A crab shell polypeptide, and a preparation method and application thereof

By preparing crab shell peptides, the problems of high side effects and limited efficacy of existing osteoporosis treatment drugs have been solved, achieving safe and effective improvement of bone density and restoration of calcium and phosphorus homeostasis, and providing a new treatment strategy.

CN120574916BActive Publication Date: 2026-03-27LIAO WEIYUAN ZHU MING (HEZE) PHARMACEUTICAL TECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510654686.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-21
Publication Date
2026-03-27
Estimated Expiration
2045-05-21

AI Technical Summary

Technical Problem

Existing osteoporosis treatments suffer from high side effects, high costs, and limited long-term efficacy, especially for osteoporosis caused by estrogen deficiency.

Method used

A method for preparing crab shell peptides, including hydrolysis, enzymatic hydrolysis, and alcohol precipitation, was adopted. By controlling the conditions of hydrolysis, enzymatic hydrolysis, and alcohol precipitation, peptides rich in medium and low molecular weight peptides, mainly composed of glutamic acid, aspartic acid, and lysine, were prepared to enhance calcium deposition, promote osteoblast activity, and inhibit osteoclast function.

Benefits of technology

It significantly improves bone density, restores trabecular bone structure, maintains bone tissue integrity, re-establishes osteoblast/osteoclast balance, restores calcium and phosphorus homeostasis, and has no obvious systemic toxicity, providing a new treatment strategy for osteoporosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120574916B_ABST
    Figure CN120574916B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of natural active peptides, and particularly relates to a crab shell polypeptide as well as a preparation method and application thereof. The preparation method provided by the present application takes crab shells as raw materials, extracts crab shell polypeptides by using a hydrolysis, enzymolysis and alcohol precipitation method, controls the hydrolysis, enzymolysis and alcohol precipitation conditions in the extraction process, and makes the prepared crab shell polypeptides mainly composed of low-molecular-weight peptides and rich in glutamic acid, aspartic acid and lysine. Experiments prove that the crab shell polypeptide provided by the present application can enhance calcium deposition, improve OB activity, improve bone density, restore trabecular bone structure, maintain the integrity of bone tissue, inhibit OC function, has no obvious systemic toxicity, and can reestablish the osteoblast / osteoclast balance at the molecular level and restore calcium-phosphorus homeostasis, and therefore can be used for preparing medicines for preventing and treating osteoporosis or health-care foods for improving bone density, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of natural active peptides, and particularly relates to a crab shell polypeptide as well as a preparation method and application thereof. BACKGROUND

[0002] Osteoporosis (OP) is a systemic bone disease characterized by decreased bone mass, degraded bone microstructure, and increased risk of brittle fracture. The prevalence of OP in women is significantly higher than that in men, especially in postmenopausal women, due to estrogen deficiency-induced bone resorption.

[0003] The pathophysiology of OP is mainly caused by the imbalance between bone resorption and bone formation, leading to reduced proliferation and differentiation of osteoblasts (OB), excessive activation of osteoclasts (OC), and calcium metabolism disorders. Current drug interventions for OP include anti-resorption agents such as bisphosphonates and denosumab, synthetic metabolic drugs such as parathyroid hormone analogs, and supportive treatments such as active vitamin D and calcium supplements. Although these therapies have clinical benefits, various drugs often have varying degrees of side effects, high costs, and limited long-term efficacy. SUMMARY

[0004] To solve the above technical problems, the present application provides a crab shell polypeptide as well as a preparation method and application thereof. The crab shell polypeptide provided by the present application can enhance calcium deposition, promote OB activity, inhibit OC function, restore calcium-phosphorus homeostasis, and is safe for the body, and can be used to prepare products for preventing and treating OP.

[0005] To achieve the above-mentioned application purposes, the present application adopts the following technical solutions:

[0006] The present application provides a preparation method of a crab shell polypeptide, which specifically comprises the following steps:

[0007] S1, crushing crab shells, dispersing them in water, adjusting the pH to 9.5-11, hydrolyzing at 60-75℃ for 2-4 hours, solid-liquid separation, and obtaining a hydrolysate;

[0008] S2, neutralizing the hydrolysate obtained in S1 to a pH of 6.5-7.0, and using a protease selected from at least one of papain, trypsin, collagenase, proteinase K, and elastase for enzymolysis; after the enzymolysis is completed, the concentrated solution is obtained by concentrating to a state where 3-4 times of anhydrous ethanol can produce a precipitate;

[0009] S3, adding ethanol to the concentrated solution to a concentration of 75%-80% in the system, standing until the precipitation no longer increases, drying the obtained precipitate, and obtaining the crab shell polypeptide.

[0010] The pH value, hydrolysis temperature and hydrolysis time in S1 are important factors to ensure the effect of protein hydrolysis and the composition of amino acids. If the pH value is less than 9.5, the protein dissolution will be insufficient; if the pH value is greater than 11, the protein will be over-hydrolyzed and the amino acids will be damaged; if the hydrolysis temperature is less than 60℃, the reaction will be too slow; if the hydrolysis temperature is too high, the amino acids will be oxidized; if the hydrolysis time is less than 2 hours, the hydrolysis will be incomplete; and if the hydrolysis time is greater than 4 hours, the protein will be over-degraded. Both the over-hydrolysis of protein and the oxidation of amino acids will further affect the effect of the obtained amino acids in treating OP.

[0011] The type of protease in S2 affects the acquisition of target peptide segments. Using other enzymes may not be able to obtain target peptide segments, which in turn affects the anti-OP effect of the obtained crab shell polypeptide.

[0012] The "concentration to produce precipitation after adding 3-4 times of anhydrous ethanol" in S2 represents the degree of concentration. In actual operation, a small amount of sample can be taken during the concentration process, 3-4 times of anhydrous ethanol can be added, and whether there is precipitation can be observed. If there is no precipitation, the concentration will continue; if there is precipitation, the concentration will stop.

