Porcine reproductive and respiratory syndrome nucleic acid vaccine adjuvant activating toll-like receptor 3 and preparation method and application thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a porcine reproductive and respiratory syndrome nucleic acid vaccine adjuvant for activating Toll-like receptor 3, and a preparation method and application thereof. The porcine reproductive and respiratory syndrome nucleic acid vaccine adjuvant contains a recombinant sequence of a chimeric conservative sequence of 3'UTR in a PRRSV genome, which is taken as a scaffold of human serine tRNA. The chimeric conservative sequence of 3'UTR in the PRRSV genome is a sequence with a similarity of more than 90% to SEQ ID NO. 1, and the recombinant sequence is a sequence with a similarity of more than 70% to SEQ ID NO. 2. The nucleic acid vaccine adjuvant produced by the application has low toxicity and low immunogenicity, can activate TLR3, and can induce high-level antibody and cellular immune responses.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a porcine reproductive and respiratory syndrome nucleic acid vaccine adjuvant that activates Toll-like receptor 3, its preparation method, and its application. Background Technology

[0002] Porcine reproductive and respiratory syndrome (PRRS), commonly known as blue ear disease, first broke out in California, USA in 1987. It is characterized by a significant increase in stillbirths and weak piglets, a sharp rise in mortality rates in newborn and suckling piglets, severe pneumonia in piglets, and a drastic decrease in growth rate. The corresponding pathogen was named porcine reproductive and respiratory syndrome virus (PRRSV). PRRSV is an enveloped positive-sense RNA virus that releases its genome into the cytoplasm after acidification and membrane fusion within the cytoplasm via standard clathrin-mediated endocytosis. The two most important glycoproteins involved are the minor structural proteins GP2a and GP4, while CD163 is the main receptor mediating viral internalization and disassembly. GP2a and GP4 mediate viral entry into susceptible host cells through interaction with CD163.

[0003] Vaccines are one of the most important measures for preventing porcine reproductive and respiratory syndrome (PRRS). However, despite the first vaccine, Ingelvac PRRS MLV, being marketed and widely used for over two decades, the morbidity rate in pig herds remains high, indicating limited control effectiveness of vaccination. Current strategies for controlling PPRSV infection are largely inadequate, and licensed vaccines also have many safety and efficacy issues. Vaccine adjuvants are substances that non-specifically enhance or alter the body's specific immune response to matched antigens, enhance the immunogenicity of antigens, or change the type of immune response, but are not antigenic themselves. Adjuvants can activate the body's innate immune system, helping antigens to be better taken up and presented by antigen-presenting cells. For vaccines, adjuvants have become crucial to success. After nearly a century of research, vaccine adjuvants have evolved from the initial aluminum salt adjuvants to various novel adjuvants, such as oil-water emulsions, liposomes, proteins, and nucleic acids. Various types of vaccine adjuvants are widely used clinically. Currently, the adjuvant used in PRRS vaccines is still an aluminum preparation, which produces a weaker immune response compared to other adjuvants, cannot participate in cellular immune responses, and causes severe local reactions. Applying TLR nucleic acid agonists as novel immune adjuvants to vaccines that are not effective against PRRS can overcome many shortcomings of traditional vaccine adjuvants, such as safety and lack of mechanism of action. It can activate pattern recognition receptors to continuously produce high levels of antibodies, becoming a new direction for research on vaccine adjuvants for porcine reproductive and respiratory syndrome. Currently, there are no TLR receptor nucleic acid agonists used as vaccine adjuvants for porcine reproductive and respiratory syndrome. Summary of the Invention

[0004] The primary objective of this invention is to provide a nucleic acid vaccine adjuvant for porcine reproductive and respiratory syndrome that activates Toll-like receptor 3.

[0005] The second objective of this invention is to provide a method for preparing a nucleic acid vaccine adjuvant for porcine reproductive and respiratory syndrome.

[0006] A third objective of this invention is to provide the application of a porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant in the preparation of a PRRS vaccine.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] A porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant that activates Toll-like receptor 3, the adjuvant containing a recombinant sequence that uses human serine tRNA as a scaffold and chisels a conserved sequence of the 3'UTR in the PRRSV genome.

[0009] Furthermore, the conserved sequence of the 3'UTR is a sequence with a similarity of more than 90% to SEQ ID NO.1, and the sequence of SEQ ID NO.1 is as follows:

[0010] nnn cugauugaca cugugccucu aagucaccua uucaauuagg gcgaccgugu ggggguaaaguuuaauugg nnn.

