Tumor microenvironment response bacterium-nano hybrid system as well as preparation method and application thereof

Abstract

The invention belongs to the field of preparation of biomedical nano-materials, and particularly relates to a tumor microenvironment responsive bacterium-nano hybrid system as well as a preparation method and application thereof. According to the invention, an engineering bacterium containing an acid response promoter and coding PD-L1 blocking peptide is prepared, and then lipidosome nanoparticles containing calcium carbonate, curcumin and an XIAP / cIAP1 antagonist are attached to the bacterium, so that the bacterium-nano hybrid system with tumor microenvironment response is obtained. The system can realize accurate drug delivery and controllable release in an acidic tumor microenvironment through a unique pH response mechanism, shows remarkable tumor targeting and treatment effects, and can be used as an anti-tumor drug.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical nanomaterial preparation, and particularly relates to a tumor microenvironment-responsive bacteria-nano hybrid system and a preparation method and application thereof. Background Art

[0002] Immunotherapy is a hot topic in cancer treatment and is considered one of the most promising approaches. In particular, immune checkpoint blockade (ICB), a core strategy in tumor immunotherapy, has significantly improved clinical outcomes in a variety of malignancies by disabling T cell inhibitory signaling. While ICB has been widely used in the clinical treatment of various tumors, response rates remain low, and most cancer patients do not benefit from immunotherapy. Existing data indicate that the objective response rate of ICB therapy remains less than 30%, and its clinical efficacy is limited by three key bottlenecks: 1) Systemic administration of conventional ICB formulations results in nonspecific distribution, which not only exacerbates inflammatory damage in normal tissues but also leads to serious immune-related adverse events (IRAEs) through off-target effects. Furthermore, their difficulty penetrating the tumor stromal barrier results in insufficient effective therapeutic concentrations; 2) Aberrant downregulation of MHC-I, a key antigen presentation molecule, in the tumor microenvironment leads to immune escape; and 3) an immunosuppressive microenvironment leads to insufficient tumor immunogenicity, hindering the anti-cancer efficacy of immunotherapy. Therefore, in order to optimize the efficacy of checkpoint blockade immunotherapy, an immune checkpoint therapy platform that specifically targets the tumor and accurately blocks the surface of tumor cells is developed to reduce IRAEs, improve intratumoral delivery, avoid immune escape, enhance tumor immunogenicity, and improve the response rate of immunotherapy.

[0003] In recent years, synthetic biology has provided new insights into overcoming this dilemma. Genetically engineered bacteria have garnered widespread attention due to their unique tumor-targeting advantages: facultative and obligate anaerobes can specifically colonize the hypoxic microenvironment of tumor tissue, enabling the spatiotemporal controllable expression of therapeutic proteins through modular genetic circuits. This "living biovector" strategy not only increases drug accumulation within lesions, but its localized action also holds the potential to mitigate systemic IRAEs at their source. However, existing bacterial therapies primarily focus on the delivery of cytotoxic proteins and lack the ability to synergistically regulate the tumor immune microenvironment.

[0004] From the perspective of immune activation mechanism, MHC-I molecules are the core components of antigen presentation, and their expression deficiency has been shown to be significantly associated with ICB resistance. Pyroptosis, a new type of programmed death, exhibits unique immune regulatory advantages: through the pore-forming effect of gasdermin protein, a large number of tumor-associated antigens (TAAs) and damage-associated molecular patterns (DAMPs) are released, which can reshape the immunosuppressive microenvironment and enhance CD8 +T cell cross-activation. However, existing pyroptosis inducers (such as chemotherapy drugs, photosensitizers) generally have problems such as poor tumor selectivity and inducing inflammatory damage to normal tissues. The rapid development of nanomedicine provides technical support for precise delivery. Smart responsive nanocarriers can increase tumor accumulation through passive targeting by the EPR effect or active targeting by surface modification, but their single biological function limits the comprehensive therapeutic effect. Therefore, there is an urgent need to develop a multimodal collaborative platform that integrates the biological targeting and engineering advantages of bacteria, the immune activation effect of pyroptosis, and the controllable delivery characteristics of nanomaterials, so as to achieve precise ICB while breaking through the tumor immune resistance mechanism. Summary of the Invention

[0005] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide a method for preparing a tumor microenvironment-responsive bacteria-nano hybrid system.

[0006] Another object of the present invention is to provide a tumor microenvironment-responsive bacteria-nano hybrid system obtained by the above preparation method.

[0007] Another object of the present invention is to provide applications of the above-mentioned tumor microenvironment-responsive bacteria-nano hybrid system.