[0013] The crab shell polypeptide prepared by the preparation method is mainly composed of low molecular weight (5000-20000 Da) peptides, and is rich in glutamic acid, aspartic acid and lysine. Experiments have proved that the crab shell polypeptide prepared by the preparation method can significantly improve the bone mineral density of OP mouse models induced by ovary, restore the trabecular bone structure, and maintain the integrity of bone tissue, and has no obvious systemic toxicity. At the molecular level, the crab shell polypeptide prepared by the preparation method can activate the cell cycle regulator and motor protein pathway in osteoblasts, while inhibiting the pro-inflammatory signal network, thereby re-establishing the balance between osteoblasts and osteoclasts and restoring the calcium-phosphorus homeostasis. This combined mechanism promotes osteogenesis while inhibiting adipogenesis. Therefore, the crab shell polypeptide has great potential in treating OP and provides a new reference for the implementation of bone-targeted interventions.

[0014] Preferably, the crab shell in S1 is fresh snow crab shell.

[0015] Preferably, the crushing in S1 is crushed to a particle size of 1-5 mm.

[0016] Preferably, the solid-liquid ratio of the crushed crab shell dispersed in water in S1 is 1:5-1:20.

[0017] Preferably, the pH adjustment in S1 is performed using a sodium hydroxide aqueous solution or a potassium hydroxide aqueous solution.

[0018] Preferably, the pH in S1 is 10.

[0019] Preferably, the temperature of the hydrolysis in S1 is 70℃.

[0020] Preferably, the time for the hydrolysis in S1 is 3 hours.

[0021] Preferably, the neutralization in S2 is performed with acetic acid.

[0022] Preferably, the protease in S2 is papain.

[0023] Further preferably, the mass of the papain is 1% to 3% of the mass of the hydrolysis solution.

[0024] Preferably, the temperature for the enzymolysis in S2 is 35 to 45℃, and the time for the enzymolysis is 3 to 6 hours, so as to obtain a higher polypeptide yield. Further preferably, the temperature for the enzymolysis is 37℃, and the time for the hydrolysis is 4 hours.

[0025] Preferably, the temperature for the concentration in S2 is not higher than 50℃.

[0026] Preferably, the temperature for the drying in S3 is not higher than 45℃.

[0027] The second aspect of the present application provides a crab shell polypeptide prepared by the above preparation method.

[0028] The third aspect of the present application provides an application of the above crab shell polypeptide in preparing an oral drug for preventing and treating osteoporosis or a health food for helping to improve bone density, wherein the active ingredient of the oral drug or the health food comprises the crab shell polypeptide.

[0029] The above crab shell polypeptide can enhance calcium deposition, promote OB activity, inhibit OC function, restore calcium-phosphorus homeostasis, and is safe to the body, and thus can be used for preparing an oral drug for preventing and treating osteoporosis or a health food for helping to improve bone density.

[0030] Preferably, the osteoporosis is osteoporosis caused by estrogen deficiency.

[0031] The fourth aspect of the present application provides an application of the above crab shell polypeptide in screening an active ingredient for improving or inhibiting osteoblast activity.

[0032] Preferably, the application is in vitro screening of an active ingredient for improving or inhibiting osteoblast activity.

[0033] The fifth aspect of the present application provides an application of the above crab shell polypeptide in screening an active ingredient for improving or inhibiting osteoclast function.

[0034] Preferably, the application is in vitro screening of an active ingredient for improving or inhibiting osteoclast function.

[0035] Screening of active ingredients for improving osteoblast activity and inhibiting osteoclast function can provide new ingredient options for preparing drugs for preventing and treating osteoporosis or health foods for improving bone density; screening of active ingredients for inhibiting osteoblast activity and improving osteoclast function can be used for researching specific substances in drugs, health foods or food products that can cause osteoporosis, thereby helping to improve the corresponding products and reduce the occurrence of osteoporosis and related events. The crab shell polypeptide can enhance osteoblast activity and inhibit osteoclast-driven bone resorption, and thus can be used as a positive control drug for screening active ingredients for improving osteoblast activity and inhibiting osteoclast function, or for screening active ingredients for inhibiting osteoblast activity and inhibiting osteoclast function by using a test scheme such as combined administration.

[0036] The crab shell polypeptide prepared by the method of the present application can effectively prevent and treat osteoporosis, and has no obvious systemic toxicity. At the molecular level, the crab shell polypeptide can activate cell cycle regulators and motor protein pathways in osteoblasts, while inhibiting pro-inflammatory signaling networks, thereby re-establishing the balance between osteoblasts and osteoclasts and restoring calcium-phosphorus homeostasis. This combined mechanism promotes osteogenesis while inhibiting adipogenesis. Therefore, the crab shell polypeptide is a natural candidate for improving bone health and has great potential in the treatment of OP, has good application prospects, and provides new insights and treatment strategies for OP treatment. In addition, the crab shell polypeptide can also be used to screen active ingredients for improving or inhibiting osteoblast activity and active ingredients for improving or inhibiting osteoclast function, thereby discovering new ingredients for preventing and treating osteoporosis and improving bone density or discovering specific substances in drugs, health foods and food products that can cause osteoporosis. BRIEF DESCRIPTION OF DRAWINGS

[0037] Figure 1 is a schematic diagram of the animal experiment process in Test Example 1 of the present application;

[0038] Figure 2 is a representative Micro-CT image of the proximal tibia microstructure of mice in each group in Test Example 1 of the present application;

[0039] Figure 3is the bone mineral density (BMD), the trabecular bone number (Tb.N), the trabecular bone thickness (Tb.Th) and the trabecular bone separation (Tb.Sp) in the proximal tibia microstructure of each group of mice in the test example 1 of the present application; p <0.05, p <0.01;

[0040] Figure 4 is the representative H&E staining and Masson staining images of the proximal tibia microstructure of each group of mice in the test example 1 of the present application;

[0041] Figure 5 is the representative H&E images of the heart, liver, spleen, lung and kidney tissues of each group of mice in the test example 1 of the present application;

[0042] Figure 6 is the representative immunohistochemical images of the proximal tibia bone microstructure of each group of mice in the test example 1 of the present application, which is stained by BMP-2, RUNX-2 and COL-1;

