Molecular marker Marker 2916 related to fruit hardness of sweet cherries and application of molecular marker Marker 2916

Abstract

The invention relates to a sweet cherry fruit hardness related molecular marker Marker 2916 and application thereof. According to the application, a hard-fruit sweet cherry variety 'Yanhongzhu' is taken as a female parent, and a soft-fruit sweet cherry variety 'Shangnan 2808' is taken as a male parent, so that a genetic population with separated hardness and softness is constructed. By means of QTL positioning, the fruit hardness major QTL is positioned on an LG4 chromosome for three consecutive years, the QTL is named as qFF4.1, a molecular marker Marker2916 is found near the qFF4.1, and when the genotype is A / A, the sweet cherry fruit is a soft fruit; when the genotype is C / C, the sweet cherry fruits are hard fruits. The development of the KASP marker reduces the detection cost of the SNP, and by identifying and screening fruit hardness genotypes of filial generations of different sweet cherry varieties, the breeding efficiency can be obviously improved, and the breeding cost can be saved.

Description

Technical Field

[0001] The invention relates to the application of a molecular marker of a fruit firmness-related gene, and belongs to the fields of sweet cherry breeding and molecular biology. Background Art

[0002] Sweet cherry (Prunus avium L.) is a drupe in the genus Prunus, subgenus Cerasus, of the Rosaceae family (Sun Yugang et al. (2018) World Sweet Cherry Breeding Achievements and Main Varieties. Deciduous Fruit Trees 50:5-10; Li Mingli et al. (2019) Current Status and Development Suggestions for the Sweet Cherry Industry in Shandong Province. Deciduous Fruit Trees 51:7-25). Sweet cherry originated in the Black Sea region and gradually spread to Europe and Asia in the 20th century (ElBaji M et al. (2021) Morphological and pomological characteristics of sweet cherry (Prunus avium L.) grown in-situ under the southern mediterranean climate in Morocco. Scientia Horticulturae 21:52-65). Sweet cherry cultivation in my country is primarily concentrated in Shandong, Liaoning, Beijing, Hebei, and Shaanxi provinces, with a production of approximately 1.2 million tons, making China a leading producer worldwide (Liu Qingzhong et al. (2022) Current Status and Development Prospects of the Sweet Cherry Industry in Shandong Province. Deciduous Fruit Trees 54:1-4). Sweet cherries are brightly colored and rich in nutrients, including antioxidants, phenolics, cellulose, vitamins, and minerals. They are beneficial for cardiovascular and cerebrovascular diseases, possessing significant economic value and are highly favored by consumers (Kelley DS et al. (2018) A Review of the Health Benefits of Cherries. 10:368). Fruit firmness is affected by a variety of factors, including changes in fruit cuticle thickness and cuticle wax composition, changes in pulp cell wall composition and content, changes in fruit vascular composition and content, and changes in fruit cell wall (cellulose, hemicellulose, pectin, and lignin) content (Liu Gangshuai et al. (2021) Advances in Fruit Cuticle Research. 21:374-385; Gong Yihui et al. (2020) Advances in Research on the Relationship between Peel Wax and Fruit Storage. Packaging Engineering 41:23-28; Liu X et al. (2021) Study on cell wall composition, fruit quality, and tissue structure of hardened 'Suli' pears (Pyrus bretschneideri Rehd). J Plant Growth Regul 40:2007-2016.). Excessive softening of fruit can affect the transportation and storage process of the fruit, seriously affecting the economic benefits of fruit farmers.Given the importance of sweet cherry fruit, it has been used as an important selection indicator in breeding practice.