[0008] The object of the present invention is achieved by the following technical solution: a method for preparing a tumor microenvironment-responsive bacteria-nano hybrid system, comprising the following steps:

[0009] (1) Transforming a plasmid DNA containing an acid-responsive promoter and encoding a PD-L1 blocking peptide into Escherichia coli to obtain an engineered bacterium having an acid-responsive promoter and expressing a PD-L1 blocking peptide;

[0010] (2) culturing the engineered bacteria obtained in step (1) using a compound containing an azide group to obtain an engineered bacteria with azide groups modified on its surface;

[0011] (3) XIAP / cIAP1 antagonist, DOPE, DSPE-PEG 2000 , CHEMS and DSPE-PEG 2000 -DBCO is mixed evenly in an organic solvent to obtain a mixed solution A; then the organic solvent is removed to obtain the original liposome membrane;

[0012] (4) mixing the original liposome membrane with an alkaline solution and hydrating with sterile water; performing ultrasonic vortex operation during the hydration process, and extruding the hydrated product to obtain a liposome suspension;

[0013] (5) removing free substances from the liposome suspension by ultrafiltration to obtain LipB-DBCO;

[0014] (6) mixing curcumin-loaded calcium carbonate nanoparticles and LipB-DBCO, and extruding to obtain LipBCa-DBCO;

[0015] (7) The LipBCa-DBCO obtained in step (6) and the recombinant bacteria with surface modification of azide groups obtained in step (2) are mixed, cultured, solid-liquid separated, and the solid obtained is washed to obtain a bacteria-nano hybrid system responsive to the tumor microenvironment.

[0016] The acid-responsive promoter in step (1) is preferably adiA promoter.

[0017] The amino acid sequence of the PD-L1 blocking peptide described in step (1) is preferably: DWFKAFYDKINETYNK.

[0018] The PD-L1 blocking peptide described in step (1) is preferably modified by ClyA protein so as to be expressed on the bacterial surface; the ClyA protein is located at the N-terminus of the PD-L1 blocking peptide.

[0019] The plasmid described in step (1) preferably contains the nucleic acid sequence shown in SEQ ID NO.1.

[0020] The framework vector of the plasmid described in step (1) is a pET series vector; more preferably pET3a.

[0021] The engineered Escherichia coli described in step (1) is preferably Escherichia coli MG1655.

[0022] The azide group-containing compound in step (2) is preferably 2-azido-2-deoxy-D-glucose.

[0023] The amount of the azide group-containing compound in step (2) is preferably 8 ~10 9 CFU ratio 1mg of azide-containing compound.

[0024] The culturing time in step (2) is preferably 10 to 16 hours.

[0025] The XIAP / cIAP1 antagonist in step (3) is preferably birinapant.

[0026] The amounts of the components used in step (3) are as follows: XIAP / cIAP1 antagonist, DOPE, DSPE-PEG 2000 , CHEMS and DSPE-PEG2000-DBCO are mixed in a molar ratio of 1:5~6:0.4~0.6:3~4:0.3~0.5; preferably in a molar ratio of 1:5.6:0.5:3.7:0.4.

[0027] The organic solvent described in step (3) is preferably an organic solvent obtained by mixing chloroform and methanol in a volume ratio of 8 to 9:1 to 2; more preferably an organic solvent obtained by mixing chloroform and methanol in a volume ratio of 9:1.

[0028] The method for removing the organic solvent in step (3) is preferably a rotary evaporation method.

[0029] The temperature of the rotary evaporation is preferably 35-45°C, more preferably 40°C.

[0030] The alkaline solution in step (4) is preferably a NaOH solution; more preferably a concentration of 0.1 mol L -1 of NaOH solution.

[0031] The amount of the alkaline solution in step (4) is preferably 10 to 20 μL of alkaline solution per 200 μL of mixed solution A.

[0032] The amount of sterile water used in step (4) is preferably 0.5-1.5 mL of sterile water per 200 μL of mixed solution A; more preferably 1 mL of sterile water per 200 μL of mixed solution A.

[0033] The hydration time in step (4) is preferably 30 to 90 minutes, more preferably 60 minutes.

[0034] The number of vortexing in step (4) is preferably 5 to 6 times.

[0035] The specific operation of extrusion described in step (4) is preferably as follows: extrusion is carried out through 0.45μm, 0.22μm and 0.1μm polycarbonate films in sequence; more preferably as follows: extrusion is carried out through 0.45μm, 0.22μm and 0.1μm polycarbonate films in sequence, and each specification of polycarbonate film is extruded 2 to 3 times.

[0036] The ultrafiltration described in step (5) is preferably achieved by using an ultrafiltration centrifuge tube.

[0037] The ultrafiltration centrifuge tube is preferably an ultrafiltration centrifuge tube with MWCO=10KDa.

[0038] The curcumin-loaded calcium carbonate nanoparticles described in step (6) are preferably synthesized by a gas diffusion method; preferably, they are prepared by the following steps: dissolving calcium chloride and curcumin in ethanol, placing the obtained mixed solution in a CO2-rich environment for reaction; after the reaction is completed, solid-liquid separation is performed, and the obtained solid is washed with ethanol to obtain curcumin-loaded calcium carbonate nanoparticles.

[0039] The calcium chloride and the curcumin are preferably mixed in a mass ratio of 20 to 40:1; more preferably in a mass ratio of 30:1.