[0043] Figure 7 is the expression level of RUNX-2 and OSX in the proximal tibia bone microstructure of each group of mice in the test example 1 of the present application; P <0.05, P <0.01;

[0044] Figure 8 is the expression level of NFATc1, RANKL and CTSK in the proximal tibia bone microstructure of each group of mice in the test example 1 of the present application; P <0.05, P <0.01, P <0.001;

[0045] Figure 9 is the representative TRAP image of the proximal tibia microstructure of each group of mice in the test example 1 of the present application;

[0046] Figure 10 is the CCK8 analysis result of MC3T3-E1 cells in the presence of 50-1600 μg / ml SCSP in the test example 2 of the present application; P <0.05, P <0.01;

[0047] Figure 11 ARS staining results and ALP staining results of MC3T3-E1 cells treated with 100 and 200 μg / ml SCSP in Test Example 2 of the present invention;

[0048] Figure 12 The expression levels of RUNX-2, OSX, NFATc1, RANKL, and CTSK in MSCs-differentiated osteoblasts treated with 100 and 200 μg / ml SCSP in Test Example 2 of the present invention; Runx - 2, Bmp - 2, Opg, Rankl qPCR analysis results of expression; P <0.05, P <0.01;

[0049] Figure 13 The effects of 100 and 200 μg / ml SCSP on the expression of RUNX-2, OSX, NFATc1, RANKL, and CTSK proteins in MC3T3-E1 cells in Test Example 2 of the present invention; P <0.05, P <0.01;

[0050] Figure 14 Representative ARS staining results of MSCs-differentiated osteoblasts and representative oil red O staining results of MSCs-differentiated adipocytes treated with 100 and 200 μg / ml SCSP in Test Example 2 of the present invention;

[0051] Figure 15 The expression levels of RUNX-2, OSX, NFATc1, RANKL, and CTSK in MSCs-differentiated osteoblasts treated with 100 and 200 μg / ml SCSP in Test Example 2 of the present invention; P <0.05, P <0.01, P <0.001;

[0052] Figure 16 Heatmap of differential gene expression in RNA-Seq analysis of MC3T3-E1 cells treated with 200 μg / ml SCSP in Test Example 2 of the present invention; data of 3 biological replicates showing fold change greater than 2 andP Values less than 0.05 were considered to be differentially expressed;

[0053] Figure 17 is the KEGG pathway analysis result of the differentially expressed genes of MC3T3-E1 cells before and after 200 μg / ml SCSP treatment in Test Example 2 of the present application. DETAILED DESCRIPTION

[0054] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with specific examples. It should be understood that the specific examples described herein are only used to explain the present application and not to limit the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the protection scope of the present application.

[0055] The prevalence of OP is higher in postmenopausal women. The main cause of OP is that the imbalance between bone resorption and bone formation leads to the decrease of OB proliferation and differentiation, the overactivation of OC and the disorder of calcium metabolism. The drugs for OP often have different degrees of side effects, high cost and limited long-term efficacy.

[0056] Crustacean shells contain abundant polysaccharides, proteins, lipids, minerals such as calcium, phosphorus and magnesium, and compounds such as astaxanthin and β-carotene. These components exhibit unique biological activities, biocompatibility and low toxicity. However, the biological activities and therapeutic potential of shell-derived proteins from crustaceans have not been explored to a great extent.

[0057] The present application provides a preparation method of crab shell polypeptide. The crab shell polypeptide prepared by the preparation method can enhance calcium deposition, promote OB activity, inhibit OC function, restore calcium and phosphorus homeostasis, and is safe to the body, and can be used to prepare products for preventing and treating OP. The preparation method specifically comprises the following steps:

[0058] S1, crushing the crab shell, dispersing it in water, adjusting the pH to 9.5-11, hydrolyzing at 60-75°C for 2-4 hours, solid-liquid separation, and obtaining a hydrolysate;

[0059] S2, neutralizing the hydrolysate obtained in S1 to a pH of 6.5-7.0, and subjecting to enzymatic hydrolysis with a protease selected from at least one of papain, trypsin, collagenase, proteinase K and elastase; after the enzymatic hydrolysis is completed, concentrating to a concentration at which a precipitate is produced after adding 3-4 times of anhydrous ethanol, to obtain a concentrated solution;

[0060] S3, adding ethanol to the concentrated solution to a concentration of 75%-80% of the system, standing until the precipitate no longer increases, drying the obtained precipitate, and obtaining the crab shell polypeptide.

[0061] The application further provides the crab shell polypeptide prepared by the preparation method.

[0062] The application further provides application of the crab shell polypeptide in preparation of an oral drug for preventing and treating osteoporosis or a health food for improving bone density.

[0063] The application scheme is described below through specific examples.

[0064] The papain used in the following examples is purchased from Solabio Company, and the enzyme activity is 800,000 U / g.

[0065] The reagents and antibodies used in the following examples are as follows:

[0066] The RUNX-2 antibody is purchased from Cell Signaling Technology Company, USA. The OSX, NFATc1, RANKL and CTSK antibodies are purchased from Santa Cruz Biotechnology, USA. The hematoxylin-eosin staining kit (H&E) and the BCIP / NBT alkaline phosphatase color developing kit (ALP) are purchased from Biyun Tian Biotechnology Co., Ltd., China. The Masson three-color staining solution and the TRAP staining reagent are both purchased from Savel Biotechnology Co., Ltd., China. The alizarin red S (ARS) solution is purchased from Solabio Technology Co., Ltd., China, and the oil red O staining solution is purchased from Sigma-Aldrich, USA. The calcium (Ca) colorimetric determination kit, the phosphorus (Pi) colorimetric determination kit, the protease inhibitor, the phosphatase inhibitor, the hypersensitive chemiluminescence substrate detection kit are all purchased from Elabscience Company. The FBS and trypsin are purchased from Gibco Company. The BC-T4 culture medium is purchased from Baso Company. The β-glycerophosphate sodium, dexamethasone and L-ascorbic acid are purchased from MCE Company. The CCK-8 solution is purchased from Yeasen Company. The PVDF membrane is purchased from Millipore Company. The FreeZol Reagent, Hiscript III Reverse Transcriptase, Taq ProUniversal SYBR qPCR Master Mix, VAHTS & Universal V8 RNA-Seq Library Prep Kit are all purchased from Vazyme Company.

