Application of Keratin5 low expression combined PADI3 nuclear translocation as prediction marker for invasion and metastasis of head and neck squamous cell carcinoma

By constructing a shRNA interference vector with low expression of Keratin5 combined with PADI3 nuclear translocation, it is characterized by localization at the front end of head and neck squamous cell invasion and metastasis, solving the problem of unclear metastasis mechanism of Keratin5 in head and neck squamous cell invasion and metastasis, providing effective metastasis prediction markers and diagnosis and treatment strategies, and optimizing the clinical diagnosis and treatment of head and neck squamous cell carcinoma.

CN120555601APending Publication Date: 2025-08-29SICHUAN CANCER HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510744970.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-05
Publication Date
2025-08-29

AI Technical Summary

Technical Problem

The specific mechanism of action of Keratin5 in the invasion and metastasis of head and neck squamous cell carcinoma in the prior art is unclear, especially its correlation with part of the epithelial-mesenchymal transformation process, the expression and subcellular localization of downstream molecules during the metastasis process, resulting in a lack of effective metastasis prediction markers and optimized diagnosis and treatment strategies.

Method used

By constructing a shRNA interference vector with low expression of Keratin5 combined with PADI3 nuclear translocation, it is characterized by localization at the tumor-stromal boundary at the front end of the invasion of metastasis, it is verified that the region co-expressed by KRT5 and PADI3 forms microdomain differences and specific patterns in tumor tissues, as a predictive marker of head and neck squamous cell carcinoma metastasis.

Benefits of technology

The region co-expressed by KRT5 and PADI3 forms specific microdomain differences and specific patterns in tumor tissues, which can be used as an effective marker for metastasis of head and neck squamous cell carcinoma, optimize clinical diagnosis and treatment strategies, and provide new molecular markers and intervention targets.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555601A_ABST
    Figure CN120555601A_ABST
Patent Text Reader

Abstract

The invention discloses application of Keratin5 low expression and PADI3 nuclear translocation in serving as a predictive marker for invasion and metastasis of head and neck squamous cell carcinoma, belongs to the technical field of biological medicine, verifies clinical applicability of KRT5 low expression and / PADI3 nuclear translocation (namely KRT5low / PADI3nucle) serving as a predictive index so as to fill the blank of the prior art, and provides a novel predictive marker for invasion and metastasis of head and neck squamous cell carcinoma. A novel molecular marker and an intervention target spot are provided for precise diagnosis and treatment of the head and neck squamous cell carcinoma; the KRT5 and PADI3 co-expression region forms a specific micro-domain difference and a specific mode in tumor tissues, can be used as an effective head and neck squamous cell carcinoma metastasis prediction marker, and has important scientific significance and application value for optimizing clinical diagnosis and treatment strategies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of low Keratin5 expression combined with PADI3 nuclear translocation as a marker for predicting invasion and metastasis of head and neck squamous cell carcinoma. Background Art

[0002] Squamous cell carcinoma (SCC) is a common malignant tumor of the head and neck, and its invasive and metastatic potential directly impacts clinical treatment and prognosis. Studies have shown that cytokeratin 5 (KRT5) is specifically expressed in SCC and could serve as a potential biomarker for this tumor, closely associated with tumor progression, invasion, and metastasis. In particular, the presence of metastatic lesions in the cervical lymph nodes is a key factor influencing treatment options and prognosis. Existing literature reports that expression of KRT5 or its homologous protein, Keratin 14 (KRT14), is significantly associated with cervical micrometastasis in HNSCC, suggesting that it may play an important role in tumor metastasis. However, the specific mechanism of action of KRT5 in the invasion and metastasis of head and neck squamous cell carcinoma remains unclear. In particular, there is a lack of in-depth research and definitive experimental evidence on how KRT5 participates in the invasion and metastasis of tumor cells, its association with key steps such as partial epithelial-mesenchymal transition (p-EMT), and the dynamic changes in the expression levels and subcellular localization of KRT5 and its downstream effector molecules during metastasis. Therefore, elucidating the molecular mechanism of KRT5 in the invasion and metastasis of head and neck squamous cell carcinoma and clarifying the expression and localization characteristics of its downstream molecules are of great scientific significance and application value for developing effective predictive markers for head and neck squamous cell carcinoma metastasis and optimizing clinical diagnosis and treatment strategies. Summary of the Invention

[0003] The purpose of the present invention is to provide an application of low Keratin5 expression combined with PADI3 nuclear translocation as a marker for predicting invasion and metastasis of head and neck squamous cell carcinoma, so as to solve the above problems.

[0004] In order to achieve the above object, the technical solution adopted by the present invention is as follows: application of low expression of Keratin5 combined with nuclear translocation of PADI3 as a predictive marker for invasion and metastasis of head and neck squamous cell carcinoma.

[0005] As a preferred technical solution, low expression of Keratin5 combined with nuclear translocation of PADI3 is characteristically located at the front end of invasion and metastasis, namely, the tumor-stroma boundary.