[0040] The reaction conditions are preferably 35-45° C. for 48-96 h; more preferably 40° C. for 72 h.

[0041] The solid-liquid separation method is preferably centrifugation.

[0042] The centrifugal speed is preferably 8000-12000 rpm, more preferably 10000 rpm.

[0043] The amount of the curcumin-loaded calcium carbonate nanoparticles in step (6) is calculated based on a mass ratio of 2:0.7 to 0.9 of the calcium carbonate nanoparticles to the XIAP / cIAP1 antagonist; preferably, the amount is calculated based on a mass ratio of 2:0.81 of the calcium carbonate nanoparticles to the XIAP / cIAP1 antagonist.

[0044] The extrusion described in step (6) is preferably achieved using a micro-extruder.

[0045] The LipBCa-DBCO described in step (7) and the recombinant bacteria modified with azide groups on the surface are preferably mixed at a ratio of 400 to 600 μg to 10 8 CFU ratio; more preferably 500μg ratio 10 8 CFU ratio.

[0046] The culture conditions in step (7) are preferably cultured at 37±1°C for 4 to 8 hours; more preferably cultured at 37±1°C for 6 hours.

[0047] The solid-liquid separation method in step (7) is preferably centrifugation.

[0048] The centrifugal conditions are preferably 4000-8000 rpm for 2-5 min; more preferably 6000 rpm for 3 min.

[0049] The washing solvent in step (7) is preferably deionized water.

[0050] A tumor microenvironment-responsive bacteria-nano hybrid system is obtained by the above preparation method.

[0051] The application of the tumor microenvironment-responsive bacteria-nano hybrid system in the preparation of anti-tumor drugs.

[0052] The present invention has the following advantages and effects compared to the prior art:

[0053] The tumor microenvironment-responsive bacteria-nano hybrid system provided by this invention possesses multiple anti-tumor advantages and precise targeting properties. Through its unique pH-responsive mechanism, this system enables precise drug delivery and controlled release in the acidic tumor microenvironment, demonstrating significant tumor targeting and therapeutic efficacy. Specifically, this system has the following outstanding advantages:

[0054] (1) Multiple synergistic therapeutic mechanisms: The system can simultaneously achieve PD-L1 blocking, MHC-I upregulation and tumor cell pyroptosis induction, and synergistically enhance the anti-tumor immune response through multiple pathways. Among them, the PD-L1 blocking peptide expressed on the surface of the bacterial membrane can specifically bind to PD-L1 on the surface of tumor cells, continuously blocking the PD1 / PD-L1 immunosuppressive axis, protecting the anti-tumor activity of T cells, and effectively relieving tumor immunosuppression. The Ca released in response 2+ It synergistically induces tumor cell pyroptosis and enhances MHC-I antigen presentation with the chemical drug Birinapant, significantly improving the therapeutic effect.

[0055] (2) Precise targeted delivery: The system utilizes the acidic characteristics of the tumor microenvironment to achieve Ca 2+ The selective release of birinapant and responsive expression of PD-L1 blocking peptide minimizes toxic side effects on normal tissues and effectively avoids common immune-related adverse reactions in traditional immunotherapy.

[0056] (3) Safety advantage: The tumor microenvironment response characteristics of the system ensure that the therapeutic ingredients act mainly at the tumor site, significantly reducing the systemic immune-related adverse reactions that may be caused by traditional immune checkpoint inhibitors and improving the safety of treatment.

[0057] This system integrates the advantages of bacterial vectors and nanotechnology, allowing the nanocarriers to be released in situ after the bacteria target the tumor site, exerting the spatiotemporal synergistic effects of PD-L1 blockade, MHC-I upregulation and pyroptosis induction, achieving precision, efficiency and safety of tumor immunotherapy, and providing a new solution for tumor immunotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 This is the Myc-tag protein expression detection result of E-MG1655 at different pH.

[0059] Figure 2 TEM image of LipBCa nanoparticles.

[0060] Figure 3 This is the scanning electron microscope (SEM) image of E-MG1655-LipBCa.

[0061] Figure 4This is the X-ray diffraction (XRD) pattern of E-MG1655-LipBCa.

[0062] Figure 5 This is the X-ray photoelectron spectroscopy (XPS) diagram of E-MG1655-LipBCa.

[0063] Figure 6 The release curve of Birinapant from E-MG1655-LipBCa is shown in FIG. 1 , wherein A is PBS at pH 7.4, and B is PBS at pH 5.5.

[0064] Figure 7 Figure 2 is the detection result after E-MG1655-LipBCa treatment of cells; A is the cell viability of B16F1 cells with different concentrations of E-MG1655-LipBCa, B is the live-dead staining assessment, and C is the Ca in the mitochondria of B16F1 cells after E-MG1655-LipBCa treatment. 2+ A is the fluorescence microscopy imaging of the concentration of E-MG1655-LipBCa, D is the fluorescence microscopy imaging of the oxidative stress of B16F1 cells after treatment with E-MG1655-LipBCa, and E is the fluorescence microscopy imaging of the membrane potential of B16F1 cells after treatment with E-MG1655-LipBCa.

