KASP molecular marker for identifying soybean hundred-grain weight and application

Abstract

The invention discloses a KASP molecular marker for identifying soybean hundred-grain weight and application thereof, and relates to the technical field of biology and application of an SNP locus, the SNP locus takes a soybean Wm82. A2. V1 genome sequence as a reference genome, the SNP is the 16321243th SNP on a soybean 11 # chromosome, and the SNP is the 16321243th SNP on the soybean 11 # chromosome. Corresponding to the 20th basic group from the 5'terminal of the sequence shown in SEQ ID NO: 1, when the locus is CC homozygosis, the corresponding genotype is A; when the locus is TT homozygous, the corresponding genotype is B; according to the application, soybeans with different hundred-grain weights are screened or screened in an auxiliary mode, and the different hundred-grain weights of the soybeans are as follows: the homozygous soybeans with the genotype A are higher than or candidate to be higher than the homozygous soybeans with the genotype B. The molecular marker has important theoretical significance and economic value for molecular marker-assisted selection of soybean germplasm or breeding progeny materials with high hundred-grain weight.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a KASP molecular marker for identifying soybean 100-grain weight and its application. Background Art

[0002] Soybean (Glycine max (Linn.) Merr.) is an important grain and oil crop in my country. With the development of the social economy and the continuous improvement of people's living standards, my country's soybean consumption has been increasing, leading to a serious contradiction between soybean supply and demand in my country. China is the world's largest soybean consumer. Faced with huge domestic demand, my country's domestic soybean production cannot meet it, and it can only rely on large-scale imports. Since 2000, China has become the world's largest soybean importer, and the import volume of soybeans has increased annually. In 2024, my country's soybean imports reached 105.03 million tons. The huge soybean import volume has caused the entire domestic soybean industry chain to face a huge crisis, seriously threatening my country's food security. Therefore, increasing soybean yield has always been a serious issue facing Chinese breeders.

[0003] Soybean 100-grain weight is a key factor influencing soybean yield. According to statistics, the 100-grain weight of cultivated soybeans generally ranges from 3.0g to 77.5g, while that of wild soybeans generally ranges from 0.5g to 10.0g. A 100-grain weight of 19.2g is generally expected to yield the highest soybean yield. Excessively large or small 100-grain weights are detrimental to soybean yield. Therefore, breeding soybean varieties with optimal 100-grain weights can help increase soybean yield. Several genetic loci and candidate genes associated with 100-grain weight have been reported, but molecular markers for molecular-assisted soybean breeding remain to be developed. Cultivated soybeans, through selection, have much lower genetic diversity than wild soybeans. Discovering and developing molecular markers for 100-grain weight in wild soybeans and applying them to modern breeding processes has important scientific significance for fully utilizing the excellent genetic information of wild soybeans and cultivating new high-yield, high-quality soybean varieties. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a KASP molecular marker for identifying soybean 100-grain weight and its application.

[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0006] Use of a SNP site, wherein the SNP site uses the soybean Wm82.a2.v1 genome sequence as a reference genome, the SNP being the 16,321,243rd SNP on soybean chromosome 11, corresponding to the 20th base from the 5' end of the sequence shown in SEQ ID NO: 1, and when the site is homozygous for CC, the corresponding genotype is A; when the site is homozygous for TT, the corresponding genotype is B;

[0007] The use is to screen or assist in screening soybeans with different 100-grain weights, and the difference in 100-grain weights of soybeans is as follows: soybeans homozygous for genotype A are higher or are candidates to be higher than soybeans homozygous for genotype B.

[0008] A method for screening or assisting in screening soybeans with different 100-grain weights, comprising the following steps: detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT, wherein the 100-grain weight of soybeans with genotype CC is greater than the 100-grain weight of soybeans with genotype TT;

[0009] The soybean of genotype CC is a soybean of homozygous CC genotype based on the C20T SNP site;

[0010] The soybean of genotype TT is a soybean of homozygous TT genotype based on the C20T SNP site;

[0011] The C20T SNP site is the 16321243rd SNP on soybean chromosome 11, using the soybean Wm82.a2.v1 genome sequence as a reference genome, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0012] Further preferably, the step of detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT is as follows:

[0013] (a1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product;

[0014] The primer combination consists of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and the downstream primer 11PC-1-R shown in SEQ ID NO: 4;

[0015] (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected by an instrument, and the genotype of the soybean to be tested is obtained based on the color of the fluorescence signal. If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 11PC-1-FAM, showing blue fluorescence, the soybean sample to be tested is of CC genotype; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 11PC-1-VIC, showing red fluorescence, the soybean sample to be tested is of TT genotype.