[0067] Unless otherwise specified, the other reagents, drugs or instruments used in the following examples are all obtained from commercial channels. Unless otherwise specified, the methods used in the following examples are all conventional methods in the art.

[0068] Example 1

[0069] The present embodiment provides a crab shell polypeptide (SCSP) and a preparation method and characterization results thereof.

[0070] 1. The preparation process is as follows:

[0071] S1. Fresh snow crab shells were cut into pieces with an outer diameter of about 1 cm, then crushed into pieces with a particle size of 1-5 mm, washed, and dispersed into distilled water at a solid-liquid ratio of 1:12. Then, the pH was adjusted to 10 with 0.2 mol / L KOH, and hydrolysis was carried out at 70°C for 3 h under constant stirring. The hydrolysate was obtained by filtration.

[0072] S2. The hydrolysate obtained in S1 was neutralized to pH 7.0 with acetic acid, and then subjected to enzymatic hydrolysis with papain (2% of the mass of the hydrolysate) at 37°C for 4 h. Then, the concentrated liquid was obtained by vacuum concentration at 35-45°C, with real-time monitoring of the concentration level (3 mL of sample was taken each time, 4 times of anhydrous ethanol was added, and whether precipitation occurred was observed. When the sample precipitated after the addition of anhydrous ethanol, the concentration was stopped). After the concentration was completed, the concentrated liquid was obtained.

[0073] S3. Ethanol was added to the concentrated liquid to a concentration of 80% v / v, and the precipitate was allowed to settle until no further precipitation occurred. The precipitate was vacuum dried at 30-40°C to a loose powder, and SCSP was obtained. The yield of SCSP reached 12.2% of the input snow crab shells.

[0074] 2. Molecular weight detection

[0075] The molecular weight of SCSP was determined according to the viscosity and retention time at 45°C using a PL hydrogel-OH Mixed-H column (8 μm, 7.5 × 300 mm, Agilent), combined with a differential refractometer detector (Agilent) and a multi-angle laser light scattering detector (Agilent).

[0076] The molecular weight distribution analysis results are shown in Table 1. The proportion of the 5000-10000 Da component was the highest (47.58%), followed by the 10000-20000 Da component (27.56%), indicating that SCSP was mainly composed of low molecular weight peptides, which would be an ideal choice for the treatment of osteoporosis.

[0077] Table 1. Molecular weight distribution of SCSP

[0078]

[0079] 3. Amino acid composition analysis

[0080] The sample was hydrolyzed in 6 M hydrochloric acid at 110°C for 22 hours, and then subjected to chromatographic analysis using a sulfonic acid type cation exchange resin column (Agilent) to analyze the amino acid composition. The detection wavelength was 570 nm and 440 nm.

[0081] The results of the amino acid composition analysis are shown in Table 2. The content of glutamic acid (Glu) was the highest (5.91 g / 100 g), followed by aspartic acid (Asp, 4.59 g / 100 g) and lysine (Lys, 3.36 g / 100 g). Essential amino acids (EAA) accounted for 39.21% of the total amino acids, and non-essential amino acids (NEAA) accounted for 60.78% of the total amino acids. The presence of EAA and NEAA, especially the enrichment of Glu, Asp, and Lys, indicates that SCSP may have important biological activities, such as promoting bone health.

[0082] Table 2 Amino acid composition of SCSP

[0083]

[0084] Example 2

[0085] The present embodiment provides a crab shell polypeptide and a preparation method thereof.

[0086] S1, fresh snow crab shells were cut into fragments with an outer diameter of about 1 cm, and then pulverized into fragments with a particle size of 1-5 mm. The fragments were washed and dispersed in distilled water at a solid-liquid ratio of 1:5, and then the pH was adjusted to 10 using 0.2 mol / L KOH. The mixture was hydrolyzed at 65°C under constant temperature stirring for 3.5 hours, and then filtered to obtain a hydrolysate;

[0087] S2, the hydrolysate obtained in S1 was neutralized to pH 7.0 with acetic acid, and then subjected to enzymatic hydrolysis using trypsin (with a mass of 2% of the mass of the hydrolysate) at 35°C for 6 hours. Then, the hydrolysate was vacuum concentrated at 35-45°C, and the concentration level was monitored in real time during the concentration process (3 mL of sample was taken each time, 4 times the amount of anhydrous ethanol was added, and whether a precipitate was produced was observed. When a precipitate was produced after the addition of anhydrous ethanol, the concentration was stopped). After the completion of the concentration, a concentrated solution was obtained.

[0088] S3, ethanol was added to the concentrated solution to a concentration of 80% v / v, and the mixture was allowed to stand and precipitate until the precipitation no longer increased. The obtained precipitate was vacuum dried at 30-40°C to a loose powder, thereby obtaining a crab shell polypeptide.

[0089] Example 3

[0090] The present embodiment provides a crab shell polypeptide and a preparation method thereof.

[0091] S1, cut fresh snow crab shells into pieces with an outer diameter of about 1 cm, then crush them into pieces with a particle size of 1-5 mm, wash them, disperse them in distilled water, the solid-liquid ratio is 1:15, then adjust the pH to 9.5 with 0.2 mol / L NaOH, hydrolyze at 70°C for 2 hours under constant stirring, filter, and obtain a hydrolysate;

[0092] S2, neutralize the hydrolysate obtained in S1 to pH 6.8 with acetic acid, use collagenase (its mass is 2.5% of the mass of the hydrolysate) to enzymatically hydrolyze at 37°C for 5 hours, then concentrate under vacuum at 30-40°C, and monitor the concentration level in real time during the concentration process (take 3 mL of sample each time, add 4 times of anhydrous ethanol, and observe whether a precipitate is produced; when a precipitate is produced after the sample is added with anhydrous ethanol, stop the concentration), and after the concentration is completed, a concentrated solution is obtained;

[0093] S3, add ethanol to the concentrated solution obtained to a concentration of 80% v / v, and let it stand to precipitate until the precipitation no longer increases. Dry the obtained precipitate under vacuum at 30-40°C to a loose powder to obtain a crab shell polypeptide.