[0065] Figure 8 The figures show the detection results after cells were treated with E-MG1655-LipBCa; A shows the expression of cleaved caspase-3 after cells were treated with E-MG1655-LipBCa, B shows the expression of GSDME-FL and GSDME-N after cells were treated with E-MG1655-LipBCa, C shows the release level of LDH, and D shows the release level of ATP.

[0066] Figure 9 These are the test results after cells were treated with E-MG1655-LipBCa; A is the fluorescence microscope image of PD-L1 blockade, and B is the expression of MHC-I detected by flow cytometry.

[0067] Figure 10 Figure 1 is the result of E-MG1655-LipBCa treatment of mouse melanoma model; A is the tumor growth curve of mouse subcutaneous melanoma (B16F1) model; B is the weight change of mice during treatment; C is the H&E staining result of tumor tissue after treatment; D is the number of tumor-infiltrating T lymphocytes CD8 + T cells and CD4 + The proportion of T cells. DETAILED DESCRIPTION

[0068] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0069] Example 1:

[0070] Preparation of a bacteria-nanohybrid system (E-MG1655-LipBCa) that blocks PD-L1, upregulates MHC-I, and induces tumor cell pyroptosis in response to the tumor microenvironment. The specific steps are as follows:

[0071] (1) Preparation of a genetically engineered bacterium (E-MG1655) with an acid-responsive promoter and expressing a PD-L1 blocking peptide

[0072] The adiA promoter region DNA and ClyA gene were extracted from Escherichia coli genomic DNA, and a sequence was designed in which the adiA promoter region DNA, ClyA gene, and blocking peptide (DWFKAFYDKINETYNK) gene were connected in sequence. After codon optimization, the sequence shown below was obtained and synthesized by Shanghai Sangon Biotechnology Co., Ltd. and cloned into the pET3a plasmid via BglII and BamHI. The acid-inducible expression vector was transformed into Escherichia coli DH5α competent cells by heat shock method for recombination. After large-scale replication, the plasmid was extracted and purified using a plasmid extraction kit. The plasmid pET3a contains the adiA promoter, ClyA-DWFKAFYDKINETYNK gene, and ampicillin resistance gene. It was then transferred to Escherichia coli MG1655 and the expression of the gene was confirmed by ampicillin resistance (100 μg mL -1 ) were cultured overnight at 37°C on Luria-Bertani (LB) agar plates, and E-MG1655 was obtained after screening. E-MG1655 colonies were then inoculated into 10 mL of LB medium for expansion. The resulting seed solution was then inoculated into LB medium at different pH values ​​(5.5, 6.5, and 7.4). The supernatant obtained after bacterial cell disruption was used for Western blotting. Figure 1 As shown in the figure, the Myc-tag protein expression of E-MG1655 at different pH was verified by Western blotting experiments. As the pH decreased, the expression of myc-tag gradually increased, and the best expression was at pH 5.5.

[0073] The sequences of the adiA promoter region DNA and ClyA-PD-L1 blocking peptide gene are as follows (positions 1 to 253 are the adiA promoter, positions 254 to 1162 are the ClyA gene, positions 1163 to 1221 are the myc-Tag protein gene, and positions 1223 to 1270 are the PD-L1 blocking peptide encoding gene:

[0074] gattggtttaaagcgttttatgataaaattaacgaaacctataacaaa taa.

[0075] (2) Construction of a multifunctional nanocomposite carrier (LipBCa) on the surface of engineered bacteria

[0076] CaCUR nanoparticles were synthesized using a gas diffusion method. Briefly, 150 mg of CaCl₂·2H₂O and 5 mg of curcumin were dissolved in 100 mL of anhydrous ethanol. A beaker was covered with plastic wrap with several holes. 5 g of NH₄HCO₃ was placed in another beaker. The two flat-bottomed beakers were then placed in a sealed container. The mixture was reacted at 40°C for 72 h. The dispersed CaCUR nanoparticles were collected by centrifugation at 10,000 rpm and washed three times with ethanol. Finally, the resulting CaCUR nanoparticles were dispersed in a 0.9% sodium chloride solution for further use.