[0016] Further preferably, the step of detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT is as follows:

[0017] (b1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product;

[0018] The primer combination consists of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and the downstream primer 11PC-1-R shown in SEQ ID NO: 4;

[0019] (b2) taking the PCR amplification product obtained in step (b1) and sequencing it;

[0020] (b3) Obtaining the genotype of the soybean to be tested based on the sequencing results obtained in step (b2).

[0021] A kit for identifying or assisting in identifying soybean 100-grain weight, comprising a primer combination for detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT;

[0022] The primer combination consists of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and the downstream primer 11PC-1-R shown in SEQ ID NO: 4;

[0023] The genotype CC is based on the C20T SNP site, which is a CC homozygous type;

[0024] The genotype TT is based on the genotype of the C20T SNP site being TT homozygous;

[0025] The C20T SNP site is the 16321243rd SNP on soybean chromosome 11, using the soybean Wm82.a2.v1 genome sequence as a reference genome, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0026] The molecular marker shown in SEQ ID NO: 1.

[0027] Application of the above kit or the above molecular marker in identifying or assisting in identifying soybean 100-grain weight.

[0028] Application of the above kit or the above molecular marker in screening or auxiliary screening of different hundred-grain soybeans.

[0029] Application of the above kit or the above molecular marker in soybean breeding.

[0030] The invention discloses an application of a primer combination in the directed breeding or assisted directed breeding of soybean lines with high 100-grain weight. The primer combination consists of an upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, an upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and a downstream primer 11PC-1-R shown in SEQ ID NO: 4.

[0031] The beneficial effects of the above technical solution are as follows: the present invention provides KASP markers for identifying allelic variations in the CC and TT genotypes and their correlation with soybean 100-grain weight. The KASP markers of the present invention are applied to molecular marker-assisted selection for soybean 100-grain weight, enabling rapid and efficient screening of soybean varieties (germplasm) with higher 100-grain weights, thereby accelerating the breeding of new high-quality soybean varieties. This invention has important theoretical significance and economic value for the use of molecular marker-assisted selection for soybean germplasm or breeding material with higher 100-grain weights. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is a diagram showing the results of QTL mapping analysis for the 100-grain weight trait of population numbered 14019 in Example 1 of the present invention;

[0033] Figure 2 This is a normal distribution marker selection efficiency diagram of the 100-grain weight of the population numbered 14019 in 2019 and 2021 in Example 1 of the present invention;

[0034] Figure 3 This is a graph showing the genotyping results of the KASP marker for 100-grain weight of the secondary population in 2024 and the variance analysis results of 100-grain weight in Example 2 of the present invention. DETAILED DESCRIPTION

[0035] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained through commercial purchase. The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0036] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, integers, steps, operations, elements and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or collections thereof.

[0037] It will also be understood that the term "and / or" used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.

[0038] References to "one embodiment" or "some embodiments" in this specification mean that a particular feature, structure, or characteristic described in conjunction with that embodiment is included in one or more embodiments of the present application. Thus, phrases such as "in one embodiment," "in some embodiments," "in other embodiments," and "in other embodiments" appearing in various places in this specification do not necessarily refer to the same embodiment, but rather mean "one or more but not all embodiments," unless otherwise specifically emphasized. The terms "including," "comprising," "having," and variations thereof all mean "including but not limited to," unless otherwise specifically emphasized.

[0039] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0040] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0041] Example 1: Discovery of soybean 100-grain weight-specific SNP sites

[0042] The soybean material in the present embodiment comes from: in 2006, the cultivated soybean Jidou 12 of this laboratory was used as the female parent, and the wild soybean ZYD02738 was used as the male parent, and hybridization was carried out to establish the RIL population. In 2012, Jidou 12 was the female parent, and the RIL population was used as the male parent, and backcrossing was carried out to obtain the BC1F1 population in 2013. In 2014, Jidou 12 was the female parent, and the BC1F2 of Jidou 12 and ZYD02738 combination was used as the male parent, and backcrossing was carried out; BC2F1 population was obtained in 2015. Self-pollination was carried out 4 times to obtain BC2F4:5 population, i.e., 53 strains of the population numbered 14019. In December 2018, in Sanya, BC2F4:5 plant rows took leaves, and DNA was extracted via Baimix Company, and genotype identification was carried out for each strain respectively to construct a genetic map.

