, and filter through gauze to obtain the pea broth. Add 2.0g of Yeast Extract, 5.0g of Glucose, 5.0g of Mannitol, 5.0g of Sorbitol, 2.0g of CaCO3, 0.1g of CaCl2, 0.5g of MgSO4, 0.5g of MgSO4, 3.0g of KNO3, 1.0g of K2HPO4, and 1.0g of KH2PO4, and adjust the volume to 1L with deionized water. If preparing a solid medium, add 15g of agar powder and sterilize at 121°C for 20 minutes. After sterilization, add 2mL of vitamin stock (6.7×10 -7 g / mL; Pyridoxine-HCl 6.0×10 -4 g / mL; Biotin 6.7×10 -7 g / mL; Thiamine-HCl 1.3×10 -3 g / mL; L-inositol 4.0×10 -5 g / mL; Nicotinic acid 4.0×10 -5 g / mL; Riboflavin 5.0×10 -5 g / mL) and Vitamin stock 2mL (FeC6H5O7·3H2O 5.4×10 -4 g / mL; Na2MoO4·H2O 3.0×10 -5 g / mL; ZnSO4·7H2O 3.8×10 - g / mL; MgSO4·H2O 3.8×10 -5 g / mL; H3BO3 2.5×10 -5 g / mL; CuSO4·5H2O7.5×10 -4 g / mL).

[0031] The reagents for protoplast transformation or gene knockout experiments are prepared as follows:

[0032] Enzyme hydrolysis solution: Prepare before use, lysing enzymes (Lysing Enzymes from Trichoderma harzianum, L1412, Sigma) 0.12 g, cellulase (yakult R10) 0.12 g, 0.8 M Mannitol 10 mL, ultrapure water 8 mL, 0.5 M KCl 800 μL, 0.5 M MES (pH 5.7) 800 μL, 0.5 M CaCl2 400 μL, sterilize by filtration through a 0.22 μm filter membrane.

[0033] W5 solution: KCl 0.1 g, CaCl2·2H2O 4.6 g, NaCl 2.25 g, glucose 7.8 g, dissolve in ultrapure water to 250 mL, and filter sterilize with a 0.22 μm filter membrane.

[0034] PEG-CaCl2 solution (40% w / v): Prepare immediately before use: 6 g PEG4000, 3.75 mL 0.8 M Mannitol, 3 mL ultrapure water, 3 mL 0.5 M CaCl2, and sterilize by filtration through a 0.22 μm filter membrane.

[0035] MMG solution (250 mL): Mannitol 18.22 g, 0.5 M MES (pH 5.7) 2.0 mL, MgCl2·6H2O 0.76 g, dilute to 250 mL with ultrapure water, and sterilize by filtration with a 0.22 μm filter membrane.

[0036] Example 1: Acquisition of six growth-regulating miRNAs in Phytophthora capsici

[0037] In this embodiment, the six pepper phytophthora growth and development regulating miRNAs were obtained based on RNA immunoprecipitation sequencing and bioinformatics analysis. Specifically, FLAG immunomagnetic beads were used to enrich and purify the proteins in pepper phytophthora transformants expressing four Argonaute proteins with FLAG tags, and then total RNA was extracted from the protein samples. The potential functional small RNA molecules bound to the Argonaute protein were discovered based on sequencing technology. After screening by ribosome-associated RNA, the precursor sequences of these small RNA molecules (sequences of about 100bp upstream and downstream of the miRNA) were analyzed to see whether they could form a typical secondary structure (predicted and evaluated by software such as RNAfold and Ufold), or the miRBase database (https: / / www.mirbase.org / ) was directly compared to screen for miRNAs with homologous precursor sequences or mature sequences. The potential functional small RNAs that met one of the above two conditions were simultaneously explored by qPCR to see whether the small RNA molecules were truly expressed in the phytophthora (based on The Green miRNA Two-Step qRT-PCR SuperMix Kit was used for assays. Ultimately, six reliable Phytophthora-specific miRNAs were identified from over a million small RNA sequences in a sequencing database. The precursor sequences of these miRNAs can be amplified from P. capsici genomic DNA or cDNA via PCR, and the mature miRNA sequences or their antisense strands can be synthesized artificially.

