Application of SNHG8 in preparation of medicine for preventing and treating non-alcoholic fatty liver disease

Abstract

The invention relates to the technical field of biotechnology and gene function and application, and provides application of SNHG8 in preparation of drugs for preventing and treating non-alcoholic fatty liver diseases. The medicine is used for preventing and treating the non-alcoholic fatty liver disease by promoting SNHG8 gene expression. The SNHG8 is applied to preparation of the medicine for preventing and treating the non-alcoholic fatty liver disease, the medicine can effectively reduce the content of triglyceride in the liver by promoting SNHG8 gene expression, liver lipid accumulation increase and lipid metabolism related protein expression up-regulation induced by high-fat and high-cholesterol diet are relieved, and therefore the non-alcoholic fatty liver disease is prevented, treated or relieved. The purpose of preventing and treating the non-alcoholic fatty liver disease is achieved.

Description

Technical Field

[0001] The present invention belongs to the fields of biotechnology and gene function and application technology, and in particular relates to the application of SNHG8 in the preparation of drugs for the prevention and treatment of non-alcoholic fatty liver disease. Background Art

[0002] Non-alcoholic fatty liver disease (NAFLD) is a common liver disease characterized by the accumulation of excess lipids in the liver, leading to lipotoxicity. The clinical burden of NAFLD is not limited to liver-related morbidity and mortality, and there is growing evidence that NAFLD is a multisystem disease that affects extrahepatic organs and regulatory pathways. Currently, there are no approved standard medications for the treatment of NAFLD. Treatment for NAFLD primarily involves dietary and lifestyle interventions, weight loss, and treatment of underlying metabolic syndrome after diagnosis. While effective, these interventions are difficult to maintain. Therefore, identifying new targets for the effective intervention and treatment of NAFLD is of great significance.

[0003] SNHG8 (small nucleolar RNA host gene 8) is a long noncoding RNA (lncRNA) with physiological functions in epithelial and muscle satellite cells. It is known that SNHG8 acts as a molecular sponge for some miRNAs to regulate their target genes. It influences the pathogenesis of atherosclerosis, chronic cerebral ischemia, acute gouty arthritis, ischemic stroke, and myocardial infarction by modulating multiple molecular axes (such as SNHG8 / miR-384 / Hoxa13 / FAM3A and miR-335 / RASA1) and the NF-κB signaling pathway. However, no studies have yet explored the effects of SNHG8 on nonalcoholic fatty liver disease (NAFLD), an early stage of NAFLD. Summary of the Invention

[0004] In view of the deficiencies in the prior art, the present invention provides the use of SNHG8 in the preparation of drugs for the prevention and treatment of non-alcoholic fatty liver disease, which aims to solve the problems mentioned in the background technology.

[0005] The present invention provides the use of SNHG8 in preparing a drug for preventing and treating non-alcoholic fatty liver disease. The drug prevents and treats non-alcoholic fatty liver disease by promoting the expression of the SNHG8 gene.

[0006] Furthermore, the drug for promoting the expression of the SNHG8 gene includes a promoter for promoting the mRNA level of the SNHG8 gene.

[0007] Furthermore, the promoter for promoting the mRNA level of the SNHG8 gene includes an overexpression vector or a biologically active molecule that promotes the mRNA level of the SNHG8 gene.

[0008] Furthermore, the overexpression vector includes a plasmid vector or a viral vector.

[0009] Furthermore, the plasmid vector is an overexpression plasmid containing the full-length coding sequence, cDNA sequence or functionally active fragment of the SNHG8 gene.

[0010] Furthermore, the bioactive molecule includes a protein, polypeptide or enzyme that promotes the transcription of the SNHG8 gene and / or enhances the mRNA stability of the SNHG8 gene.

[0011] Furthermore, preventing and treating non-alcoholic fatty liver disease means preventing, treating or alleviating non-alcoholic fatty liver disease.

[0012] The present invention has the following technical effects: SNHG8 can be used in the preparation of a drug for the prevention and treatment of non-alcoholic fatty liver disease. By promoting SNHG8 gene expression, the drug can effectively reduce liver triglyceride content, alleviate the increased liver lipid accumulation and upregulation of lipid metabolism-related protein expression induced by a high-fat, high-cholesterol diet, thereby preventing, treating, or alleviating non-alcoholic fatty liver disease, achieving the purpose of preventing and treating non-alcoholic fatty liver disease. This indicates that overexpression of SNHG8 can improve the occurrence and progression of non-alcoholic fatty liver disease, especially in the early stages of non-alcoholic fatty liver disease. Therefore, SNHG8 can provide a new theoretical basis and therapeutic target for the preparation of drugs for the prevention and treatment of non-alcoholic fatty liver disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] A more complete understanding of exemplary embodiments of the present invention may be obtained by referring to the following drawings: Figure 1 This is a graph showing the results of analyzing the mRNA level of the SNHG8 gene in each group of mice in Example 2 of the present invention by RT-qPCR, where * indicates p < 0.05 and ## indicates p < 0.01; Figure 2 These are the results of triglyceride content determination in each group of mice in Example 3 of the present invention, **** indicates p < 0.0001, # indicates p < 0.05; Figure 3 4 is a graph showing the pathological changes in liver tissue observed under a microscope after hematoxylin-eosin staining and Oil Red O staining in each group of mice in Example 4 of the present invention; Figure 4 This is a graph showing the expression of lipid metabolism-related proteins in each group of mice in Example 5 of the present invention analyzed by Western blotting, with β-Actin serving as the internal reference protein. DETAILED DESCRIPTION