[0043] The phenotypic detection method of soybean 100-grain weight is as follows: the number of grains per plant and the weight of grains per plant of each family in the wild soybean substitution line population 14019 are counted, and the formula for calculating the 100-grain weight is: 100-grain weight = (grain weight per plant / number of grains per plant) × 100.

[0044] Combined with phenotypic data, QTL mapping of soybean 100-grain weight was performed, such as Figure 1As shown in Table 1, QTLs associated with soybean 100-grain weight, qOSW-14019-11-19 and qOSW-14019-11-21, were mapped on soybean chromosome 11. Their LOD values ​​were 6.39 and 6.63, respectively, explaining 23.65% and 19.06% of the phenotypic variation, respectively. The SNP associated with these QTLs is labeled Chr11_16321243_C_T. The SNP was based on the soybean Williams82 (Wm82.a2.v1) genome sequence as the reference genome. The nucleotide sequence of the 16,321,243rd SNP on soybean chromosome 11 is either C or T, corresponding to nucleotide position 20 of SEQ ID NO: 1.

[0045] Table 11 QTL location analysis results for 100-grain weight in population 4019

[0046]

[0047] The genotypes of each family in the population corresponding to the soybean SNP marker Chr11_16321243_C_T are divided into three types, namely CC, TT and C / T. The genotype CC is homozygous for C, the genotype TT is homozygous for T, and the genotype CT is heterozygous for C and T. The 100-grain weight phenotypic values ​​of the 53 soybean lines in this example and the genotype identification results of Chr11_16321243_C_T are shown in Tables 2 and Figure 2 As shown, in 2019, the average 100-grain weight of CC genotype and TT genotype families were 14.44g and 11.92g, respectively. Compared with the average 100-grain weight of TT genotype families, the average 100-grain weight of CC genotype families was significantly higher by 21.14% (P < 0.001); in 2021, the average 100-grain weight of CC genotype and TT genotype families were 10.85g and 9.11g, respectively. Compared with the average 100-grain weight of TT genotype families, the average 100-grain weight of CC genotype families was significantly higher by 19.09% (P < 0.001).

[0048] Table 21 Results of soybean molecular markers and 100-grain weight testing for population 4019 in 2019 and 2021

[0049]

[0050]

[0051]

[0052] Example 2. Genetic Identification of KASP Markers in Secondary Population Soybean

[0053] A KASP marker was designed targeting the specific CHR11_16321243_C_T site on chromosome 11, and the following primers were designed:

[0054] 11PC-1-FAM: gaaggtgaccaagttcatgctACTGTGAACAACACTCCAAC (SEQ ID NO: 2);

[0055] 11PC-1-VIC: gaaggtcggagtcaacggattACTGTGAACAACACTCCAAT (SEQ ID NO: 3);

[0056] 11PC-1-R: CCATCAACCTTGTGGAGACC (SEQ ID NO: 4);

[0057] Amplification was performed using 5 μL of KASPAssay Mix (1.2 μL each of 11PC-1-FAM and 11PC-1-VIC, 3 μL of 11PC-1-R, and 4.6 μL of ddH2O). The reaction system was as shown in Table 3, with the following procedure: 94°C for 15 min; 10 cycles of 94°C for 20 s, followed by 61-55°C for 30 s, with the temperature decreasing by 0.6°C each cycle; 26 cycles of 94°C for 20 s, followed by 55°C for 1 min, with a final temperature of 30°C for 1 min.