[0003] At present, along with the development of sequencing technology, sequencing cost is constantly reduced, and more and more plant genomes are parsed, and single nucleotide polymorphism (SNP) is the molecular marker with the largest number and the widest distribution in plant genome, and is used for new variety breeding by screening effective molecular markers, and helps to break genetic linkage and improve breeding efficiency. Association analysis, also known as linkage disequilibrium mapping, is an analytical method (Flint-Garcia SA, Thornsberry JM, Buckler LV ES (2003) Structure of linkage disequilibrium in plants. Annual review of plant biology 54:357-374) based on linkage disequilibrium to identify the relationship between target traits and molecular markers. However, due to the influence of its statistical method and population structure, there is often a false positive problem. Linkage analysis can complement association analysis, so combining association and linkage analysis can quickly and accurately identify genetic loci controlling target traits (Korte, A. and Farlow, A. (2013) The advantages and limitations of trait analysis with GWAS: a review. Plant Methods, 9:29.). Currently, my country lacks sweet cherry germplasm resources and has a limited number of hard-fleshed sweet cherry varieties. Developing more molecular markers that can facilitate resource screening and identification and assist in breeding is of strategic importance for cultivating hard-fleshed sweet cherry varieties in my country. Summary of the Invention

[0004] In response to the problems existing in the prior art, the present invention provides a sweet cherry fruit firmness molecular marker Marker2916, and provides detection primers for detecting the sweet cherry fruit firmness molecular marker, as well as the application of the detection primers in different sweet cherry varieties, especially in the cultivation of hard-fruited sweet cherry seedlings for detection, aiming to solve some of the problems in the prior art.

[0005] Primers were designed to amplify molecular markers associated with sweet cherry fruit firmness. PCR amplification of the gene located at 16,080,628 bp on chromosome 4 of the sweet cherry genome (Prunus avium Tieton Genome v2.0; https: / / www.rosaceae.org / Analysis / 9262820) was performed, with the target fragments 50-150 bp before and after.

[0006] The target is a fragment centered at 16080628 bp on chromosome 4 of the sweet cherry genome and 100 bp before and after.

[0007] The primers are three specific KASP primers, and their sequences are as follows:

[0008] Upstream primer 1: 5'-CACTCAATCCGGGAAGCTGT-3',

[0009] Upstream primer 2: 5'-ACTCAATCCGGGAAGCTGG-3',

[0010] Downstream primer: 5'-CGTAATCCATCACCCTTGAATCT-3',

[0011] Different fluorescent labels are added to the 5' ends of upstream primer 1 and upstream primer 2 respectively.

[0012] The three specific KASP primers are:

[0013] CR2916-F1:5'- GAAGGTCGGAGTCAACGGATT CACTCAATCCGGGAAGCTGT-3'(SEQ IDNO.1),

[0014] CR2916-F2:5'- GAAGGTGACCAAGTTCATGCT ACTCAATCCGGGAAGCTGG-3'(SEQ IDNO.2),

[0015] CR2916-R: 5'-CTCCCACCACTGGCATAGC-3' (SEQ ID NO. 3).

[0016] A molecular marker Marker2916 related to the firmness of sweet cherry fruit is located at a SNP site at the 16080628bp position of chromosome 4 of the sweet cherry genome. The genotype of the SNP site is defined as C / C in hard fruit materials and A / A in soft fruit materials.

[0017] The genotype of the SNP site was obtained by PCR amplification using sweet cherry genomic DNA as a template using KASP primers. The sequences of the KASP primers are as follows:

[0018] CR2916-F1:5'- GAAGGTCGGAGTCAACGGATT CACTCAATCCGGGAAGCTGT-3',

[0019] CR2916-F2:5'- GAAGGTGACCAAGTTCATGCT ACTCAATCCGGGAAGCTGG-3', CR2916-R:5'-CTCCCACCACTGGCATAGC-3'.

[0020] The primers or molecular markers are used in the detection or identification of sweet cherry fruit firmness.

[0021] The application uses the primers to obtain the genotype of the SNP site through PCR amplification with sweet cherry genomic DNA as a template. The genotype in hard fruit materials is C / C, and in soft fruit materials is A / A.

[0022] The primer is a KASP primer, and its sequence is as follows:

[0023] CR2916-F1:5'- GAAGGTCGGAGTCAACGGATT CACTCAATCCGGGAAGCTGT-3',

[0024] CR2916-F2:5'- GAAGGTGACCAAGTTCATGCT ACTCAATCCGGGAAGCTGG-3, CR2916-R:5'-CTCCCACCACTGGCATAGC-3'.