[0014] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0015] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs; the terms used herein are only for the purpose of describing specific embodiments rather than limiting the present invention.

[0016] An embodiment of the present invention provides the use of SNHG8 in the preparation of a drug for preventing and treating non-alcoholic fatty liver disease. The drug prevents and treats non-alcoholic fatty liver disease by promoting the expression of the SNHG8 gene.

[0017] In some embodiments, the drug that promotes the expression of the SNHG8 gene includes a promoter that promotes the mRNA level of the SNHG8 gene.

[0018] In some embodiments, the promoter for promoting the mRNA level of the SNHG8 gene includes an overexpression vector or a biologically active molecule that promotes the mRNA level of the SNHG8 gene.

[0019] In some embodiments, the overexpression vector comprises a plasmid vector or a viral vector.

[0020] In some embodiments, the plasmid vector is an overexpression plasmid containing the full-length coding sequence, cDNA sequence, or functionally active fragment of the SNHG8 gene.

[0021] In some embodiments, the biologically active molecule includes a protein, polypeptide, or enzyme that promotes transcription of the SNHG8 gene and / or enhances the mRNA stability of the SNHG8 gene.

[0022] In some embodiments, preventing and treating non-alcoholic fatty liver disease is preventing, treating or ameliorating non-alcoholic fatty liver disease.

[0023] Materials and methods 1. Obtaining SNHG8 overexpression plasmid (1) SNHG8 overexpression plasmid was purchased from Beijing Qingke Biotechnology Co., Ltd. The overexpression plasmid used pLIVE vector with SalⅠ and BamHI as restriction sites and inserted the complete SNHG8 sequence.

[0024] The amplified sequence is: F:GAATTATTCTTTTACATTTCAGTTTTTCTGCTAGCAGGCGCCAGTCGACCTCTTTGGCTGCGAT (SEQ ID NO. 1); R: ATGTGATGTTACTCGAGTCCGCGGTGAGCTCTGGATCCTTATTACACACCAAACATCTTTTTATT (SEQ ID NO. 2).

[0025] pLIVE This vector (hepatic in vivo expression vector) is designed to achieve high-level, long-term transgene expression in the mouse liver. It utilizes a chimeric promoter consisting of the mouse alpha-fetoprotein enhancer II and the mouse minimal albumin promoter. Two introns are designed into the vector to enhance expression of the delivered transgene. Downstream of the first intron is a multiple cloning site (MCS) with eight unique restriction enzyme sites for easy insertion of the gene of interest. Compared to classic promoters (such as the CMV immediate-early promoter), the chimeric promoter and two introns collectively promote high-level transgene expression in the liver for extended periods.

[0026] (2) Amplify the purchased plasmid: Use E. coli competent cells for transformation, plate, and invert in a 37°C incubator overnight; remove the overnight culture plate from the 37°C incubator, pick clones, and perform colony PCR (polymerase chain reaction) to identify positive clones.

[0027] PCR identification primers are as follows: F:TTACTCGAGTCCGCGTGAG (SEQ ID NO.3); R:TTCTGCTAGCAGGCGCG (SEQ ID NO. 4).

[0028] (3) Take 5-10 μl of the PCR-positive bacterial solution and inoculate it into 100 ml of LB (containing resistance) medium. Incubate overnight in a shaker at 220 rpm and 37°C for 12-16 hours. Remove the overnight culture and use an endotoxin-free extraction kit to extract the endotoxin-free plasmid from the turbid bacterial solution. Finally, dilute the plasmid with physiological saline for subsequent tail vein injection.

[0029] 2. Mouse tail vein injection (1) Irradiate the mice with an incandescent lamp a few minutes before injection to promote vasodilation.

[0030] (2) Fix the mouse: Place the mouse in a transparent fixator, exposing the tail, and tighten the knob at the rear end of the fixator (be careful not to tighten it too much to avoid compressing breathing).

[0031] (3) Observe the blood vessels: The tail veins of mice are located on both sides of the tail, are bluish-purple in color, and are relatively thin; the arteries are located in the middle, are red in color, and have obvious pulsations. Avoid the arteries during injection.