[0058] Table 3 PCR reaction system of test population

[0059]

[0060] The marker Chr11_16321243_C_T was used to genotype 66 lines of the F3 subgroup derived from population 14019. KASP marker detection showed that among the 66 Chinese soybean germplasm materials, 10 germplasms were of CC genotype and 15 germplasms were of TT genotype. The genotype results are shown in Tables 4 and Figure 3 As shown,

[0061] Table 4 Detection results of molecular markers and 100-grain weight content of soybean in secondary population

[0062]

[0063]

[0064]

[0065] Table 5 Statistical analysis of the relationship between Chr11_16321243_C_T allelic variation type and 100-grain weight

[0066]

[0067] The average 100-kernel weights of the CC and TT genotype families were 17.79 g and 14.21 g, respectively. Compared with the TT genotype family, the CC genotype family had a significantly higher average 100-kernel weight by 25.16% (P < 0.001), indicating that the Chr11_16321243_C_T marker is reliable and effective for identifying soybean 100-kernel weight.

[0068] In summary, soybeans with a CC genotype at Chr11_16321243_C_T exhibit high 100-grain weight, while soybeans with a TT genotype at Chr11_16321243_C_T exhibit low 100-grain weight. Soybeans with a CC genotype at Chr11_16321243_C_T exhibit higher 100-grain weight than soybeans with a TT genotype at Chr11_16321243_C_T. When selecting soybean varieties with superior 100-grain weight, soybeans with a CC genotype at the Chr11_16321243_C_T locus should be selected for breeding and improvement.

[0069] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these examples without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

[0070] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0071] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. The use of SNP sites is characterized by: The SNP site uses the soybean Wm82.a2.v1 genome sequence as a reference genome. The SNP is the 16,321,243rd SNP on soybean chromosome 11, corresponding to the 20th base from the 5' end of the sequence shown in SEQ ID NO:

1. When the site is homozygous for CC, the corresponding genotype is A; when the site is homozygous for TT, the corresponding genotype is B. The use is to screen or assist in screening soybeans with different 100-grain weights, and the difference in 100-grain weights of soybeans is as follows: soybeans homozygous for genotype A are higher or are candidates to be higher than soybeans homozygous for genotype B.

2. A method for screening or assisting screening of soybeans with different 100-grain weights, characterized in that: The method comprises the following steps: detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT, and the 100-grain weight of the soybean of genotype CC is greater than the 100-grain weight of the soybean of genotype TT; The soybean of genotype CC is a soybean of homozygous CC genotype based on the C20T SNP site; The soybean of genotype TT is a soybean of homozygous TT genotype based on the C20T SNP site; The C20T SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 16321243rd SNP on soybean chromosome 11, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO:

1.

3. The method according to claim 2, characterized in that The steps of detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT are as follows: (a1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product; The primer combination consists of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and the downstream primer 11PC-1-R shown in SEQ ID NO: 4; (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected by an instrument, and the genotype of the soybean to be tested is obtained based on the color of the fluorescence signal. If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 11PC-1-FAM, showing blue fluorescence, the soybean sample to be tested is of CC genotype; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 11PC-1-VIC, showing red fluorescence, the soybean sample to be tested is of TT genotype.

4. The method according to claim 2, characterized in that The steps of detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT are as follows: (b1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product; The primer combination consists of an upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, an upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and a downstream primer 11PC-1-R shown in SEQ ID NO: 4; (b2) taking the PCR amplification product obtained in step (b1) and sequencing it; (b3) Obtaining the genotype of the soybean to be tested based on the sequencing results obtained in step (b2).

5. A kit for identifying or assisting in identifying soybean 100-grain weight, characterized in that: The invention comprises a primer combination for detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT; The primer combination consists of an upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, an upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and a downstream primer 11PC-1-R shown in SEQ ID NO: 4; The genotype CC is based on the C20T SNP site, which is a CC homozygous type; The genotype TT is based on the genotype of the C20T SNP site being TT homozygous; The C20T SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 16321243rd SNP on soybean chromosome 11, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO:

1.

6. The molecular marker shown in SEQ ID NO:

1.

7. Use of the kit according to claim 5 or the molecular marker according to claim 6 in identifying or assisting in identifying soybean 100-grain weight.

8. Use of the kit according to claim 5 or the molecular marker according to claim 6 in screening or assisted screening of different 100-grain soybeans.

9. Use of the kit according to claim 5 or the molecular marker according to claim 6 in soybean breeding.

10. Use of a primer combination in directed breeding or assisted directed breeding of soybean lines with high 100-grain weight, the primer combination consisting of an upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, an upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and a downstream primer 11PC-1-R shown in SEQ ID NO: 4.

Images