[0006] As a preferred technical solution, the shRNA interference vector used to construct the low expression of Keratin5 is selected from one of shKRT5-1, shKRT5-2, and shKRT5-3, and the nucleotide sequences of shKRT5-1, shKRT5-2, and shKRT5-3 are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0007] in,

[0008] The sequence of SEQ.ID NO: 1 is: CCAGAGGAGTTGGACCAGTCAACATCTCGAGATGTTGACTGGTCCAACTCCTTTTTTTG

[0009] The sequence of SEQ.ID NO: 2 is: CCGGGCTTGTGGAGTGGGTGGCTATCTCGAGATAGCCACCCACTCCACAAGCTTTTTG

[0010] The sequence of SEQ.ID NO: 3 is: CCGGCCGCAGTTCTATATTCTGCTTCTCGAGAAGCAGAATATAGAACTGCGGTTTTTG

[0011] The present invention verifies the relationship between low expression of KRT5 and nuclear translocation of PADI3 (i.e., KRT5 low / PADI3 nuclear ) as a predictive indicator to fill the gap in existing technologies and provide new molecular markers and intervention targets for the precise diagnosis and treatment of head and neck squamous cell carcinoma.

[0012] Compared with the existing technology, the advantages of the present invention are that the areas where KRT5 and PADI3 are co-expressed form specific micro-domain differences and specific patterns in tumor tissues, which can be used as effective predictive markers for head and neck squamous cell carcinoma metastasis and have important scientific significance and application value for optimizing clinical diagnosis and treatment strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Figure 2 is the result of KRT5 gene knockdown in FaDu and CAL 27 cells;

[0014] Figure 2 The results of the co-IP experiments of KRT5 and PADI3 in 9FaDu and CAL 27 cells are shown;

[0015] Figure 3 Western blot results of PADI3 before and after KRT5 knockdown in FaDu and CAL 27 cells;

[0016] Figure 4 Western blot results of KRT5 and PADI3 in the cytoplasm and nucleus of FaDu and CAL 27 cells before and after KRT5 knockdown;

[0017] Figure 5 The immunofluorescence results of KRT5 and PADI3 in the cytoplasm and nucleus of FaDu and CAL 27 cells before and after KRT5 knockdown;

[0018] Figure 6 Western blot results of PADI3 in the cytoplasm and nucleus of FaDu and CAL 27 cells before and after PADI3 overexpression;

[0019] Figure 7 Western blot results of EMP-related marker proteins in FaDu and CAL 27 cells before and after PADI3 overexpression;

[0020] Figure 8 To analyze the correlation results between KRT5 and PADI3 genes in HNSCC patients;

[0021] Figure 9 These are the results of immunohistochemistry and immunofluorescence experiments of KRT5 and PADI3 in the cytoplasm and nucleus of HNSCC tumor tissue. DETAILED DESCRIPTION

[0022] The present invention will be further described below with reference to the embodiments.

[0023] Example 1:

[0024] Construction of KRT5 gene knockdown cell line

[0025] In this example, three shRNA interference vectors were constructed for knocking down the KRT5 gene in FaDu cells and CAL 27 cells. They were named shKRT5-1, shKRT5-2, and shKRT5-3, respectively. Their nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0026] Specific operations:

[0027] (1) Plasmid amplification

[0028] ① Place the prepared LB liquid medium on a shaker at 250 rpm and 37°C and incubate for 0.5 h;

[0029] ② Take 200 μL of shKRT5-1, shKRT5-2, and shKRT5-3 monoclonal bacterial suspension and inoculate them into three conical flasks containing LB liquid culture medium respectively, and place them on a shaker at 250 rpm and 37°C overnight.

[0030] (2) Plasmid extraction using Hispeed Plasmid Midi kit

[0031] ① Collect the bacterial suspension into a 50 mL centrifuge tube, centrifuge at 6000 g for 15 min at 4°C, and discard the supernatant;

[0032] ② Add 6 mL of P1 solution and mix by pipetting repeatedly until the precipitate is completely dissolved. Add 6 mL of P2 solution, cover the centrifuge tube and mix by inverting 4-6 times. Let it stand at room temperature for 5 minutes. Add LyseBlue liquid until the liquid turns blue.

[0033] ③ Add 6 mL of P3 solution and mix thoroughly by inversion until the liquid turns colorless. Pour the solution into the QIA filter cartridge and incubate at room temperature for 10 min.

[0034] ④ Prepare a QIAGEN-tip column, add 4 mL of QBT buffer and allow it to flow naturally. After the QBT buffer has flowed through, pressure filter the liquid in the QIA filter cartridge into the tip column and allow it to filter naturally.

[0035] ⑤ Add 20mL QC to wash the tip filter column;

[0036] ⑥ Add 5 mL of QF to elute and collect the plasmid DNA in a 15 mL centrifuge tube;

[0037] ⑦ Add 3.5 mL of isopropanol, mix thoroughly, and let stand at room temperature for 5 minutes;

[0038] ⑧ Filter the solution through a filter membrane to allow the plasmid DNA to adsorb on the filter membrane, add 2 mL of 70% ethanol to filter and wash the filter membrane, and repeat the washing twice;

[0039] ⑨ Add 800 μL of DEPC water to dissolve the DNA and detect the plasmid concentration using Nano Drop.