[0025] The PCR amplification reaction system is 5 μL, including 2 μL genomic DNA, 2 μL 2×Taq DNA Polymerase Mix, and 1 μL SNP Primer Mix (4×); the Primer Mix contains CR2916-F1, CR2916-F2, CR2916-R, and ddH2O, wherein CR2916-F1, CR2916-F2, CR2916-R, and ddH2O are mixed at a ratio of 24:24:48:100.

[0026] The present invention is specifically achieved through the following technical solutions:

[0027] A first aspect of the present invention provides a sweet cherry fruit firmness molecular marker, wherein the molecular marker is located at 16080628bp on chromosome 4 of the sweet cherry genome (Prunus avium Tieton Genome v2.0; https: / / www.rosaceae.org / Analysis / 9262820), and the nucleotide at the position is A or C.

[0028] The genotypes of the sweet cherry fruit firmness molecular marker include A / A, A / C, and C / C; wherein, when the genotype is A / A, the sweet cherry fruit is a soft fruit; when the genotype is C / C, the sweet cherry fruit is a hard fruit; and when the genotype is A / C, it is a heterozygous type, and the sweet cherry fruit firmness is between the two.

[0029] A second aspect of the present invention provides detection primers for detecting the sweet cherry fruit firmness molecular marker described above. The detection primers include an upstream primer and a downstream primer; the upstream primers 1 and 2 and the downstream primer. The 3' end of the upstream primer is complementary to two bases of the SNP, and the 5' end is attached to a universal fluorescent linker, which can be any different fluorescent linker for identification. The fluorescent linker used in the present invention is the sequence VIC: GAAGGTCGGAGTCAACGGATT and FAM: GAAGGTGACCAAGTTCATGCT. The primer sequences are as follows:

[0030] CR2916-F1:5'- GAAGGTCGGAGTCAACGGATT CACTCAATCCGGGAAGCTGT-3'(SEQ IDNO.1)CR2916-F2:5'- GAAGGTGACCAAGTTCATGCT ACTCAATCCGGGAAGCTGG-3'(SEQ ID NO.2)

[0031] CR-916-R:

[0032] 5'-CGTAATCCATCACCCTTGAATCT-3'(SEQ ID NO.3)

[0033] Next, the primer powder was diluted to 100 μL / mL, and primers CR2916-F1, CR2916-F2, and CR2916-R were diluted with water in a ratio of 24:24:48:100.

[0034] The third aspect of the present invention provides the use of the above-mentioned detection primers in sweet cherries, which includes the detection of soft and hard sweet cherry varieties and the detection of natural sweet cherry varieties, providing assistance for subsequent breeding.

[0035] A fourth aspect of the present invention provides a method for detecting the firmness of sweet cherry fruit, comprising the following steps:

[0036] S1. Extract genomic DNA from the sweet cherry fruit to be tested, 20 ng / μL;

[0037] S2. Perform PCR amplification using the detection primers shown in SEQ ID NOs: 1-3, detect the fluorescent signal during amplification, and determine the fruit firmness genotype based on the fluorescent signal.

[0038] Furthermore, the PCR amplification reaction system is 4 μL, including 2 μL genomic DNA, 2 μL 2×Taq DNA Polymerase Mix, and 2 μL SNP Primer Mix (4×); the Primer Mix contains CR2916-F1, CR2916-F2, CR2916-R, and ddH2O, wherein CR2916-F1, CR2916-F2, CR2916-R, and ddH2O are mixed at a ratio of 24:24:48:100.

[0039] The first step consisted of one cycle of pre-denaturation (94°C) for 10 min. The second step consisted of 10 cycles of denaturation (94°C) for 20 s and annealing / extension (61°C-55°C) for 45 s, with the temperature decreasing by 0.6°C each cycle. The third step consisted of 37 cycles of denaturation (94°C) for 20 s and annealing / extension (55°C) for 45 s. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the QTL positioning map for three consecutive years (2017-2019), where A is the QTL positioning result in 2017, B is the QTL positioning result in 2018, and C is the QTL positioning result in 2019.

[0041] Figure 2 The genotypes after Marker2916 was developed as a KASP marker, where A represents the genotypes in the parents and B represents the genotypes in the sweet cherry variety.