[0077] LipB nanoparticles were prepared by lipid membrane hydration method. Briefly, 100 μL of birinapant (10 mM, molecular weight 806.94, 0.81 mg) was mixed with 100 μL of 4.2 mg DOPE (dilinoleoylphosphatidylethanolamine, molecular weight 744.05, molar number 5.6 μmol), 1.5 mg DSPE-PEG 2000 (distearylphosphatidylethanolamine-polyethylene glycol 2000, molecular weight 2849.507, molar number 0.5 μmol), 1.8 mg CHEMS (cholesterol succinate, molecular weight 486.73, molar number 3.7 μmol) and 1.4 mg DSPE-PEG 2000 -DBCO (distearoylphosphatidylethanolamine-polyethylene glycol 2000-dibenzocyclooctyne, molecular weight 3154.807, molar number 0.4 μmol) chloroform / methanol (v / v, 9 / 1) solution (DOPE, DSPE-PEG 2000 , CHEMS and DSPE-PEG 2000 The mixture was mixed with 1% PEG-DBCO in a molar ratio of 5.6:0.5:3.7:0.4, and then transferred to a 50 mL round-bottom flask. The organic solvent was removed by continuous rotary evaporation at 40 ° C to prepare the original liposome membrane. Then, sodium hydroxide (NaOH) solution (0.1 mol L -1, 10-20 μL) was poured into the original liposome membrane to promote the full ionization of CHEMS, and then a lamellar structure was formed to obtain a lipid membrane. Subsequently, the lipid membrane was hydrated for 1 hour by adding 1 mL of sterile water at room temperature, with occasional vortexing, and then sequentially extruded with 0.45 μm, 0.22 μm and 0.1 μm polycarbonate membranes. Each specification of polycarbonate membrane was extruded 3 times to form a liposome suspension. The liposome suspension was centrifuged (3000 rpm, 10 min) through an ultrafiltration centrifuge tube (MWCO = 10 KDa), and the unloaded Birinapant was removed as the filtrate. The concentrate was collected to obtain LipB-DBCO.

[0078] 2 mL of PBS (0.1 M, pH 7.4) containing CaCUR (1 mg / mL) was added to the hydrated LipB-DBCO, and then the mixture was stirred at 100 W cm -2 The LipBCa-DBCO nanoparticles were obtained by ultrasonication under the probe for 5 minutes and then harvested by micro extruder. TEM imaging showed that the LipBCa-DBCO nanoparticles were spherical in shape and about 150 nm in size (Fig. Figure 2 shown).

[0079] (3) Preparation of E-MG1655-LipBCa:

[0080] 1 mg of 2-azido-2-deoxy-D-glucose was added to 10 mL of LB medium and mixed with E-MG1655 (final concentration of 10 8 CFU mL -1 ) were co-cultured overnight to obtain E-MG1655-N3. LipBCa-DBCO (500 μg mL -1 ) was added to the mixture containing E-MG1655-N3(10 8 CFU mL -1 ) solution at 37°C for 6 h. The mixture was centrifuged at 6000 rpm for 3 min, and the precipitate was washed three times with deionized water to obtain E-MG1655-LipBCa.

[0081] Scanning electron microscopy (SEM) images of E-MG1655-LipBCa showed that LipBCa successfully bound to the surface of MG1655 ( Figure 3 ). E-MG1655-LipBCa was collected, freeze-dried, and then analyzed by X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS). Figure 4 The X-ray diffraction pattern of E-MG1655-LipBCa is shown, which matches the CaCO3 standard card (JCPDS No.33-0268). Figure 5As shown in the high-resolution Ca 2p XPS spectrum of E-MG1655-LipBCa, two binding energy peaks are located at 350.70 and 347.25 eV, which are attributed to Ca 2+ 2p1 / 2 and Ca 2+ 2p3 / 2. Therefore, XRD and XPS results confirmed the existence of CaCO3 on the surface of E-MG1655.

[0082] The birinapant release kinetics of E-MG1655-LipBCa was determined by dialysis. The specific steps were as follows: 1 mL of E-MG1655-LipBCa (1 mg mL –1 , dispersed in 0.1 M PBS, pH 7.4 or 5.5), incubated in PBS buffer (200 mL, 0.1 M) at pH 7.4 or pH 5.5, and continuously stirred (250 rpm) at room temperature. 1 mL was taken at 0, 1, 2, 6, 12, 24, 36, 48, and 72 h, and its absorbance at 400 nm was measured. The birinapant release rate was calculated based on the birinapant standard curve. The specific release behavior of E-MG1655-LipBCa under different pH conditions is shown in Figure 2. Figure 6 As shown in the figure, at pH 5.5, the cumulative release of birinapant from E-MG1655-LipBCa was as high as 58.4% after 72 h, indicating that it has a rapid release behavior under acidic conditions.

[0083] Example 2

[0084] The in vitro cytotoxicity and calcium overload induction experiments of E-MG1655-LipBCa were performed as follows:

[0085] Mouse melanoma B16F1 cells were plated in 96-well plates (1×10 4 cells / well) for 24 h, and different concentrations (0, 1.56, 3.13, 6.25, 12.5, 25, 50, 100, 200 μg mL -1 ) E-MG1655-LipBCa solution (solvent is 0.01M, pH 7.4 PBS, added at a volume of 100 μL / well) was incubated with B16F1 cells for 24 h, and then the relative survival rate was detected using the standard methylthiazolium tetrazolium (MTT) method. Figure 7 As shown in A, 200 μg mL -1 E-MG1655-LipBCa reduced the viability of B16F1 cells to 70%. -1The cells treated with E-MG1655-LipBCa and the untreated cells were stained with calcein-AM (1 μmol / L) and PI (1 μmol / L) for 15 min at room temperature in the dark, and the cell fluorescence images were observed using an inverted fluorescence microscope. Figure 7 As shown in B, E-MG1655-LipBCa can effectively kill B16F1 cells.