[0040] (3) Lentiviral packaging

[0041] ① Collect 293T cells by centrifugation and count them. Seed 2 million cells per dish on a 10 cm dish and incubate in a 5% CO2 incubator at 37°C for 24 h.

[0042] ② Prepare a viral plasmid mixture at a ratio of 3:2.7:0.3 for virus plasmid:dR8.9:VSV-G. Next, add 580 μL of opti-MEM / DMEM to the plasmid mixture and incubate at room temperature for 5 minutes. Then, add 18 μL of X-tremeGene HP and incubate at room temperature for 15 minutes. After incubation, add the mixture to 293T cells. Incubate at 37°C, 5% CO₂ for 10 hours, then switch to 20% FBS complete medium.

[0043] ③ After 24 hours, collect the supernatant into a 15 mL centrifuge tube and freeze at -80°C. Add 9 mL of 20% FBS complete medium and continue culturing for 48 hours. Collect the supernatant a second time and mix it with the first supernatant. Centrifuge at 1500 rpm for 5 minutes, collect the supernatant, and aliquot. After aliquoting, freeze at -80°C until needed.

[0044] (4) Tumor cell transfection and positive screening

[0045] ① Digest and collect FaDu and CAL 27 cells, count them, and seed them onto 10 cm dishes at a rate of 200,000 cells per dish. Add complete culture medium and incubate in a 37°C, 5% CO2 incubator for 24 h.

[0046] ② Take a 15 mL centrifuge tube, add 9 mL of culture medium without double-antibody 10% FBS, 1 mL of packaged virus, and 10 μL of 10 μg / mL polybrene, mix well, and add to the culture dish containing tumor cells for incubation;

[0047] ③ 24 hours after transfection, the culture medium was replaced with fresh complete culture medium containing dual antibodies and 2 μg / mL puromycin for screening.

[0048] Western Blot experiment:

[0049] (1) Sample loading: Select an appropriate 8% SDS-PAGE or 12% SDS-PAGE precast gel and fix it to the electrophoresis device. Fill the device with 1× Running Buffer and carefully remove the comb. Add 30µg of denatured protein sample to the sample well and 5µL of marker to the marker well.

[0050] (2) Electrophoresis: Connect the electrophoresis device to the power supply and adjust the voltage (upper layer: stacking gel voltage 80V, electrophoresis for about 30 minutes; lower layer: separation gel voltage 120V, electrophoresis for about 120 minutes) until the bromophenol blue approaches the bottom of the separation gel, then turn off the power supply and remove the connected wires;

[0051] (3) Transfer (wet transfer): Carefully remove the electrophoresis gel, cut off the concentrated gel and place the gel in the transfer buffer; put 1× Transfer Buffer into a large iron box, soak 2 sponges, 2 filter papers, and 1 PVDF membrane (the PVDF membrane was activated in methanol for 30 seconds before being taken out and placed in the transfer buffer), and assemble the transfer device in the order of 1 layer of sponge, 1 layer of filter paper, gel, PVDF membrane, 1 layer of filter paper, and 1 layer of sponge; put the assembled device into the electrophoresis tank, close the lid, turn on the power, and run the electrophoresis at 4°C and 200mA for 90 minutes;

[0052] (4) Blocking: After transfer, remove the PVDF membrane and block it with blocking solution (5% skim milk powder dissolved in 1× TBST) at room temperature for 1 h.

[0053] (5) Incubation with primary antibody: After blocking, cut the membrane according to the molecular weight of the target protein, add the primary antibody diluted with 1×TBST (the dilution factor of the primary antibody is based on the concentration in the antibody manual), and incubate overnight at 4°C;

[0054] (6) Wash the membrane: Wash with 1×TBST three times, 10 min each time;

[0055] (7) Incubation with secondary antibody: Add the secondary antibody diluted with 1×TBST (select the appropriate secondary antibody according to the species of the primary antibody, for example, if the primary antibody is mouse anti-rat, the secondary antibody should be goat anti-rat; if the primary antibody is rabbit anti-rabbit, the secondary antibody should be goat anti-rabbit). Dilute the secondary antibody according to the concentration in the antibody instructions and incubate at room temperature for 1 h.

[0056] (8) Wash the membrane: Wash with TBST three times, 10 min each time;

[0057] (9) Development: Immerse the membrane in the ultrasensitive ECL chemiluminescent substrate working solution, solution A: solution B = 1: 1, and place it in the Tianneng Gel Imaging System 4200 for development.

[0058] Test results such as Figure 1 As shown, Figure 1 In the table, Scramble represents the control group cells (negative control cells), shKRT5-1, shKRT5-2, and shKRT5-3 represent cells after KRT5 gene knockdown using shRNA interference vectors, and the same applies to the rest. Figure 1 It can be seen that the three interference vectors can effectively reduce the expression level of KRT5 protein. In the subsequent examples, shKRT5-1 and shKRT5-2 were selected for subsequent related studies.