[0094] Example 4

[0095] The present embodiment provides a crab shell polypeptide and a preparation method thereof.

[0096] S1, cut fresh snow crab shells into pieces with an outer diameter of about 1 cm, then crush them into pieces with a particle size of 1-5 mm, wash them, disperse them in distilled water, the solid-liquid ratio is 1:20, then adjust the pH to 11 with 0.2 mol / L KOH, hydrolyze at 60°C for 4 hours under constant stirring, filter, and obtain a hydrolysate;

[0097] S2, neutralize the hydrolysate obtained in S1 to pH 6.5 with acetic acid, use protease K (its mass is 1% of the mass of the hydrolysate) to enzymatically hydrolyze at 40°C for 3.5 hours, then concentrate under vacuum at 35-45°C, and monitor the concentration level in real time during the concentration process (take 3 mL of sample each time, add 3 times of anhydrous ethanol, and observe whether a precipitate is produced; when a precipitate is produced after the sample is added with anhydrous ethanol, stop the concentration), and after the concentration is completed, a concentrated solution is obtained;

[0098] S3, add ethanol to the concentrated solution obtained to a concentration of 75% v / v, and let it stand to precipitate until the precipitation no longer increases. Dry the obtained precipitate under vacuum at 35-45°C to a loose powder to obtain a crab shell polypeptide.

[0099] Example 5

[0100] The present embodiment provides a crab shell polypeptide and a preparation method thereof.

[0101] S1. Cut fresh snow crab shells into pieces with an outer diameter of about 1 cm, then crush them into pieces with a particle size of 1~5 mm, wash them, disperse them in distilled water at a material-to-liquid ratio of 1:10, then adjust the pH to 10.5 with 0.2 mol / L NaOH, hydrolyze at a constant temperature of 75℃ for 2.5 h with stirring, filter, and obtain the hydrolysate.

[0102] S2. Neutralize the hydrolysate obtained in S1 with acetic acid to pH 6.7, and enzymatically hydrolyze it with elastase (3% of the mass of the hydrolysate) at 45℃ for 3 hours. Then, concentrate it under vacuum at 40~50℃, and monitor the concentration level in real time during the concentration process (take 3mL of sample each time, add 3 times the amount of anhydrous ethanol, and observe whether precipitation occurs. When precipitation occurs after adding anhydrous ethanol, stop the concentration). After the concentration is completed, the concentrated solution is obtained.

[0103] S3. Add ethanol to the obtained concentrate until the ethanol concentration is 75% v / v, and let it stand to precipitate until the precipitation no longer increases. Vacuum dry the obtained precipitate at 35~45℃ until it becomes a loose powder to obtain crab shell polypeptide.

[0104] Test Example 1

[0105] The anti-osteoporosis activity of the crab shell polypeptide (SCSP) prepared in Example 1 of this invention was investigated in a mouse model of osteoporosis induced by bilateral ovariectomy.

[0106] 1. Laboratory animals

[0107] Five-week-old female C57BL / 6 mice (20 ± 5 g) were purchased from Home-SPF Biotechnology Co., Ltd. (Beijing, China) and housed at the SPF-grade Laboratory Animal Center of Qingdao University under the following conditions: 25 ± 3℃, humidity 60% - 70%, and a 12-hour light-dark cycle. All animal experiments were conducted in accordance with the ethical standards approved by the Shandong Provincial Laboratory Animal Management Committee and the Laboratory Animal Center of Qingdao University (QDU-AEC-2024418).

[0108] 2. Experimental Methods

[0109] 2.1 Establishment of an Ovariectomized (OVX) Mouse Model

[0110] Twenty-four female C57BL / 6 mice were randomly divided into four groups: sham-operated group (Sham group), osteoporosis model group (OVX group), low-dose treatment group (OVX + 50 mg / kg SCSP treatment group), and high-dose treatment group (OVX + 100 mg / kg SCSP treatment group). The two SCSP treatment groups received SCSP orally daily, while the Sham and OVX groups received an equal volume of physiological saline orally daily. After seven days of administration, the mice were anesthetized, the surgical area was shaved, and disinfected with povidone-iodine. The skin, mucous membranes, and muscle layers were incised sequentially, and a dorsal incision was made approximately 2 cm lateral to the spine at the level of the last rib. The incisions in the sham-operated group were sutured directly. In the other groups, both ovaries were ligated at the fallopian tubes and removed, followed by suturing. Postoperatively, the mice in each group received the same medication regimen for 56 consecutive days, and urine was collected from all mice on day 49. 24 hours after the last gavage, blood was drawn from the orbital puncture site, and then bone tissue was taken.

[0111] Bone tissue harvesting procedure: Mice were anesthetized with sodium pentobarbital and euthanized by cervical dislocation. The mice were fixed in a supine position, and the skin of the hind limbs was disinfected with alcohol. The skin was cut open to expose the muscles, and the muscles were separated to expose the femur and tibia. The femur and tibia were carefully freed, and the muscles and fascia tissue were removed. The mice were rinsed with physiological saline and then placed in 4% paraformaldehyde.

[0112] The flowchart of the experiment is as follows: Figure 1 As shown.

[0113] 2.2 Micro-CT Scan

[0114] Bone tissue was fixed in 4% paraformaldehyde (PFA) and scanned using a Micro-CT system (90 kV, 200 μA, PerkinElmer, Japan). One hundred slices from the proximal tibial plateau were selected, and Analyzer 12.0 software (PerkinElmer) was used to statistically analyze bone mineral density (BMD), trabecular bone number (Tb. N), trabecular bone thickness (Tb. Th), and trabecular bone separation (Tb. Sp). Each parameter was measured three times.

[0115] 2.3 Tissue staining

[0116] Decalcification, paraffin embedding, sectioning, and histological analysis were performed. All histological staining was imaged under an optical microscope (Nikon, USA).