[0042] Figure 3 Correlation analysis between Marker 2916 genotypes and fruit firmness in different sweet cherry varieties was performed using Anova analysis of variance. Significant differences between the two groups at the p ≤ 0.05 level are indicated by *, and ns indicates no significant difference between the two groups. *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.001; ns, p > 0.05. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below with reference to the embodiments.

[0044] This study is based on a genetic population constructed from the hard-fruited sweet cherry variety 'Wanhongzhu' and the soft-fruited sweet cherry variety 'Shangnan 2808', and a genetic map was constructed using the offspring of the two parent sweet cherries. Using three years of phenotypic data and QTL mapping, a major QTL associated with fruit firmness was located on chromosome 4 ( Figure 1 A, B, and C), qFF4.1, and Marker2916 near its LOD value peak can explain 55.60%, 36.73%, and 37.09% of the phenotypic contribution rates of fruit firmness in 2017-2019 (Table 1).

[0045] Table 1 Phenotypic contribution rate of Marker2916

[0046]

[0047] Sweet cherry varieties were harvested at maturity and then tested using a firmness tester (Firmtech Eleven). Thirty cherries of each variety were tested. After removing the skin with a knife, a 3mm diameter probe was pressed into the fruit to measure firmness in grams.

[0048] Marker2916 was developed as a KASP marker. For example, primer CR2916-F1 carries red fluorescence, and primer CR2916-F2 carries blue fluorescence. When only red fluorescence is detected, it means that the nucleotide at 16080628bp on chromosome 4 is only A, and the SNP site of the sweet cherry sample is determined to be a soft fruit allele, and the genotype is defined as A / A; if only blue fluorescence is detected, it means that the nucleotide at 16080628bp on chromosome LG4 is only C, and the site is determined to be a hard fruit allele, and the genotype is defined as C / C. If green fluorescence appears at the detection site, it means that both A and C exist at the SNP site, and it is determined to be a heterozygote, and the genotype is defined as A / C. It was found that the genotypes of the hard-fruit sweet cherry variety 'Wanhongzhu' and the soft-fruit sweet cherry variety 'Shangnan 2808' are C / C and A / C, respectively (see Figure 2 Middle A).

[0049] Statistics on the fruit firmness of different genotypes in different years found that the average fruit firmness of sweet cherries with the C / C genotype was higher than that of the A / C genotype (see Table 2). Genotyping and identification were performed using 56 sweet cherry varieties preserved by the Forestry and Fruit Research Institute of the Beijing Academy of Agricultural and Forestry Sciences. It was found that the number of sweet cherry varieties with the C / C genotype was 44, and the number of sweet cherry varieties with the A / C genotype was 12 ( Figure 2 Middle B).

[0050] Table 2 Genotypes of Marker2916 in different sweet cherry varieties and their corresponding fruit firmness

[0051]

[0052] Correlation analysis of different Marker2916 genotypes with fruit hardness in different years showed that different genotypes were significantly correlated with fruit hardness. From 2017 to 2019, the fruit hardness of varieties with hard fruit genotypes was increased by 78.8%, 59.1%, and 65% on average compared with varieties with soft fruit genotypes (Table 3, Figure 3 ). This shows that this molecular marker can be used to assist in the breeding of hard-fruited sweet cherry varieties, significantly shortening the breeding time and workload.

[0053] Table 3 Analysis of the breeding potential of Marker2916 for fruit firmness

[0054]

[0055] The genotype detection results of the present invention are highly consistent with the phenotype of the hardness of the fruit of the sample to be tested. After population verification, the amplification effect using the above primers is the best, and the genotypes of the SNP sites in the sweet cherry fruit can be clearly and effectively distinguished, and the above nucleotide mutation sites can be quickly and accurately detected, providing an accurate, fast and effective method for the selection and breeding of hard-fruited sweet cherry varieties.

[0056] The present invention is based on competitive allele-specific PCR (KASP) technology and utilizes the sweet cherry fruit firmness marker site and upstream and downstream specific sequences to design a detection primer set. One end of the upstream primer is provided with a specific linker sequence for connecting to a fluorescent group. The primer set is used to amplify the sample to be tested, and the fluorescent signal generated during the PCR amplification process is then recorded and analyzed by a computer, thereby monitoring single nucleotide variations at the SNP site.