[0059] The inventors also found through further research that:

[0060] (1) The roundness of FaDu cells and CAL 27 cells after KRT5 gene knockdown was significantly lower than that of the Scramble control group, and there was a significant difference between the two and statistically significant (p < 0.05).

[0061] (2) Morphological staining and circularity analysis showed that the shapes of FaDu cells and CAL 27 cells after KRT5 gene knockdown were more irregular than those in the Scramble control group, and the typical epithelial cell phenotype changed, acquiring some mesenchymal phenotype characteristics.

[0062] (3) Further Western blot results showed that after KRT5 gene knockdown, the expression level of epithelial cell marker protein E-Cadherin in FaDu cells and CAL 27 cells was significantly downregulated, but some expression was still present. In addition, the expression levels of mesenchymal cell marker proteins N-Cadherin, Snail, and TWIST1 were significantly upregulated. Western blot experimental results showed that after KRT5 gene knockdown, FaDu cells and CAL 27 cells retained epithelial cell characteristics while acquiring mesenchymal cell characteristics, showing a protein expression pattern of mixed epithelial / mesenchymal cell phenotype, thereby participating in the regulation of the EMP process of cells.

[0063] (4) Flow cytometry was used to detect the proportion of CD44+ and CD24- antibody-labeled stem cell subsets in FaDu cells and CAL 27 cells before and after KRT5 gene knockdown. The results showed that in the scramble control group, the proportion of CD44+ / CD24- cell subsets in FaDu cells and CAL 27 cells was 6.06%±1.79% and 40.6%±2.15%, respectively. After KRT5 gene knockdown, this proportion increased significantly: in the shKRT5-1 knockdown group, the proportion of CD44⁺ / CD24⁻ cell subsets in FaDu cells and CAL 27 cells increased to 19.63%±2.30% and 57.17%±1.82%, respectively; in the shKRT5-2 knockdown group, the proportion increased to 22.43%±5.46% and 67.93%±3.29%, respectively. Flow cytometry results showed that after KRT5 gene knockdown, the proportion of CD44⁺ / CD24⁻ cell subsets in FaDu cells and CAL 27 cells increased significantly, and the difference was statistically significant (p<0.05). KRT5 gene knockdown significantly enhanced the stemness characteristics of FaDu cells and CAL 27 cells, thereby promoting the dynamic conversion of EMP.

[0064] (5) Gene expression data of HNSCC patients were extracted from the TCGA database and analyzed using R software (Version 3.5.1). The results showed that in HNSCC patients, the expression of the KRT5 gene was positively correlated with the expression of the epithelial cell marker protein E-Cadherin (CDH1), with a correlation coefficient of 0.61; while it was negatively correlated with the expression of the mesenchymal cell marker proteins N-Cadherin (CDH2), Snail (SNAI1), and TWIST1, with correlation coefficients of -0.25, -0.25, and -0.18, respectively. Analysis of TCGA clinical data showed that the KRT5 gene was involved in the regulation of the EMP process, suggesting that it may be involved in the invasion and metastasis of HNSCC.

[0065] (6) Scratch test was used for detection. The experimental results showed that compared with the Scramble control group cells, the 24-hour migration rate of FaDu cells and CAL 27 cells was significantly increased after KRT5 gene knockdown, that is, the in vitro migration ability was significantly enhanced, and the difference was significant and statistically significant (p < 0.05);

[0066] (7) The inventors conducted an in vitro Transwell invasion experiment to explore the effect of KRT5 gene on the in vitro invasion ability of FaDu cells and CAL 27 cells. The experimental results showed that compared with the Scramble control group cells, after the KRT5 gene was knocked down, the number of FaDu cells and CAL 27 cells that passed through the membrane increased significantly, that is, the in vitro invasion ability was significantly enhanced, and the difference was significant and statistically significant (p < 0.05);

[0067] It was demonstrated that KRT5 gene knockdown significantly enhanced the in vitro migration and invasion ability of FaDu cells and CAL 27 cells. This finding revealed that the KRT5 gene plays an important role in regulating the EMP process and thus affecting cell migration and invasion ability.

[0068] (8) KRT5 gene knockdown enhanced the tumorigenicity of FaDu cells and CAL 27 cells in nude mice:

[0069] A subcutaneous tumor formation assay in nude mice was used to investigate the effect of KRT5 on the tumorigenicity of HNSCC cells in vivo. In the experiment, KRT5 knockdown FaDu and CAL 27 tumor cells, as well as their scrambled control counterparts, were inoculated subcutaneously into the right thigh of nude mice, with six mice per group. After the mice were raised and tumors were established, tumor size was measured. Over time, the growth rate of KRT5 knockdown FaDu and CAL 27 tumors was significantly higher than that of the scrambled control group (p<0.05). In the middle and late stages of tumor formation, tumor volume in the KRT5 knockdown group was significantly larger than that in the scrambled control group, a difference that was visible to the naked eye. At the end of the experiment, the nude mice were sacrificed, and the tumors were completely removed and weighed. The results showed that tumor weight in the KRT5 knockdown group was significantly higher than that in the scrambled control group (p<0.05).