[0038] SEQ ID NO. 1-6 are shown below:

[0039] SEQ ID NO.1(miR2):

[0040] >CAAGUCUCCAUCGAAACCUCG

[0041] SEQ ID NO.2(miR3):

[0042] >UCCUGGACUCACUUCCUCUUC

[0043] SEQ ID NO.3(miR8):

[0044] >CUGGUUCGCUUGGUACGCUAA

[0045] SEQ ID NO.4(miR53):

[0046] >UGAUCGUCACACGCACGGGCUU

[0047] SEQ ID NO.5(miR117):

[0048] >UAAACUUGCGCUGAUAGGGCUCCAUU

[0049] SEQ ID NO.6(miR157):

[0050] >UUCAGGAAGAGGAAGAACGCAUGUC

[0051] The precursor sequence information is as follows (capital letters indicate the mature miRNA sequence and its complementary paired sequence, and lowercase letters indicate other non-paired sequences):

[0052] miR2 (SEQ ID NO.7):

[0053] acttcgtcttttgacatctctagataacttcttcttcttcttctctgcttgccgaaccatacaagaCAAGTCTCCATCGAAACCCGtgtggcactcgatct tgcggtcattctggcaattgattatgggctgccagactcttcgcaaagtgccacacgaggtttcgatggagacttgtctcgttgggcttcataatgcggatac

[0054] miR3 (SEQ ID NO.8):

[0055] agagaggaagtgagtccaggaaacatacagcctgtatgttTCCTGGACTCACTTCCTCTTCga

[0056] miR8 (SEQ ID NO.9):

[0057] ggcgcgagagttcacttcgcCTACCAAGCGTACCAACGCcgcacttcagcacacgagcgcatggcaaacgttacaatgcttactcgcgctcgtttgctgagctgcagcgCTGGTTCGCTTGGTACGCTAAatgcactcttgccac

[0058] miR53 (SEQ ID NO.10):

[0059] tacaccgacgcacaagcgacgaccacggttgtgcgtcaaTCTTAGAGAGTCCCACGAACTTGGCaactggatggcatgagttatttacaaattgaatcatactgccgatcttatctgcgtTGATCGTCACACGCACGGGCTAacacgggagctatgaccatagtttcatccttggttgcgcggacgctgtgaacgcgaatatcatcgacacgatgcctactcctctgggcagggtacgcacccatacgcctagcttatctgc

[0060] miR117 (SEQ ID NO.11):

[0061] tgtcgtcacgacgcttggtcacttgtgctaacatttgaaatgggcagtccgtcgtgtttagtttgtgtgatgtccgcttacccgtagaTCTGTCACGCTCTGACCACCCGtgggtacagaTAAACTTGCGCTGATAGGGCTCCATTtcagtaggtacgagcggtatctccgaatctggtagcccttggtaccgaacttggctgcgaaggtgagcgttacggcgagtgatattaatcacctcctccaccacgattttctgacg

[0062] miR157 (SEQ ID NO.12):

[0063] tctcaaccttcgatgacaggtgtaaaacgccctcggtatgaggaaggaatcaatcttagccagttaacttctcgcgaagacgTTCAGGAAGAGGAAGAACGCATGTCTCTAGTCCTCAGTCTCCTTGCgattcgccatgtgccggaaccaaaaacgtattacggggcgatgcgttcatcgtatgcagacaaatggcatgcagctactgactcagaataccagtcact

[0064] Example 2. Expression verification of miRNA in Phytophthora capsici

[0065] Use The Green miRNA Two-Step qRT-PCR SuperMix Kit was used to measure the expression of the six miRNAs selected above. The mature sequence of miRNA was used as the upstream primer of fluorescent quantitative PCR (the base U was replaced by base T). -△△Ct Methods The expression levels of miRNA were calculated and normalized with the expression level of Actin gene. The results are shown in Figure 1 As shown in the figure, the expression levels of the six miRNAs were significantly lower than those of the reference genes, but the expression of these six miRNAs could be detected in the mycelial stage of Phytophthora capsici with sporangia.