[0057] In summary, based on the genetic population and QTL analysis constructed from the hard-fruited sweet cherry variety 'Wanhongzhu' and the soft-fruited sweet cherry variety 'Shangnan 2808', the present invention located the fruit firmness QTL on chromosome LG4. The SNP variation of 16,080,628 bp near the LOD peak provides a new molecular marker for breeding new hard-fruited sweet cherry varieties. This molecular marker can effectively distinguish soft and hard fruit materials at the genotype level, and has high consistency with the phenotype. The typing effect of genotype detection by PCR amplification is good, which is conducive to greatly improving breeding efficiency and shortening the breeding process.

Claims

1. Primers for amplifying molecular markers related to sweet cherry fruit firmness were designed. The relevant gene was located at 16080628 bp on chromosome 4 of the sweet cherry genome, and the fragments of 50-150 bp before and after it were used as targets. Specific primers for PCR amplification were designed.

2. The primer according to claim 1, wherein the target is a fragment located at 16080628 bp of chromosome 4 of the sweet cherry genome and 100 bp before and after it.

3. The primers according to claim 2, wherein the primers are three specific KASP primers, and the sequences thereof are as follows: Upstream primer 1: 5'-CACTCAATCCGGGAAGCTGT-3', Upstream primer 2: 5'-ACTCAATCCGGGAAGCTGG-3', Downstream primer R: 5'-CGTAATCCATCACCCTTGAATCT-3', Different fluorescent labels are added to the 5' ends of upstream primer 1 and upstream primer 2 respectively.

4. The primer according to claim 3, wherein the three specific KASP primers are: CR2916-F1:5'-GAAGGTCGGAGTCAACGGATTCACTCAATCCGGGAAGCTGT-3', CR2916-F2:5'-GAAGGTGACCAAGTTCATGCTACTCAATCCGGGAAGCTGG-3', CR2916-R:5'-CTCCCACCACTGGCATAGC-3'.

5. A molecular marker, Marker 2916, associated with sweet cherry fruit firmness, characterized by: A SNP site is located at the 16080628 bp position of chromosome 4 of the sweet cherry genome. The genotype of the SNP site is defined as C / C in hard fruit materials and A / A in soft fruit materials.

6. The molecular marker Marker 2916 according to claim 5 is amplified by PCR using KASP primers and sweet cherry genomic DNA as a template to obtain the genotype of the SNP site. The KASP primer sequence is as follows: CR2916-F1:5'-GAAGGTCGGAGTCAACGGATTCACTCAATCCGGGAAGCTGT-3', CR2916-F2:5'-GAAGGTGACCAAGTTCATGCTACTCAATCCGGGAAGCTGG-3', CR2916-R:5'-CTCCCACCACTGGCATAGC-3'.

7. Use of the primers according to any one of claims 1 to 4 or the molecular marker Marker 2916 according to claim 5 or 6 in the screening, detection or identification of sweet cherry fruit firmness.

8. The use according to claim 7, wherein the genotype of the SNP site is obtained by PCR amplification using the primers according to any one of claims 1 to 4 with sweet cherry genomic DNA as a template, and the genotype in the SNP site is C / C in hard fruit materials and A / A in soft fruit materials.

9. The use according to claim 8, wherein the primer is a KASP primer, and its sequence is as follows: CR2916-F1: 5'-GAAGGTCGGAGTCAACGGATTCACTCAATCCGGGAAGCTGT-3', CR2916-F2: 5'-GAAGGTGACCAAGTTCATGCTACTCAATCCGGGAAGCTGG-3, CR2916-R: 5'-CTCCCACCACTGGCATAGC-3'.

10. The use according to claim 9, wherein the PCR amplification reaction system is 5 μL, comprising 2 μL genomic DNA, 2 μL 2×Taq DNA Polymerase Mix, and 1 μL SNP Primer Mix (4×); the Primer Mix comprises CR2916-F1, CR2916-F2, CR2916-R, and ddH2O, wherein: CR2916-F1, CR2916-F2, CR2916-R and ddH2O were mixed evenly at 24:24:48:100.

Images