[0070] (9) KRT5 gene knockdown enhances the liver metastasis ability of FaDu cells and CAL 27 cells in nude mice:

[0071] A nude mouse tail vein injection model of hematogenous metastasis was established. KRT5 knockdown FaDu and CAL 27 tumor cells, as well as scrambled control tumor cells, were injected into the tail veins of nude mice, with nine mice per group. At the end of the experiment, the mice were sacrificed and the livers removed intact. Metastatic nodules on the liver surface were observed, and if metastasis was detected, the number of metastatic lesions in each liver was counted. Results showed that the number of liver metastases in the KRT5 knockdown FaDu and CAL 27 cell groups was 9 and 8, respectively, while in the scrambled control group, only 4 and 3 liver metastases were found in the FaDu and CAL 27 cell groups. The differences between the experimental and control groups were statistically significant (p < 0.05). Furthermore, statistical analysis showed that the number of liver metastases in the KRT5 knockdown FaDu and CAL 27 cell groups was significantly increased compared to the scrambled control group (p < 0.05).

[0072] In summary, compared with the scramble control group, the incidence and number of liver metastases in the KRT5 knockdown FaDu and CAL27 cell groups injected via tail vein were significantly increased. Therefore, KRT5 knockdown significantly enhances the liver metastasis ability of FaDu and CAL27 cells in nude mice.

[0073] (10) Clinical sample analysis of the relationship between KRT5 gene and lymph node metastasis in HNSCC patients:

[0074] Gene expression data from HNSCC patients were extracted from the TCGA database and the GSE65858 dataset and analyzed using Rsoftware (version 3.5.1). In the TCGA database, KRT5 gene expression was significantly lower in HNSCC patients with N1-N3 lymph node metastasis compared with those with N0 lymph node metastasis, and the difference was statistically significant (p < 0.05). Similarly, in the GSE65858 dataset, KRT5 gene expression was significantly lower in HNSCC patients with N1-N3 lymph node metastasis compared with those with N0 lymph node metastasis, and the difference was statistically significant (p < 0.05). This suggests that KRT5 gene expression is negatively correlated with lymph node metastasis in HNSCC patients.

[0075] (11) Knockdown of KRT5 gene enhanced the adhesion of FaDu and CAL 27 cells to platelets:

[0076] Western blot analysis revealed that KRT5 knockdown significantly upregulated ICAM-1 protein expression in FaDu and CAL 27 cells compared with the scramble control group. This suggests that KRT5 knockdown may promote the binding of tumor cells to platelets by enhancing ICAM-1 protein expression in FaDu and CAL 27 cells.

[0077] Platelet adhesion assays were performed on FaDu and CAL 27 cells after KRT5 gene knockdown, as well as tumor cells in the scrambled control group. Platelet adhesion to the surfaces of FaDu and CAL 27 cells after KRT5 gene knockdown was significantly greater than that in the scrambled control group. Fluorescence intensity was measured using a microplate reader and adhesion rates were calculated. The platelet adhesion rates of FaDu and CAL 27 cells after KRT5 gene knockdown were significantly increased, and the differences were statistically significant (p < 0.05).

[0078] (12) KRT5 gene knockdown exacerbates tumor-related abnormal blood hypercoagulability in animals:

[0079] KRT5 knockdown FaDu tumor cells and their scrambled counterparts were inoculated subcutaneously into the right thigh of nude mice, with six mice per group. The experiment was terminated in the middle to late stages of tumor formation, and blood was collected from the orbital cavity to measure serum TAT levels. The results showed that TAT concentrations in the peripheral blood of nude mice in the KRT5 knockdown FaDu cell group were significantly higher than those in the scrambled control group (P < 0.05). Furthermore, the tumors were completely removed and ground into a pulp, and protein was extracted to measure TAT levels in the tumor protein. The results showed that TAT concentrations in tumor protein in the KRT5 knockdown FaDu cell group were significantly higher than those in the scrambled control group (P < 0.05). Therefore, KRT5 knockdown significantly increased TAT concentrations in both peripheral blood and tumor protein in nude mice, exacerbating abnormal hypercoagulability in the blood of these mice.

[0080] (13) Gene knockdown activated the IL-6 / STAT3 signaling pathway in FaDu and CAL 27 cells:

[0081] ELISA assays were performed to detect the expression of IL-6, an important cytokine closely associated with tumor cell stemness, in the supernatants of FaDu and CAL 27 cells after KRT5 gene knockdown, and the differences were statistically significant (p<0.05).

[0082] Western blot analysis further revealed changes in related signaling pathways. KRT5 knockdown significantly upregulated the expression of Stat3, a key protein in the IL-6 / STAT3 signaling pathway, and its phosphorylated form, Phospho-Stat3, in FaDu and CAL27 cells.