[0011] Furthermore, the recombinant sequence is a sequence with a similarity of more than 70% to SEQ ID NO.2, and the SEQ ID NO.2 sequence is as follows:

[0012] gcagcgaugg ccgagugguu aaggcguugg acucugauug acacuugcc ucuaagucaccuauucaauu agggcgaccg ugugggggua aaguuuaauu ggaauccaau ggggucuccc cgcgcagguucgaacccugc ucgcugcgcc a.

[0013] The preparation method of the porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant described above, and the specific preparation steps of the porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant are as follows:

[0014] S1: Obtain the PRRSV genome sequence from the NCBI database and perform alignment analysis on its 3'UTR sequence to obtain the conserved 3'UTR sequence mentioned above;

[0015] S2: The conserved 3'UTR sequence is inserted into the anticodon loop of human serine tRNA to synthesize the recombinant sequence described above. The recombinant sequence is then inserted into the plasmid to construct the expression vector.

[0016] S3: Transform the expression vector into competent Escherichia coli cells to obtain recombinant strains, and culture them in a culture medium to obtain bacterial suspension;

[0017] S4: Extract total RNA from the bacterial culture obtained in step S3, and purify it by FPLC to obtain recombinant PRRSV-3'UTR.

[0018] Furthermore, in step S2, the plasmid is the pBSMrna plasmid.

[0019] Furthermore, in step S3, the competent E. coli cells are HST08 or DH5α competent cells, and the culture medium is LB medium or TB medium.

[0020] Furthermore, the method also includes the following step: encapsulating the recombinant PRRSV-3'UTR using nanoliposomes as a carrier.

[0021] The above-described application of porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant in the preparation of PRRS vaccines.

[0022] The beneficial technical effects of this invention are as follows:

[0023] This invention uses human serine tRNA as a scaffold, directly embedding a conserved sequence from the 3'UTR of the PRRSV genome at its anticodon loop, and expressing the recombinant sequence in *E. coli*. The recombinant RNA can then be efficiently delivered via lipid nanoparticle encapsulation. The nucleic acid vaccine adjuvant of this invention exhibits excellent biological activity, significantly enhancing vaccine efficacy, increasing antibody levels, and strengthening cellular immunity. Furthermore, the recombinant small RNA produced using human serine tRNA as a scaffold shows even greater development potential. Using tRNA as a scaffold improves the stability and safety of small RNAs. The production process of recombinant small RNA via *E. coli* fermentation is simple, yields high output, is easier to scale up, and is less costly. In addition, the lipid nanoparticle encapsulation of the nucleic acid vaccine adjuvant ensures efficient delivery, reduces adjuvant loss, and minimizes damage to the organism. Attached Figure Description

[0024] Figure 1To detect the expression of recombinant PRRSV-3'UTR in Escherichia coli by denaturing polyacrylamide urea gel electrophoresis;

[0025] Figure 2 The purpose is to purify recombinant tRNA using PFLC. ser The liquid chromatogram and the purity identification diagram of -3'PRRSV by denaturing polyacrylamide gel electrophoresis.

[0026] Figure 3 Changes in TNF-α expression in Marc-145 cells after transfection with recombinant PRRSV-3'UTR and viral infection;

[0027] Figure 4 Changes in IFN-β expression in Marc-145 cells after transfection with recombinant PRRSV-3'UTR and viral infection;

[0028] Figure 5 Changes in IL-6 expression in Marc-145 cells after transfection with recombinant PRRSV-3'UTR and viral infection;

[0029] Figure 6 Changes in IRF3 expression in Marc-145 cells after transfection with recombinant PRRSV-3'UTR and viral infection;

[0030] Figure 7 The expression and distribution of NF-κB in Marc-145 cells after transfection with recombinant PRRSV-3'UTR and viral infection;

[0031] Figure 8 To investigate the activation of the IRF-3 signaling pathway in Marc-145 cells after transfection with recombinant PRRSV-3'UTR and viral infection;

[0032] Figure 9 To detect the viral titer change curve after transfection with recombinant PRRSV-3'UTR and infection with the virus, the qPCR method was used.

[0033] Figure 10 To detect the effect of PEG-LNP on tRNA using denaturing polyacrylamide urea gel electrophoresis ser -3'PRRSV package status;

[0034] Figure 11 PEG-LNP encapsulates tRNA ser- Zeta particle size range after 3'PRRSV;

[0035] Figure 12 For infection with inactivated vaccines and tRNA serChanges in the concentration of PRRSV-specific IgG antibodies in rat serum after -3'PRRSV. Detailed Implementation

[0036] The following is a further detailed description of the present invention in conjunction with specific preferred embodiments, and it should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, various simple deductions or substitutions can be made without departing from the concept of the present invention, and all such modifications and substitutions should be considered within the scope of protection of the present invention. Specific conditions not specified in the embodiments are performed according to conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, all reagents or instruments used are conventional products obtained through commercial channels.