[0086] B16F1 cells were plated in 24-well plates (4 × 10 4 The cells were incubated in 4% paraformaldehyde (P < 0.05) for 24 h and then incubated with 1 mL / well of 200 μg mL -1 The cells were incubated with E-MG1655-LipBCa solution (0.01 M PBS, pH 7.4) for 24 h. After washing with PBS, the cells were washed with Flow-4AM (a specific mitochondrial Ca 2+ Probe) staining, and fluorescence microscopy was used to detect whether the mitochondrial Ca 2+ The control group consisted of cells that were not incubated with E-MG1655-LipBCa and were incubated only with PBS. The B16F1 cells after different treatments were stained and imaged with a fluorescence microscope. It was found that a stronger fluorescence intensity was observed in the cells treated with E-MG1655-LipBCa (see Figure 7 C), which should be a large amount of Ca in mitochondria 2+ Breakdown of mitochondrial Ca 2+ dynamic balance of mitochondrial Ca 2+ Overload, oxidative stress surges in cells.

[0087] B16F1 cells were plated in 24-well plates (4 × 10 4 The cells were incubated in 4% paraformaldehyde (P < 0.05) for 24 h and then incubated with 1 mL / well of 200 μg mL -1 The cells were incubated with E-MG1655-LipBCa solution (solvent: 0.01M PBS, pH 7.4) for 24 hours. After washing with PBS, the intracellular oxidative stress was measured using the 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) probe or the mitochondrial probe 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolylcarbocyanine iodide (JC-1) was used to evaluate the mitochondrial membrane potential of B16F1 cells after E-MG1655-LipBCa treatment. Fluorescence microscopy was used to detect whether the mitochondrial membrane potential of B16F1 cells was reduced. The control group was composed of cells that were not incubated with E-MG1655-LipBCa and were incubated only with PBS. The intracellular oxidative stress was measured using the 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) probe, and it was found that ROS in cells treated with E-MG1655-LipBCa increased significantly (see Figure 7D). Mitochondrial Ca was assessed using the mitochondrial probe 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolylcarbocyanine iodide (JC-1). 2+ The degree of mitochondrial damage caused by overload enhancement, such as Figure 7 As shown in Figure E, after treatment with E-MG1655-LipB, the mitochondria of B16F1 cells were at a higher mitochondrial membrane potential, causing JC-1 to produce aggregates and become fluorescent red.

[0088] Example 3

[0089] E-MG1655-LipBCa induces cell pyroptosis, upregulation of MHC-I expression, and PD-L1 blockade. The specific steps are as follows:

[0090] B16F1 cells were seeded in 6-well plates (1.6×10 6 cells / well) for 24 h, incubate until completely adherent, and add 1.6 mL / well of 200 μg mL -1 After incubation with E-MG1655-LipBCa solution (solvent is 0.01M PBS, pH 7.4) for 24 hours, the cells were washed twice with PBS, and proteins were extracted with RIPA buffer. The protein concentration was detected by BCA protein kit (Sigma-Aldrich), ATP detection kit was used to detect ATP, and LDH detection kit was used to detect LDH. Then, protein immunoblotting was used to detect the levels of cytochrome C, Pro-caspase 3 and Cleaved-caspase 3, GSDME and GSDME-N. Finally, a chemiluminescence imaging system (Tanon5200Multi, Tanon, China) was used to observe the protein bands. Figure 8 As shown in Figure A, E-MG1655-LipBCa induced the release of cytochrome C from mitochondria into the cytoplasm and increased the expression of cleaved caspase-3. GSDME protein is a key executioner in the pyroptosis process because it can be cleaved by caspase-3 into an active membrane perforation domain (GSDME-N). Figure 8 As shown in Figure B, after E-MG1655-LipBCa treatment of cells, GSDME-FL can be effectively cleaved into the GSDME-N domain. The expression level of GSDME-N protein is significantly increased, indicating that the E-MG1655-LipBCa group provides complete conditions for the occurrence of pyroptosis. Figure 8 As shown in Figures C and D, E-MG1655-LipBCa significantly stimulated LDH and ATP secretion. These results confirm that mitochondrial Ca 2+ The sudden surge of Ca 2+ homeostasis, leading to mitochondrial Ca 2+Overload ultimately leads to an increase in ROS and the release of cytochrome C, which further activates caspase-3 to cleave GSDME. The N-terminal domain generated by GSDME binds to membrane phospholipids to form transmembrane pores, leading to pyroptosis and the release of related inflammatory molecules and cellular contents.