[0032] (4) Wipe the tail with an alcohol cotton ball for disinfection. After the alcohol evaporates (to avoid stimulating vasoconstriction), hold the syringe in your right hand, with the needle at a 10-15° angle to the tail, and insert the needle from the 1 / 3 of the tail tip. The needle should be inserted to a depth of about 1-2 mm. After insertion, a clear outline of the needle tip can be seen in the blood vessel. If a small amount of blood is withdrawn from the syringe, it means that the needle tip is in the blood vessel. Then, inject the plasmid solution.

[0033] 3. Experimental animals and their breeding (1) Experimental animal species, sex, age and source: C57BL / 6 (C57) mice, male, 6-8 weeks old, were purchased from Jicui Yaokang Biotechnology Co., Ltd.

[0034] (2) Experimental animal feed formula: high-fat and high-cholesterol feed (purchased from Biopac, product number D09100310), energy composition: 40 kcal% fat (palm oil), 20 kcal% fructose and 2% cholesterol.

[0035] (3) Animal husbandry and environmental conditions: All mice were housed in an SPF-grade animal room at the Transgenic Animal Center of the Institute of Translational Medicine, Nanchang University (License No.: SYXK (Gan) 2021-0001). The lighting was alternating every 12 h, the temperature was 24 ± 2 °C, and the humidity was 40-70%. The mice had free access to water and food.

[0036] Example 1: Construction of a mouse model of non-alcoholic fatty liver disease: The purchased mice were ear-tagged and weighed, and then randomly divided into four groups: a normal diet group, a high-fat diet group, a high-fat control group, and a high-fat experimental group. After one week of adaptive feeding, the mice in the normal diet group, high-fat diet group, high-fat control group, and high-fat experimental group were injected with an empty plasmid diluted with saline into the mice in the high-fat control group, and a SNHG8 overexpression plasmid diluted with saline into the mice in the high-fat experimental group using tail vein injection. Thereafter, except for the normal diet group, the other three groups of mice were switched to a high-fat, high-cholesterol diet for a total of 14 weeks. During the 7th week, the mice in the high-fat experimental group were again injected with a saline-diluted SNHG8 overexpression plasmid to maintain high expression of SNHG8 in the liver.

[0037] Mice in each group were intraperitoneally injected with anesthetic (sodium pentobarbital, the dose was adjusted according to the mouse body weight), and liver tissue was obtained by dissection; part of the fresh liver tissue was immediately snap-frozen in liquid nitrogen and stored at -80°C for subsequent RNA extraction, triglyceride and Oil Red O staining, and protein immunoblotting; part of the liver tissue was fixed with 4% paraformaldehyde for subsequent HE (hematoxylin-eosin) staining.

[0038] Example 2: The frozen liver tissues of mice in the normal diet group, high-fat diet group, high-fat control group and high-fat experimental group were taken and the mRNA level of the SNHG8 gene was analyzed by RT-qPCR (reverse transcription-quantitative polymerase chain reaction). Specifically, total RNA was extracted from the liver tissue using TRIzol reagent (purchased from Invitrogen Life Sciences). ® cDNA was synthesized using the III 1stStrand cDNA Synthesis Kit (gDNA digester plus) (purchased from Yisheng, product number 11139ES60). ® Gene amplification was performed using SYBR Green Master Mix (Low RoxPlus) (purchased from Yisheng, Cat. No. 11202ES08). RT-qPCR was performed on an ABI7500 real-time fluorescence quantitative PCR system, and relative gene expression was calculated using the 2-ΔΔCT method. β-Actin was used as an internal control.

[0039] Primer sequences: m-β-Actin-F: GGCTGTATTCCCCTCCATCG (SEQ ID NO.5); m-β-Actin-R: CCAGTTGGTAACAATGCCATGT (SEQ ID NO. 6); m-SNHG8-F:TTTCTAGGAAACGCCGGGA (SEQ ID NO.7); m-SNHG8-R: AAAGGCCCACTCACTACCCA (SEQ ID NO. 8).

[0040] The mRNA level of SNHG8 gene in each group of mice was analyzed by RT-qPCR. Figure 1 As shown, the results showed that the high-fat experimental group mice successfully achieved overexpression of SNHG8; and compared with the normal diet group, the mRNA level of the SNHG8 gene in the liver of mice in the high-fat diet group was reduced.