[0117] 2.3.1 Hematoxylin and eosin (H&E) staining

[0118] Dewax the sections, stain with hematoxylin for 2 minutes, stain with eosin for 10 seconds, rinse with water, and image.

[0119] 2.3.2 Masson trichrome staining

[0120] The sections were stained with Weigert iron hematoxylin for 10 minutes, then stained sequentially with acidic ethanol, Masson blue solution and aniline blue, and then imaged.

[0121] 2.3.3 TRAP staining

[0122] The sections were incubated with TRAP working solution at 37°C in the dark for 30 minutes, counterstained with hematoxylin, and then imaged.

[0123] 2.4 Immunohistochemistry (IHC)

[0124] Decalcified bone sections were dewaxed, rehydrated, quenched, antigen-retrieved, blocked with 5% BSA, incubated with primary antibody overnight at 4°C, washed, incubated with secondary antibody, counterstained with hematoxylin, and imaged under an optical microscope (Nikon, USA). The following antibodies were used in the IHC experiment (dilution ratios are in parentheses): anti-BMP-2 (1:100), anti-RUNX-2 (1:100), and anti-COL-1 (1:100).

[0125] 2.5 Western blot analysis

[0126] Bone tissue was lysed with RIPA buffer containing protease and phosphatase inhibitors, homogenized, and incubated on ice for 10 minutes. The protein concentration of the supernatant obtained from the lysed bone tissue was determined using the BCA method: the supernatant was separated by SDS-PAGE gel and transferred to a PVDF membrane. The membrane was blocked with 5% skim milk powder, incubated with primary antibody overnight at 4°C, washed, incubated with secondary antibody at room temperature for 1 hour, washed, and developed using a high-sensitivity chemiluminescent substrate detection kit. The following antibodies were used in Western blot experiments (dilution ratios are in parentheses): GAPDH (1:1000), RUNX-2 (1:1000), OSX (1:1000), NFATC1 (1:1000), RANKL (1:1000), and CTSK (1:1000). All experiments were repeated three times.

[0127] 2.6 Serum Biochemical Analysis

[0128] The collected urine was centrifuged at 13,000 rpm for 5 min, and the supernatant was collected. Blood samples obtained by orbital puncture were centrifuged at 3,000 rpm for 10 min. Calcium (Ca) in serum and urine was determined according to the manufacturer's instructions using a calcium colorimetric assay kit and a phosphorus colorimetric assay kit. 2+ The concentrations of Ca and inorganic phosphorus (Pi) were determined using a microplate reader (Molecular Devices, USA) at 610 nm. 2+The absorbance values ​​were recorded at 660 nm (Pi) and 660 nm (Pi).

[0129] 2.7 Statistical Analysis

[0130] Data are expressed as mean ± SEM. Statistical comparisons were performed using Graph Pad Prism 9.5, employing one-way ANOVA, two-way ANOVA, or Student's test. A p-value < 0.05 was considered statistically significant.

[0131] 3. Experimental Results

[0132] 3.1 Micro-CT Scan Results

[0133] like Figure 2 As shown, compared with the Sham group, mice in the OVX group exhibited significant trabecular bone degeneration and decreased bone mineral density (BMD), confirming osteoporotic bone loss. Treatment with 50 mg / kg and 100 mg / kg SCSP significantly improved BMD and trabecular bone structure, with the High-SCSP group showing similar bone parameters to the Sham group. Quantitative analysis results (e.g.) Figure 3 The findings (shown) confirm these results, demonstrating that BMD, trabecular bone number (Tb. N), trabecular bone thickness (Tb. Th), and trabecular bone separation (Tb. Sp) were significantly lower in the OVX group compared to the Sham group, while these parameters were significantly higher in the SCSP group, demonstrating the protective effect of SCSP on bone quality and morphology.

[0134] 3.2 Tissue staining results

[0135] like Figure 4 As shown, bone integrity and collagen fiber distribution were severely impaired in the OVX group mice, while SCSP treatment at 50 mg / kg and 100 mg / kg preserved these characteristics, particularly in the High-SCSP group. These results validate the improvement in bone integrity and collagen fiber distribution. Importantly, H&E staining demonstrated that SCSP treatment did not induce histological abnormalities in major organs, including the heart, liver, spleen, lungs, and kidneys, in any of the experimental groups. Figure 5 As shown.

[0136] Micro-CT scans and tissue staining results indicate that SCSP alleviates OVX-induced bone loss by improving BMD, restoring trabecular bone structure, and maintaining bone tissue integrity, without causing systemic toxicity.

[0137] 3.3 IHC staining results

[0138] Osteoblast-mediated bone formation (OP) is characterized by an imbalance between osteoblast-mediated bone formation and osteoclast-driven bone resorption. IHC staining showed significantly reduced expression of osteoblast markers (BMP-2, RUNX-2, COL-1) in OVX mice, reflecting impaired osteoblast function; SCSP treatment restored these markers in a dose-dependent manner, with the High-SCSP group reaching levels comparable to the Sham group. Figure 6 As shown.

[0139] 3.4 Results of Western blot analysis

[0140] Western blot analysis further confirmed increased expression of RUNX-2 and OSX in the SCSP treatment group, such as Figure 7 As shown.

[0141] In OVX-treated mice, the expression of osteoclast-associated proteins (NFATc1, RANKL, and CTSK) was elevated, while SCSP treatment significantly reduced the expression of NFATC1, RANKL, and CTSK. Figure 8 As shown.

[0142] 3.5 TRAP staining results

[0143] TRAP staining showed a significant increase in osteoclast count in the OVX group mice, indicating enhanced bone resorption. Figure 9 As shown, SCSP treatment significantly reduced the number of osteoclasts, especially at a dose of 100 mg / kg, where the number of osteoclasts was comparable to that in the Sham group.