[0091] B16F1 cells were plated in 6-well plates (1.6×10 5 The cells were incubated in 4% paraformaldehyde (P < 0.05) for 24 h and then diluted with 1.6 mL / well of 100 μg mL -1 The cells were incubated with E-MG1655-LipBCa solution (solvent: 0.01M PBS, pH 7.4) for 24 hours. The cells were washed twice with PBS and fixed with 4% v / v paraformaldehyde for 20 minutes. The control group consisted of cells that were not treated with E-MG1655-LipBCa and were incubated with PBS only. The cells were incubated with PD-L1 primary antibody for 1 hour and then with FITC-conjugated secondary antibody for 1 hour, and then the blocking effect of PD-L1 was evaluated under a fluorescence microscope. Figure 9 As shown in Figure A, the green fluorescence level of PD-L1 in B16F1 cells in the control group was significantly increased, while almost no green fluorescence was observed in the E-MG1655-LipBCa group.

[0092] B16F1 cells were plated in 6-well plates (1.6 × 10 5 cells / well) for 24 h and then incubated with 1.6 mL / well of 100 μg mL -1 The cells were incubated with E-MG1655-LipBCa solution (solvent: 0.01M PBS, pH 7.4) for 24 hours. The control group was cells incubated with PBS only without E-MG1655-LipBCa. After washing with PBS three times, the cells were treated with trypsin and the precipitate was collected by centrifugation at 1000 rpm. The resulting precipitate was incubated with MHC-I primary antibody for 1 hour and with FITC-conjugated secondary antibody for 30 minutes, and then the expression of MHC-I in the membrane was detected by flow cytometry. Figure 9 As shown in Figure B, the MHC-I expression in the E-MG1655-LipBCa group was higher than that in the control group, indicating that Birinapant can induce MHC-I expression, thereby restoring the function of T cells to present and recognize antigens.

[0093] Example 4 Application of E-MG1655-LipBCa in the treatment of melanoma, the specific steps are as follows:

[0094] Containing 1×10 6 B16F1 cells / mL in PBS (100 μL / mouse) were subcutaneously implanted into the back of female C57BL / 6 mice to establish B16F1 tumor-bearing mice. 3At about 1 hour, PBS (control group) and E-MG1655-LipBCa (equivalent to 10 8 CFU MG1655 / mouse). The tumor volume and body weight of the mice were monitored throughout the experiment. The mice were killed 14 days after treatment, and the main organs and tumors were taken for H&E staining and immune cell infiltration flow cytometric analysis. The tumor and main organs were immersed in 4% paraformaldehyde, and tissue sections were prepared, stained with hematoxylin and eosin, and observed under an optical microscope. For flow cytometry detection, the tumor was cut into small pieces and completely minced with a sterile blade. Subsequently, a single cell suspension was obtained by filtering through a 200 mesh sieve. The cells were collected, centrifuged at 1200 rpm for 5 minutes, and CD4 was labeled with anti-CD3-FITC, anti-CD4-PE, and anti-CD8-APC antibodies. + T helper cells (CD3 + CD4 + T cells) and CD8 + Cytotoxic T cells (CD3 + CD8 + T cells) were stained by flow cytometry. Figure 10 As shown in Figure A, tumors in mice treated with PBS continued to grow. In contrast, E-MG1655-LipBCa combined treatment significantly inhibited tumor growth. Figure 10 As shown in Figure B, the weight of B16F1 tumor-bearing mice in each group hardly decreased during the treatment. In addition, hematoxylin and eosin (H&E) staining showed that tumor tissue necrosis was obvious after E-MG1655-LipBCa treatment ( Figure 10 C in ). Figure 10 As shown in D, E-MG1655-LipBCa group CD3 + CD8 + T cells and CD3 + CD4 + The percentages of T cells reached 7.71% and 11.4%, respectively, which were significantly increased compared with the PBS group.

[0095] In summary, the present invention provides a bacterial-nano hybrid system that blocks PD-L1, upregulates MHC-I, and induces tumor cell pyroptosis in a tumor microenvironment-responsive manner. Through the synergistic action of multiple mechanisms, this system effectively reverses the tumor's immunosuppressive microenvironment while avoiding the limitations of traditional immunotherapy. This system offers an innovative, efficient, precise, and safe strategy for tumor immunotherapy. This system holds great promise for clinical application and is expected to improve treatment outcomes and quality of life for cancer patients.

[0096] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A method for preparing a tumor microenvironment-responsive bacteria-nano hybrid system, characterized in that The steps include: (1) Transforming a plasmid DNA containing an acid-responsive promoter and encoding a PD-L1 blocking peptide into Escherichia coli to obtain an engineered bacterium having an acid-responsive promoter and expressing a PD-L1 blocking peptide; (2) culturing the engineered bacteria obtained in step (1) using a compound containing an azide group to obtain an engineered bacteria with azide groups modified on its surface; (3) XIAP / cIAP1 antagonist, DOPE, DSPE-PEG 2000 , CHEMS and DSPE-PEG 2000 -DBCO is mixed evenly in an organic solvent to obtain a mixed solution A; then the organic solvent is removed to obtain the original liposome membrane; (4) mixing the original liposome membrane with an alkaline solution and hydrating with sterile water; performing ultrasonic vortex operation during the hydration process, and extruding the hydrated product to obtain a liposome suspension; (5) removing free substances from the liposome suspension by ultrafiltration to obtain LipB-DBCO; (6) mixing curcumin-loaded calcium carbonate nanoparticles and LipB-DBCO, and extruding to obtain LipBCa-DBCO; (7) The LipBCa-DBCO obtained in step (6) and the recombinant bacteria with surface modification of azide groups obtained in step (2) are mixed, cultured, solid-liquid separated, and the solid obtained is washed to obtain a bacteria-nano hybrid system responsive to the tumor microenvironment.