[0037] Example 1

[0038] Construction of a novel nucleic acid vaccine adjuvant

[0039] (1) Search the PRRSV genome sequence in the gene database of the NBCI website (https: / / www.ncbi.nlm.nih.gov / ) to find the 3'UTR sequence of different PRRSV strains. Compare the 3'UTR regions of different strains to find a segment of the 3'UTR in the chimeric PRRSV genome with high homology and conservation. The highly conserved 3'UTR sequence is a sequence with more than 90% similarity to SEQ ID NO.1.

[0040] (2) A highly conserved 3'UTR sequence (SEQ ID NO.1) was inserted into the anticodon loop of a human serine tRNA scaffold (Table 1), and a recombinant PRRSV-3'UTR sequence (tRNA) was designed. ser -3'PRRSV). The designed human tRNA was predicted using the CentroidFold (http: / / www.ncrna.org / centroidfold) online prediction tool. ser The secondary structure of the recombinant PRRSV-3'UTR expressed in scaffold chimerism was predicted by adjusting the scaffold tRNA. ser The position of the anticodon at the PRRSV-3'UTR was determined, resulting in a chimeric sequence with more than 50% similarity to SEQ ID NO.2. Individual nucleotides were then adjusted, and sequences with optimal secondary structure were selected to construct the recombinant expression plasmid tRNA. ser -3'PRRSV (SEQ ID NO. 2). Using the Eag I and Sac II restriction endonuclease sites of the pBSKrna plasmid, tRNA was... ser The -3'PRRSV sequence was inserted into the pBSKrna plasmid to obtain tRNA.ser -3'PRRSV expression vector.

[0041] Table 1 Sequence List

[0042]

[0043] (3) tRNA ser After transforming the -3'PRRSV expression plasmid into E. coli HST08 competent cells, 8 mL of LB medium was added and cultured overnight at 37°C with shaking at 200 rpm. The bacterial culture was centrifuged at 9000 g for 2 min, and the precipitate was collected. The precipitate was resuspended in 180 μL of 10 mM magnesium acetate-Tris·HCl solution, followed by 200 μL of saturated phenol, and the mixture was shaken at room temperature for 20–60 min. After centrifugation at 10000 g for 10 min, the aqueous phase was collected, and 0.1 times the volume of the aqueous phase of 5 M NaCl was added to precipitate macromolecular impurities. The supernatant was then added to 2 times the volume of anhydrous ethanol, centrifuged at 10000 g for 10 min, and the supernatant was discarded. Residual ethanol was absorbed with absorbent paper, and after the RNA dried, DEPC water was added to dissolve the RNA. The concentration was determined, and the RNA sample was stored at -80°C.

[0044] Experimental Example 1

[0045] Denaturing polyacrylamide gel electrophoresis for identification of recombinant tRNA ser -3'PRRSV expression

[0046] The RNA sample obtained in Example 1 was mixed with RNA loading buffer and added to the wells of the denaturing gel. After electrophoresis at 100V for 50-80 min, the sample was placed in a solution containing 0.5 μg / mL GelRed and gently shaken for 20 min. The gel was then observed using a gel imaging system, photographed, and saved. The results are as follows: Figure 1 As shown.

[0047] The results are as follows Figure 1 As shown, this invention uses denaturing polyacrylamide gel electrophoresis to identify recombinant tRNA in Escherichia coli. ser The expression of -3'PRRSV, and the thickness of the band, reflects the expression level. The results indicate that recombinant tRNA... ser- 3'PRRSV can be expressed in large quantities.

[0048] Experimental Example 2

[0049] FPLC purification of recombinant tRNA ser -3'PRRSV

[0050] (1) Recombinant tRNAser-3'PRRSV was purified using the Bio-Rad NGC™ Chromatography System with an ion exchange column (ENrich™ Q10).

[0051] Mobile phase A: 10 mM NaH2PO4 solution, pH 7.0.

[0052] Mobile phase B: 10 mM NaH2PO4 solution, 1 M NaCl solution, pH 7.0.

[0053] The flow rate was 2.0 mL / min. The column was alternately washed with DEPC water, mobile phase A, and mobile phase B for approximately 1 h each time. Each wash consisted of 5 column volumes.