[0066] Table 1. Primer sequences used to detect miRNA expression

[0067]

[0068] Example 3: Obtaining 6 Silencing Transformants of Phytophthora capsici miRNA

[0069] In this example, gene silencing is performed based on protoplast transformation of RNA molecules antagonizing miRNA, and a PEG-CaCl2-mediated protoplast transformation method is used to prepare miRNA silencing transformants. The method of oomycete genetic transformation is disclosed in the document "Wang, Z., Tyler, BM, Liu, X. Protocol of Phytophthora capsici transformation using the CRISPR-Cas9 system. Plant Pathogenic Fungi and Oomycetes. Humana Press, New York, NY, 2018: 265-274."

[0070] Table 2. Antisense small RNA sequences for miRNA silencing

[0071] miRNA inhibitory molecule number sequence Inhibitor miR2 CGAGGUUUCGAUGGAGACUUG Inhibitor miR3 GAAGAGGAAGUGAGUCCAGGA Inhibitor miR8 UUAGCGUACCAAGCGAACCAG Inhibitor miR53 AAGCCCGUGCGUGUGACGAUCA Inhibitor miR117 AAUGGAGCCCUAUCAGCGCAAGUUUA Inhibitor miR157 GACAUGCGUUCUUCCUUCCUGAA

[0072] The six miRNA gene silencing transformants were obtained by directly transforming the reverse complementary small RNA (antagonistic miRNA, Table 2) of the miRNA obtained in Example 1 into the protoplasts of Phytophthora capsici LT1534 through PEG-CaCl2-mediated transformation. The grown transformants were screened by culturing on G418-resistant V8 solid medium plates at 25°C. The mycelium of suspected transformants was collected, and RNA was extracted for qPCR expression verification. The results showed that the Ct values ​​of the miRNA qPCR were all greater than 35 (expression was undetectable). Six miRNA silencing transformants were obtained.

[0073] Example 4: Analysis of biological characteristics of miRNA-silenced transformants of Phytophthora capsici

[0074] 1. Mycelial growth rate detection

[0075] The wild-type pepper Phytophthora strain LT1534 and the miRNA-silencing transformant obtained in Example 3 were cultured in V8 solid medium (15 mL of medium was poured into a 9 cm culture dish) and cultured in the dark at 25° C. for 4 days. The colony diameter of each strain was measured by the cross-cross method, and each strain was repeated 3 times.

[0076] The results showed that the mycelial growth rate of all tested miRNA silenced transformant strains was significantly decreased compared with the wild-type pepper Phytophthora strain LT1534 and the control sRNA treatment ( Figure 2 The experimental results show that the miRNA regulating the growth and development of Phytophthora capsici is involved in regulating the hyphal growth of Phytophthora capsici and the formation of normal colony morphology.

[0077] 2. Sporangium Quantity Detection

[0078] The wild-type pepper Phytophthora strain LT1534 and the miRNA-silencing transformant obtained in Example 3 were inoculated into V8 solid medium (15 mL of medium was poured into a 9 cm culture dish), cultured in the dark at 25°C for 4 days, and then cultured in the light at 25°C for 5 days to induce spore production. The morphology of the sporangium on the culture dish was observed under a microscope and the number was counted. This was repeated three times for each strain.

[0079] The results showed that compared with the wild-type pepper phytophthora strain LT1534 and the control sRNA treatment, the sporangium production of the miRNA-silenced transformants obtained in Example 3 was significantly reduced except for miR53, indicating that the five growth and development regulatory miRNAs of pepper phytophthora except miR53 affected the production of pepper phytophthora sporangium ( Figure 2 ).