[0083] (14) KRT5 gene knockdown activated the NF-κB signaling pathway in FaDu and CAL 27 cells:

[0084] Western Blot experiments were performed to detect the expression of p65, a key protein in the NF-κB signaling pathway, and its phosphorylated form pp65 in FaDu cells and CAL 27 cells after KRT5 gene knockdown. The upregulation of pp65 was particularly significant.

[0085] In addition, after extracting nuclear proteins, Western Blot results showed that the expression of nuclear translocated pp65 in cells after KRT5 gene knockdown was also significantly enhanced compared with the Scramble control group.

[0086] (15) The molecular mechanism by which KRT5 regulates EMP-induced migration in FaDu and CAL 27 cells through NF-κB and IL-6 / STAT3 signaling pathways:

[0087] FaDu and CAL27 cells, after KRT5 gene knockdown, were treated with varying concentrations of Stattic, a phosphorylation inhibitor of the IL-6 / STAT3 signaling pathway. Western blot analysis revealed that increasing Stattic concentrations gradually decreased the expression of Stat3 and its phosphorylated form, Phospho-Stat3, key proteins in the IL-6 / STAT3 signaling pathway. Furthermore, Western blot analysis (Figure 31) revealed that treatment with 2.5 µM Stattic for varying durations in FaDu and CAL27 cells after KRT5 knockdown revealed that Stat3 and Phospho-Stat3 expression levels were gradually downregulated, with the most significant effect observed after 48 hours of treatment. Furthermore, ELISA was used to assess IL-6 expression in cell supernatants. The results showed that increasing Stattic concentrations gradually decreased IL-6 expression in the supernatants of FaDu and CAL27 cells after KRT5 knockdown, with statistically significant differences (p < 0.05). Western Blot and ELISA experimental results showed that in FaDu and CAL 27 cells after KRT5 gene knockdown, the IL-6 / STAT3 signaling pathway was involved in regulating the EMP process of HNSCC cells and promoted the expression of IL-6.

[0088] Example 2:

[0089] KRT5 regulates EMP progression, invasion and metastasis through direct interaction with PADI3

[0090] To further explore the upstream and downstream effector molecules involved in KRT5's regulation of EMP in head and neck squamous cell carcinoma cells, the inventors investigated KRT5's interacting proteins. They screened KRT5, KRT13, KRT15, ​​KRT4, KRT19, MMP14, PADI3, C3, SORT1, PCDHA11, and KLHL35 as potential interacting proteins. Finally, they selected PADI3 (Protein Arginine Deminase 3) as a key KRT5 target for validation.

[0091] It is important to note that after gene functional analysis and literature review, PADI3, C3, and SORT1 were selected for further investigation. However, protein analysis of C3 and SORT1 revealed that C3 protein co-precipitated with KRT5 only in hypopharyngeal squamous cell carcinoma FaDu cells, but not in tongue squamous cell carcinoma CAL27 cells. This limits the broad applicability of C3 to different types of head and neck squamous cell carcinoma. SORT1 protein expression exhibited the opposite effect after KRT5 knockdown: significantly increased expression and negative correlation with KRT5. Therefore, we excluded C3 and SORT1. The experimental results confirmed that only PADI3, in terms of co-precipitation and correlation with KRT5, best met our experimental expectations, and therefore PADI3 was selected for further functional validation.

[0092] (1) Sample processing of adherent cells:

[0093] Remove the culture medium and press 1×10 5 Wash twice with 1× PBS at a ratio of 150µL per 1×10 cells; scrape the cells with a cell scraper and collect them into a 1.5mL EP tube. 5 Add 20-30µL of binding buffer per cell, and add protease inhibitors (such as PMSF at a final concentration of 1mM). Mix well and place on ice for 10 minutes. Collect the supernatant by centrifugation (4°C, 14000g, 10 minutes) and place on ice until use (or store at -20°C for long-term storage).

[0094] (2) Magnetic bead pretreatment:

[0095] Vortex the immunoprecipitation magnetic beads for 1 minute to thoroughly resuspend them. Transfer 25-50 µL of the suspension to a 1.5 mL EP tube. Add 200 µL of binding buffer for washing. Perform magnetic separation (place the EP tube on a magnetic separator, allowing the beads to adhere to the tube walls until the solution clears; this procedure is omitted below). Discard the supernatant, remove the EP tube from the magnetic separator, and repeat the wash cycle. Finally, add 200 µL of binding buffer to resuspend the beads for later use.

[0096] (3) Antibody binding reaction:

[0097] ① Preparation of antibody working solution: Dilute the antibody sample with binding buffer to a final concentration of 5-50µg / mL antibody working solution and place on ice until ready for use.

[0098] ② Antibody adsorption: Magnetic separation was performed on the magnetic bead suspension pretreated in step 2, and the supernatant was discarded. 200µL of antibody working solution was added, and the suspension was quickly resuspended and placed on a flip mixer at room temperature or the EP tube was gently flipped manually. After 15 minutes, magnetic separation was performed and the supernatant was collected and placed on ice for subsequent detection.