[0144] 3.6 Serum biochemical analysis results

[0145] Calcium homeostasis is frequently disrupted in ovariectomy. As shown in Table 3, mice in the OVX group exhibited decreased urinary calcium excretion and elevated serum phosphorus levels. SCSP treatment resulted in higher urinary calcium and phosphorus levels than the Sham and OVX groups, suggesting that SCSP regulates calcium and phosphorus metabolism and may counteract the metabolic disturbances induced by ovariectomy.

[0146] Table 3. Serum calcium, urinary calcium, serum phosphorus, and urinary phosphorus levels in mice ( ± S ).

[0147]

[0148] The above results indicate that SCSP restores the osteoblast / osteoclast balance by enhancing osteoblast activity, inhibiting osteoclast-driven bone resorption, and normalizing calcium and phosphorus metabolism.

[0149] Test Example 2

[0150] The effects of the crab shell polypeptide (SCSP) prepared in Example 1 of this invention on mineralized nodule formation, calcium deposition, osteogenic gene and protein expression levels, adipogenic differentiation, signaling pathways, inflammatory response, and motor proteins were investigated using bone marrow mesenchymal stem cells (MSCs) and pre-osteoblasts (MC3T3-E1).

[0151] 1. Experimental Methods

[0152] 1.1 Cell Culture and Differentiation

[0153] MSCs were cultured in BC-T4 medium containing 10% FBS. Mouse MC3T3-E1 cells were cultured in α-MEM medium containing 10% FBS. Cells were passaged every 3–4 days, digested with 0.25% trypsin for 5–10 minutes, and then re-coated at a 1:4 ratio. The cells were divided into four groups: untreated (Normal), differentiation (Control), low-dose peptide group (100 μg / ml SCSP), and high-dose peptide group (200 μg / ml SCSP). MSCs from each group were subjected to osteogenic and adipogenic differentiation, and MC3T3-E1 cells from each group were subjected to osteogenic differentiation. Osteogenic differentiation was induced for 21 days in DMEM medium containing 10 mM β-glycerophosphate, 100 nM dexamethasone, and 50 µM L-ascorbic acid. Adipogenic differentiation was induced for 12 days in DMEM medium containing 100 μg / ml 3-isobutyl-1-methylxanthine, 1 μM dexamethasone, and 50 μg / ml L-ascorbic acid. All cultures were maintained at 37°C and 5% CO2.

[0154] 1.2 Cell proliferation experiment

[0155] Mouse MC3T3-E1 pre-osteoblasts were cultured at 5 × 10⁻⁶ cells per well. 3 Cells were seeded in 96-well plates and cultured in complete culture medium for 24 hours. After incubating with 50–1600 µg / ml SCSP for 48 hours, 10 μL of CCK-8 solution was added to each well, and the plates were incubated at 37°C in the dark for 2 hours. The absorbance was measured at 450 nm using a full-wavelength microplate reader (Molecular Devices, USA). All experiments were repeated three times.

[0156] 1.3 Cell staining analysis

[0157] MSCs cells from each group that underwent osteogenic and adipogenic differentiation, as well as MC3T3-E1 cells from each group that underwent osteogenic differentiation, were fixed with 4% PFA for 20 minutes and washed. They were then stained with 1% ARS solution, BCIP / NBT staining solution, or Oil Red O solution, incubated at room temperature in the dark for 30 minutes, washed, and imaged using an optical microscope (Nikon, USA).

[0158] 1.5 RNA extraction and qPCR analysis

[0159] Total RNA was isolated from osteogenic and adipogenic MSCs and osteogenic MC3T3-E1 cells from group 1.1 using FreeZol Reagent. The precipitate was washed with 70% ethanol and dissolved in H2O. 1 μg of total RNA was used for reverse transcription using random primers and Hiscript III Reverse Transcriptase. 20 ng of cDNA was used in each RT-qPCR reaction on a CFX96 instrument using Taq Pro Universal SYBR qPCR Master Mix. All expression values ​​were compared with GAPDH as an internal control. The gene-specific primers used in all PCR-based analyses (forward and reverse primers are in parentheses) are: Mouse Runx-2 (ATGCTTCATTCGCCTCACAAA; GCACTCACTGACTCGGTTGG); Mouse Bmp2 (GGGACCCGCTGTCTTCTAGT; TCAACTCAAATTCGCTGAGGAC); Mouse Opg (ACCCAGAAACTGGTCATCAGC; CTGCAATACACACACTCATCACT); Mouse Rankl (CAGCATCGCTCTGTTCCTGTA; CTGGCGTTTTCATGGAGTCTCA); Mouse Gapdh (TCCCACTCTTCCACCTTCGATGC; GGGTCTGGGATGGAAATTGTGAGG).

[0160] All experiments were repeated 3 times.

[0161] 1.6 RNA Sequencing Analysis

[0162] RNA was extracted in Section 1.5 and an RNA library was prepared using the VAHTS & Universal V8 RNA-Seq Library Prep Kit. Sequencing was performed on the MGI-SEQ 2000 platform. Reads were aligned to the mouse genome (GRCm38) using HISAT2, and differential expression analysis was performed using DESeq2. GO and KEGG pathway enrichment analysis was performed using WebGestalt.

[0163] 1.7 Western blot analysis

[0164] MSCs cells from osteogenic and adipogenic differentiation groups and MC3T3-E1 cells from osteogenic differentiation groups in step 1.1 were lysed with RIPA buffer containing protease inhibitors and phosphatase inhibitors, homogenized, and incubated on ice for 10 minutes. The protein concentration of the supernatant obtained from cell lysis was determined using the BCA method: the supernatant was separated by SDS-PAGE gel and transferred to a PVDF membrane. The membrane was blocked with 5% skim milk powder, incubated with primary antibody at 4°C overnight, washed, incubated with secondary antibody at room temperature for 1 hour, washed, and developed using a high-sensitivity chemiluminescent substrate detection kit. The following antibodies were used in Western blot experiments (dilution ratios are in parentheses): GAPDH (1:1000), RUNX-2 (1:1000), OSX (1:1000), NFATC1 (1:1000), RANKL (1:1000), and CTSK (1:1000). All experiments were repeated three times.