[0080] 3. Zoospore Count and Resting Spore Germination Detection

[0081] Zoospore production: Induce sporangia in P. capsici according to the above method. Subsequently, add sterile water and incubate at 4°C and then at room temperature for 0.5 h to allow the sporangia to release zoospores. Aspirate the liquid and vortex to convert the zoospores into resting spores. Pipette 20 μL of the liquid, cover with a coverslip, and observe and count the zoospores under an optical microscope with a 10x objective.

[0082] Acute spore germination rate: Acute spores were obtained according to the above method and cultured in the dark at room temperature for 6-8 hours (germination was considered when the germ tube was longer than the acute spore diameter). When the acute spore germination rate of the wild-type strain was greater than 50%, the number of acute spores germinated in the gene knockout transformants was counted and the germination rate was calculated.

[0083] The results showed that compared with the wild-type pepper phytophthora strain LT1534 and the control sRNA treatment, the miRNA silenced transformants obtained in Example 3 had significantly reduced zoospore production except for miR53 and miR157; however, only the resting spore germination rate of miR8 and mi53 was significantly downregulated, indicating that the growth and development regulatory miRNAs of pepper phytophthora partially affected the production of zoospores and resting spore germination of pepper phytophthora. Figure 2 ).

[0084] IV. Pathogenicity test of detached leaves of transformants

[0085] The tobacco plant variety used for the test was Nicotiana benthamiana, planted in seedling trays on peat soil and grown for 4 to 6 weeks. Wild-type Phytophthora capsici strain LT1534 and the miRNA-silencing transformant obtained in Example 2 were inoculated onto V8 solid medium (15 mL of medium was poured into a 9 cm culture dish) and cultured in the dark at 25°C for 4 days. A 5 mm bacterial cake was punched out from the edge of the colony using a borer. Tobacco leaves from the same leaf position were collected and inoculated with a bacterial cake near the center of the leaf vein. Five leaves were inoculated with each strain. After 4 days of culture at 25°C in the dark with humidity (RH = 60%-80%), the diameter (mm) of the lesions of Phytophthora capsici infected tobacco leaves was measured using the cross-hatch method.

[0086] The results showed that compared with the wild-type pepper Phytophthora strain LT1534, the miRNA silenced transformants obtained in Example 3, except for miR3, showed a significant decrease in pathogenicity to tobacco leaves ( Figure 3 This suggests that miRNAs other than miR3 that regulate the growth and development of P. capsici are involved in regulating the biological pathways by which P. capsici infects host plants. Particularly noteworthy are miR53 and miR157, as silencing both miRNAs can completely eliminate the pathogenicity of P. capsici.

[0087] Therefore, miRNAs that regulate the growth and development of pepper phytophthora can regulate the virulence of pepper phytophthora. Inhibiting the functions of miR2 / 8 / 53 / 117 / 157 can control the infection process of pepper phytophthora and control the large-scale occurrence of the disease.

Claims

1. Six miRNAs identified from Phytophthora capsici, whose nucleotide sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No.

6.

2. A small RNA molecule having a reverse complementary sequence to the miRNAs of claim 1, characterized in that: The nucleotide sequence of the small RNA molecule is SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.19 or SEQ ID No.

20.

3. The use of the RNA molecule according to claim 1 or 2, characterized in that The application is any one or more of the following A1)-A5): A1) Application in regulating the growth rate of Phytophthora mycelium; A2) Application in regulating the production of Phytophthora sporangium; A3) Application in regulating the inhibition of zoospore production by Phytophthora; A4) Application in regulating the pathogenicity of Phytophthora to hosts; A5) Application in inhibiting and / or killing Phytophthora pathogens.

4. The use according to claim 3, characterized in that The phytophthora is the pepper phytophthora (Phytophthora capsici).

5. The use according to claim 4, characterized in that The phytophthora is pepper phytophthora (Phytophthora capsici) LT1534.

6. Use of the RNA molecule according to claim 1 or 2 in screening pesticide preparations that inhibit the growth and development of Phytophthora and / or its pathogenicity to hosts.

Images