2. The method for preparing the tumor microenvironment-responsive bacteria-nano hybrid system according to claim 1, characterized in that: The acid-responsive promoter in step (1) is the adiA promoter; The amino acid sequence of the PD-L1 blocking peptide described in step (1) is: DWFKAFYDKINETYNK; The azide group-containing compound in step (2) is 2-azido-2-deoxy-D-glucose.

3. The method for preparing the tumor microenvironment-responsive bacteria-nano hybrid system according to claim 2, characterized in that: The PD-L1 blocking peptide described in step (1) is modified by ClyA protein; The amount of the azide group-containing compound in step (2) is 8 ~10 9 CFU ratio 1mg of azide-containing compound.

4. The method for preparing the tumor microenvironment-responsive bacteria-nano hybrid system according to claim 1, characterized in that: The plasmid described in step (1) contains the nucleic acid sequence shown in SEQ ID NO.1; The framework vector of the plasmid described in step (1) is a pET series vector; The engineered Escherichia coli bacteria described in step (1) is Escherichia coli MG1655.

5. The method for preparing the tumor microenvironment-responsive bacteria-nano hybrid system according to claim 1, characterized in that: The XIAP / cIAP1 antagonist in step (3) is Birinapant; The organic solvent described in step (3) is an organic solvent obtained by mixing chloroform and methanol in a volume ratio of 8-9:1-2; The alkaline solution described in step (4) is a NaOH solution; The curcumin-loaded calcium carbonate nanoparticles described in step (6) are prepared by the following steps: dissolving calcium chloride and curcumin in ethanol, and placing the obtained mixed solution in a CO2-rich environment for reaction; after the reaction is completed, solid-liquid separation is performed, and the obtained solid is washed with ethanol to obtain curcumin-loaded calcium carbonate nanoparticles.

6. The method for preparing the tumor microenvironment-responsive bacteria-nano hybrid system according to claim 5, characterized in that: The alkaline solution described in step (4) has a concentration of 0.1 mol L -1 NaOH solution; The calcium chloride and the curcumin are mixed in a mass ratio of 20 to 40:1; The reaction conditions are 35-45°C for 48-96h; The solid-liquid separation method is centrifugation.

7. The method for preparing the tumor microenvironment-responsive bacteria-nano hybrid system according to claim 1, characterized in that: The amounts of the components used in step (3) are as follows: XIAP / cIAP1 antagonist, DOPE, DSPE-PEG 2000 , CHEMS and DSPE-PEG2000-DBCO in a molar ratio of 1:5-6:0.4-0.6:3-4:0.3-0.5; The amount of the alkaline solution in step (4) is 10-20 μL of alkaline solution per 200 μL of mixed solution A; The amount of sterile water in step (4) is 0.5-1.5 mL of sterile water per 200 μL of mixed solution A; The amount of the curcumin-loaded calcium carbonate nanoparticles in step (6) is calculated based on a mass ratio of the curcumin-loaded calcium carbonate nanoparticles to the XIAP / cIAP1 antagonist of 2:0.7-0.9; The LipBCa-DBCO described in step (7) and the recombinant bacteria modified with azide groups on the surface are mixed at a ratio of 400 to 600 μg to 10 8 CFU ratio.

8. The method for preparing the tumor microenvironment-responsive bacteria-nano hybrid system according to claim 1, characterized in that: The culturing time in step (2) is 10 to 16 hours; The method for removing the organic solvent in step (3) is rotary evaporation; The hydration time in step (4) is 30 to 90 minutes; The number of vortexing described in step (4) is 5 to 6 times; The specific operation of the extrusion described in step (4) is as follows: extrusion is performed through 0.45 μm, 0.22 μm and 0.1 μm polycarbonate films in sequence; The ultrafiltration in step (5) is achieved by using an ultrafiltration centrifuge tube; The extrusion in step (6) is achieved using a micro extruder; The culture conditions described in step (7) are 37±1°C for 4-8 hours; The solid-liquid separation method in step (7) is centrifugation.

9. A tumor microenvironment-responsive bacteria-nano hybrid system, characterized by: The method is obtained by the preparation method according to any one of claims 1 to 8.

10. Use of the tumor microenvironment-responsive bacteria-nano hybrid system according to claim 9 in the preparation of anti-tumor drugs.

Images