[0099] ③ Washing: Add 200µL of binding buffer to the EP tube for washing. Gently pipette to evenly disperse the magnetic bead-antibody complex. Then perform magnetic separation, discard the supernatant, and remove the EP tube from the magnetic separator. Repeat the above washing steps once.

[0100] (4) Antigen precipitation reaction:

[0101] ① Antigen adsorption: Add 200µL of the antigen sample prepared in step 1 and gently pipette to evenly disperse the antigen and magnetic bead-antibody complex. Place the tube in a shaker or gently invert the EP tube manually for 10 minutes at room temperature to allow the antigen and antibody to fully bind. If binding is weak, react at room temperature for 1 hour or at 4°C overnight.

[0102] ② Washing and Transfer: Magnetic separation of the antigen-adsorbed magnetic bead-antibody-antigen complex was performed. The supernatant was collected and placed on ice for subsequent analysis. 200µL of wash buffer was added to the EP tube for washing. Gently pipette to evenly disperse the magnetic bead-antibody-antigen complex. Then, magnetic separation was performed and the supernatant was discarded. Remove the EP tube from the magnetic separator and repeat the wash process two more times. Finally, 200µL of wash buffer was added and the magnetic bead-antibody-antigen complex suspension was transferred to a new 1.5mL EP tube using a pipette. Magnetic separation was then performed and the supernatant was discarded.

[0103] (5) Antigen elution:

[0104] Denaturing elution method: Samples eluted with this method are suitable for SDS-PAGE analysis. Remove the EP tube from the magnetic separator, add 25µL of 1× SDS-PAGE Loading Buffer, mix thoroughly, and heat at 95°C for 5 minutes. Then, perform magnetic separation (centrifugation (13,000g, 10 minutes at room temperature) can also be used). Collect the supernatant for SDS-PAGE analysis.

[0105] Co-immunoprecipitation (co-IP) results are as follows Figure 2 As shown, PADI3 was co-immunoprecipitated with KRT5, demonstrating a direct interaction between the two.

[0106] Western blot experiments confirmed that after KRT5 knockdown, PADI3 expression was downregulated in FaDu and CAL 27 cells. Figure 3 As shown. By analyzing the cytoplasmic and nuclear proteins respectively, it was found that ( Figure 4), KRT5 protein is primarily localized in the cytoplasm, while PADI3 is expressed in both the cytoplasm and the nucleus. KRT5 knockdown downregulates cytoplasmic PADI3 expression in FaDu and CAL 27 cells, while upregulating nuclear PADI3 expression. Therefore, the inventors speculate that KRT5 knockdown may disrupt the PADI3-KRT5 complex in the cytoplasm, allowing free PADI3 to translocate to the nucleus, further promoting EMP.

[0107] Cell immunofluorescence results (such as Figure 5 The results further demonstrated the intracellular localization and enrichment of KRT5 and PADI3 before and after KRT5 knockdown. After KRT5 knockdown, PADI3 showed obvious nuclear translocation, which was consistent with the western blot results.

[0108] The inventors overexpressed PADI3 in shKRT5 cells, and the results confirmed that the expression of PADI3 in both the cytoplasm and the nucleus was significantly upregulated, and the PADI3 overexpression achieved the expected effect ( Figure 6 Further western blot experiments of EMP-related molecules found that after PADI3 overexpression, the expression level of E-cadherin did not change significantly, but the expression of N-cadherin was significantly upregulated, and snail and TWIST1 were upregulated to varying degrees ( Figure 7 This result suggests that nuclear PADI3 may play a key role in regulating N-cadherin expression, thereby participating in the regulation of EMP phenotypic transformation.

[0109] Example 7. Dual-color immunohistochemistry assay

[0110] The inventors used immunohistochemistry and immunofluorescence techniques to analyze the enrichment and localization of KRT5 and PADI3 in human HNSCC specimens ( Figure 7 ), the results showed that KRT5 expression in human HNSCC tumor tissue was mainly concentrated in the cytoplasm, and KRT5 expression was weakened in the tumor-stroma boundary area. PADI3 was expressed in both the cytoplasm and the nucleus in tumor tissue, and PADI3 showed typical nuclear localization in the tumor-stroma boundary area. This result was consistent with the results of cytological experiments, and suggested that the areas where KRT5 and PADI3 were co-expressed formed specific microdomain differences and specific patterns in tumor tissue, which can be used as an effective predictive marker for head and neck squamous cell carcinoma metastasis and has important scientific significance and application value for optimizing clinical diagnosis and treatment strategies.

[0111] The specific experimental steps are as follows:

[0112] (1) Baking: Place the prepared tissue slices in an oven at 60℃-65℃ and bake for 1h-1.5h.

[0113] (2) Dewaxing: conventional dewaxing and rehydration, xylene I 20 min, xylene II 20 min, anhydrous ethanol 1 10 min, anhydrous ethanol I1 10 min, 95% ethanol 5 min, 85% ethanol 5 min, rinse with tap water 3 times.