[0165] 1.8 Statistical Analysis

[0166] Data are expressed as mean ± SEM. Statistical comparisons were performed using Graph Pad Prism 9.5, employing one-way ANOVA, two-way ANOVA, or Student's test. A p-value < 0.05 was considered statistically significant.

[0167] 2. Experimental Results

[0168] 2.1 Effects of SCSP on osteogenic activity of MC3T3-E1 cells

[0169] 2.1.1 Results of cell proliferation experiment

[0170] CCK-8 assays showed a dose-dependent increase in osteoblast viability after SCSP treatment, such as... Figure 10 As shown.

[0171] 2.1.2 Cell staining analysis results

[0172] like Figure 11As shown: ARS staining results showed enhanced mineralized nodule formation and calcium deposition in the SCSP group, especially in the high-dose group; ALP staining results confirmed enhanced early osteogenic differentiation.

[0173] 2.1.3 qPCR analysis results

[0174] like Figure 12 As shown, osteogenic genes (including RUNX - 2 , BMP - 2 and OPG The expression of ) is adjusted upwards. RANKL The expression was downgraded.

[0175] 2.1.4 Results of Western blot analysis

[0176] like Figure 13 As shown, the protein levels of RUNX-2 and OSX increased, while the expression of NFATc1, RANKL, and CTSK decreased, indicating the role of SCSP in maintaining osteoblast / osteoclast balance.

[0177] 2.2 Effects of SCSP on osteogenic differentiation of MSCs

[0178] 2.2.1 Results of cell staining analysis

[0179] like Figure 14 As shown, ARS staining revealed increased formation of mineralized nodules in the SCSP-treated group, indicating enhanced osteogenic activity; SCSP treatment reduced lipid accumulation, indicating an inhibitory effect on adipogenic differentiation.

[0180] 2.2.2 Results of Western blot analysis

[0181] like Figure 15 As shown, in the SCSP treatment group, RUNX-2 and OSX expression increased, while NFATc1, RANKL and CTSK levels decreased.

[0182] The above experimental results demonstrate that SCSP has the ability to induce MSCs to differentiate into osteogenic cells, promote bone formation, and inhibit adipogenesis and osteoclast formation.

[0183] 2.2.3 RNA sequencing analysis results

[0184] like Figure 16 As shown, compared with the control group, 2410 genes were upregulated and 1837 genes were downregulated in SCSP-treated cells; Figure 17 As shown, KEGG pathway enrichment analysis identified significant involvement in cell cycle, inflammation, and motor protein pathways. Key genes involved in the cell cycle pathway include... Ccnb1, Ttk, Ndc80, Ccnb2, Cdc20, Espl1, Plk1 and Cdc25 .in,Plk1 , Ccnb2 and Ccnb1 Closely associated with the Fox O signaling pathway, a key regulator of osteoblast survival, oxidative stress, and bone remodeling, SCSP treatment also modulates the inflammatory response, altering the expression of IL-17 signaling, Toll-like receptor signaling, and rheumatoid arthritis-related genes, including... Ccl2, Il17re, Fosl1, Mmp13, Ccl5, Tlr1, Il12b and Atp6v1b1 Notably, SCSP significantly upregulated genes associated with motor protein activity, including Myo5c, Kif20a, Kif18b, Kif4, Kif23, Kif2c, Cenpe, Kif20b, Kif14 and Myh7b These results indicate that SCSP enhances osteoblast activity through cell cycle regulation and immune modulation, while simultaneously regulating cytoskeleton function through motor proteins.

[0185] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for preparing crab shell polypeptide, characterized in that, Specifically, the following steps are included: S1. Crush the crab shells, disperse them in water, adjust the pH to 9.5~11, and hydrolyze them at 60~75℃ for 2~4 hours. Separate the solid and liquid to obtain the hydrolysate. S2. Neutralize the hydrolysate obtained in S1 to a pH of 6.5-7.0, and then enzymatically hydrolyze it with papain. The hydrolysis temperature is 35-45°C, and the hydrolysis time is 3-6 hours. After the hydrolysis is completed, concentrate the solution until a precipitate is formed after adding 3-4 times the amount of anhydrous ethanol, thus obtaining the concentrated solution. S3. Add ethanol to the concentrated solution until the ethanol concentration of the system is 75%~80%, let it stand until the precipitation no longer increases, and dry the precipitate to obtain the crab shell polypeptide.

2. The method for preparing crab shell polypeptide according to claim 1, characterized in that, The crab shell mentioned in S1 is a fresh snow crab shell; and / or The pulverization described in S1 refers to pulverizing to a particle size of 1-5 mm; and / or In S1, the material-to-liquid ratio when the crab shells are crushed and dispersed in water is 1:5 to 1:20; and / or In S1, the pH is adjusted using an aqueous solution of sodium hydroxide or potassium hydroxide; and / or The pH mentioned in S1 is 10; and / or The hydrolysis temperature described in S1 is 70°C; and / or The hydrolysis time described in S1 is 3 hours; and / or In S2, the neutralization is carried out using acetic acid; and / or The concentration temperature described in S2 does not exceed 50°C; and / or The drying temperature described in S3 shall not exceed 45°C.

3. Crab shell polypeptide prepared according to the preparation method of crab shell polypeptide according to claim 1 or 2.

4. The use of the crab shell polypeptide according to claim 3 in the preparation of oral medications for preventing and treating osteoporosis or health foods that help improve bone density, characterized in that, The active ingredient of the oral medication or health food includes the crab shell polypeptide.

5. The application according to claim 4, characterized in that, The osteoporosis mentioned is osteoporosis caused by estrogen deficiency.

6. The use of the crab shell polypeptide of claim 3 in screening active ingredients for improving osteoblast activity.

7. The application according to claim 6, characterized in that, The application is to screen active ingredients in vitro to enhance osteoblast activity.

8. The use of the crab shell polypeptide of claim 3 in screening active ingredients for inhibiting osteoclast function.

9. The application according to claim 8, characterized in that, The application is to screen for active ingredients that inhibit osteoclast function in vitro.

Citation Information

Patent Citations

  • Preparation method and application of scallop skirt whitening peptide

    CN107523601A