[0041] Example 3: Frozen liver tissues of mice in the normal diet group, high-fat diet group, high-fat control group, and high-fat experimental group were collected for determination of triglyceride content using a tissue cell enzymatic triglyceride assay kit (Prilai, E1013). (1) Accurately weigh the centrifuge tube, add the liver tissue block and weigh it again, subtract the two (i.e., weight reduction method) to calculate the tissue weight (50 mg), add 1 ml of RIPA lysis buffer, break the tissue with a homogenizer, and let it stand on ice for 10 minutes; (2) Transfer an appropriate amount of supernatant to a 1.5 ml centrifuge tube and heat at 70°C for 10 minutes. The remaining lysate is quantified using a BCA (bicinchoninic acid) protein quantification kit. (3) Centrifuge at 2000 rpm for 5 minutes at room temperature. The supernatant can be used for enzymatic assay. (4) Preparation of working solution: Mix 4 ml of reagent R1 and 1 ml of reagent R2 in a ratio of 4:1. Use immediately or store at 4°C for less than 1 day. Discard if discoloration occurs. (5) Standard dilution: Use distilled water, physiological saline, or a liquid consistent with the sample buffer to dilute the 4 mM glycerol standard in series to 1000, 500, 250, 125, 62.5, 31.25, 15.625, and 7.8125 µmol / L. Take 4 to 6 tubes of these and set up a 0 concentration control reaction tube. (6) Add the sample to a 96-well plate, adding 10 μL of sample and 190 μL of working solution to each well; (7) Incubate at 37°C for 15 minutes, then measure the OD value using a microplate reader. (8) Compare the actual triglyceride content of each group based on the ratio of triglyceride concentration to protein concentration of each sample.

[0042] The results of triglyceride content determination in each group of mice are as follows Figure 2 As shown, the results showed that compared with the normal diet group, the triglyceride content in the liver tissue of mice in the high-fat diet group was significantly increased; but compared with the high-fat control group, the increase in triglyceride in the liver tissue of mice was alleviated after overexpression of SNHG8 (high-fat experimental group).

[0043] Example 4: The liver tissues of mice in the normal diet group, high-fat diet group, high-fat control group, and high-fat experimental group were fixed with 4% paraformaldehyde and stained with hematoxylin-eosin. The pathological changes in the liver tissues of mice in each group were observed under a microscope. The frozen liver tissues of mice in each group were stained with Oil Red O, and the pathological changes in the liver tissues of mice in each group were observed under a microscope.

[0044] The pathological changes of liver tissues of mice in each group were observed under a microscope after hematoxylin-eosin staining and oil red O staining. Figure 3 Hematoxylin-eosin staining revealed that compared with the normal diet group, the liver tissue of mice fed a high-fat diet exhibited extensive steatosis, with round vacuoles of varying sizes and shifted nuclei visible in the cytoplasm. However, compared with the high-fat control group, lipid accumulation and steatosis in the liver tissue of mice fed a high-fat diet were significantly improved. Oil Red O staining revealed diffuse orange-red lipid droplets in both the high-fat diet and control groups, while the area of ​​red lipid droplets was significantly reduced in the high-fat diet group.

[0045] Example 5: The frozen liver tissues of mice in the normal diet group, high-fat diet group, high-fat control group, and high-fat experimental group were obtained, and the expression of lipid metabolism-related proteins (FASN, ACC1, ACLY, and SCD1) was analyzed by western blotting.

[0046] The expression of lipid metabolism-related proteins in each group of mice was analyzed by Western blotting. Figure 4 As shown, the results showed that a high-fat and high-cholesterol diet significantly upregulated the expression of lipid metabolism-related proteins, but overexpression of SNHG8 significantly reversed this phenomenon.

[0047] In summary, overexpression of SNHG8 can improve the occurrence and development of non-alcoholic fatty liver disease. Therefore, SNHG8 can provide a new theoretical basis and therapeutic target for the preparation of drugs for the prevention and treatment of non-alcoholic fatty liver disease.

[0048] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of SNHG8 in the preparation of a drug for the prevention and treatment of non-alcoholic fatty liver disease, characterized in that: The drug prevents and treats non-alcoholic fatty liver disease by promoting the expression of the SNHG8 gene.

2. The use according to claim 1, characterized in that: Drugs for promoting the expression of the SNHG8 gene include promoters for promoting the mRNA level of the SNHG8 gene.

3. The use according to claim 2, characterized in that: The promoter for promoting the mRNA level of the SNHG8 gene includes an overexpression vector or a biologically active molecule that promotes the mRNA level of the SNHG8 gene.

4. The use according to claim 3, characterized in that: The overexpression vector includes a plasmid vector or a viral vector.

5. The use according to claim 4, characterized in that: The plasmid vector is an overexpression plasmid containing the full-length coding sequence, cDNA sequence or functionally active fragment of the SNHG8 gene.

6. The use according to claim 3, characterized in that: The bioactive molecules include proteins, polypeptides or enzymes that promote the transcription of the SNHG8 gene and / or enhance the mRNA stability of the SNHG8 gene.

7. The use according to claim 1, characterized in that: Prevention and treatment of non-alcoholic fatty liver disease means preventing, treating or alleviating non-alcoholic fatty liver disease.

Images