[0114] (3) Antigen retrieval: Citrate buffer or Tris-EDTA can be used as the retrieval solution. Heat the retrieval solution in a microwave oven until boiling, then add the tissue sections. Continue heating on medium heat for 15 minutes and then turn off the heat. Allow the retrieval solution to cool naturally, remove the sections, and rinse with tap water for 1 minute.

[0115] (4) Blocking: Add endogenous peroxidase blocker to the tissue sections and incubate at room temperature for 12 minutes. Remove the sections and rinse them with tap water for 1 minute. Place them in tap water for later use.

[0116] (5) Blocking: Take out the slices and shake off excess water. Wipe the water around the tissue with filter paper. Draw a circle on the tissue with an immunohistochemistry pen. Add blocking solution (usually 5% sheep serum) to the tissue and block it in a 37°C oven for 30 minutes.

[0117] (6) Add rabbit primary antibody: shake off the blocking solution, directly drop rabbit primary antibody to cover the tissue, cover the wet box lid, and incubate at 37℃ for 1h or 4℃ overnight.

[0118] (7) Add ultrasensitive goat anti-rabbit IgG-HRP polymer: Immerse the sections in PBST three times, shake off the PBST, add ultrasensitive goat anti-rabbit IgG-HRP polymer to cover the tissue, and incubate at 37°C for 30 minutes.

[0119] (8) DAB color development: Wash the sections three times with PBST. Prepare DAB color development solution by mixing DAB chromogen and DAB buffer at a ratio of 1:20. Discard the PBST and add DAB color development solution dropwise. Color development should be carried out at room temperature for 1-10 minutes. After color development, place the sections in tap water to terminate the reaction and rinse with running water for 2 minutes.

[0120] (9) Add mouse primary antibody: Wash the sections three times with PBST, shake off the PBST, and directly add mouse primary antibody to cover the tissue. Cover the wet box with a lid and incubate at 37°C for 1 hour or at 4°C overnight.

[0121] (10) Add ultrasensitive goat anti-mouse IgG-AP polymer: Wash the sections three times with PBST, shake off the PBST, add ultrasensitive goat anti-mouse IgG-AP polymer to cover the sections, and incubate at 3°C ​​for 30 minutes.

[0122] (11) Fast Red color development: Wash the sections three times with PBST. Prepare a Fast Red color development solution by mixing Fast Red and Fast Red buffer at a ratio of 1:40. Discard the PBST and add the Fast Red color development solution dropwise. Color development should be carried out at room temperature for 15 minutes. After color development, place the sections in tap water to terminate the reaction.

[0123] (12) Restaining: After staining, rinse the sections with tap water for 2 minutes, stain in hematoxylin for 30 seconds to 3 minutes, and then rinse with tap water for 2 minutes. Differentiation solution (75% ethanol: concentrated hydrochloric acid = 99:1) was used for 2 seconds, and then rinsed with tap water for 1 minute.

[0124] (13) Dehydration: The sections were dehydrated routinely with 85% ethanol for 5 min, 95% ethanol for 5 min, anhydrous ethanol I for 10 min, and anhydrous ethanol II for 10 min.

[0125] (14) Transparency: xylene I for 10 min, xylene II for 10 min, sealing with neutral resin, and observation under a microscope.

[0126] Gene expression data of HNSCC patients were extracted from the TCGA database and the GSE65858 dataset and analyzed using Rsoftware (version 3.5.1). Figure 8 As shown in Figure 2, in HNSCC patients, the expression of KRT5 gene was positively correlated with PADI3 (p<0.05). We used immunohistochemistry and immunofluorescence techniques to analyze the enrichment and localization of KRT5 and PADI3 in human HNSCC specimens ( Figure 9 ), the results showed that KRT5 expression in human HNSCC tumor tissue was mainly concentrated in the cytoplasm, and KRT5 expression was weakened in the tumor-stroma boundary area. PADI3 was expressed in both the cytoplasm and the nucleus in tumor tissue, and PADI3 showed typical nuclear localization in the tumor-stroma boundary area. This result was consistent with the results of cytological experiments, and suggested that the areas where KRT5 and PADI3 were co-expressed formed specific microdomain differences and specific patterns in tumor tissue. It can be used as an effective predictive marker for head and neck squamous cell carcinoma metastasis and has important scientific significance and application value for optimizing clinical diagnosis and treatment strategies.

[0127] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of low Keratin5 expression combined with PADI3 nuclear translocation as a predictive marker for invasion and metastasis of head and neck squamous cell carcinoma.

2. The use according to claim 1, characterized in that Low Keratin5 expression combined with PADI3 nuclear translocation is characteristically localized at the front end of invasion and metastasis, namely the tumor-stroma boundary.

3. The use according to claim 1, characterized in that The shRNA interference vector used to construct the low expression of Keratin5 is selected from one of shKRT5-1, shKRT5-2, and shKRT5-3, and the nucleotide sequences of shKRT5-1, shKRT5-2, and shKRT5-3 are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.