[0054] Total RNA was separated using the following procedure: 0–8 min (0% B), 8–13 min (55% B), 13–50 min (55–75% B), 50–70 min (100% B), and 70–80 min (0% B). RNA was detected at 260 nm absorbance, and the peak corresponding to recombinant RNA was collected. Purity was determined by denaturing polyacrylamide gel electrophoresis.

[0055] (2) RNA sample processing methods

[0056] The total RNA extraction procedure is the same as above. The extracted total RNA was centrifuged at 13,000 rpm for 10 min at 4°C. The supernatant was filtered through a 0.45 μm microporous membrane, and 5–10 mg was injected each time.

[0057] (3) FPLC component collection and concentration desalting

[0058] The purity of the collected fractions was determined by denaturing polyacrylamide gel electrophoresis. RNA was precipitated from the mixed fractions with two volumes of anhydrous ethanol and incubated at -80°C for approximately 0.5 h. RNA was collected by centrifugation at 10000g at 4°C for 10 min. The RNA precipitate was dissolved in DEPC water, filtered through an ultrafiltration column, and centrifuged at 7500g at 4°C for 10 min. The filtrate was discarded. This step was repeated until all solutions were centrifuged. The ultrafiltration column was then inverted and centrifuged at 2000g for 2 min. The resulting solution was collected, its concentration determined, and it was stored at -80°C. The results are as follows: Figure 2 As shown.

[0059] The results are as follows Figure 2 As shown, this invention utilizes PFLC to purify recombinant tRNA. ser Chromatograms of -3'PRRSV and identification of the purity of the collected components by denaturing polyacrylamide gel electrophoresis. Figure 2 Chromatogram A shows the location of the target peak and the collected components, indicating recombinant tRNA. ser- 3'PRRSV was well separated from other endogenous RNAs in Escherichia coli. Figure 2 Denaturing polyacrylamide gel electrophoresis of B showed that the purified recombinant tRNA...ser -3'PRRSV, a single band without extraneous bands or tailing, confirms the presence of recombinant tRNA. ser -3'PRRSV has good purity, meaning that pure recombinant tRNA can be obtained after FPLC purification. ser -3'PRRSV.

[0060] Experimental Example 3

[0061] Transfect tRNA ser Effect of -3'PRRSV adjuvant on cytokine levels after PRRSV infection of Marc-145 cells

[0062] The total RNA of Marc-145 cells infected with transfection adjuvant and inactivated PRRSV was extracted and analyzed by real-time quantitative PCR to detect changes in the expression of cytokines TNF-α, IFN-β, IL-6 and interferon-regulated transcription factor IRF3.

[0063] The specific steps are as follows:

[0064] (1) Cell transfection

[0065] Marc-145 cells were loaded at 5 × 10 4 Cells were seeded per well in 6-well plates, and cells were divided into Blank and tRNA groups. ser The -3' PRRSV group was transfected with cells according to the Pvam instruction manual. ser The transfection concentration of PRRSV was 20 nM. 24 h after transfection, both groups were infected with PRRSV (3 × 10⁻⁶ m³ / h). 6 PFU / mL, TCID50 method).

[0066] (2) RNA extraction

[0067] Follow the instructions for the EZNATotal RNA KitI. After extracting RNA from cells, determine the concentration and store at -80°C for later use.

[0068] (3) qPCR detection of the expression of cytokines TNF-α, IL-6, IFN-β and TRF3

[0069] mRNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit. The reverse transcription conditions were: 37℃ / 15 min; 80℃ / 15 s. The changes in the levels of cytokines TNF-α, IL-6, IFN-β, and TRF-3 in each group were detected by qPCR. The qPCR reaction conditions are shown in Table 2; the primer sequences for detecting the levels of cytokines TNF-α, IFN-β, IL-6, and TRF-3 are shown in Table 3.

[0070] Table 2 qPCR reaction conditions

[0071]

[0072]

[0073] The results are as follows Figure 3 , Figure 4 , Figure 5 , Figure 6 As shown, Figure 3-6 The results show the changes in the levels of cytokines TNF-α, IFN-β, IL-6, and TRF-3 in Marc-145 cells after transfection with recombinant PRRSV-3'UTR and viral infection. The results indicate that, compared with the Blank group, tRNA levels were significantly lower. ser The expression levels of TNF-α and IL-6 in the -3'PRRSV group were not statistically significantly different, but there was an increasing trend, suggesting that tRNA... ser -3'PRRSV can activate cellular immune responses. Significantly elevated expression levels of interferon IFN-β and interferon transcription factor IRF-3 suggest the presence of tRNA. ser -3'PRRSV adjuvant may activate downstream signaling pathways by activating TLR3, thereby enhancing the pro-inflammatory response of Marc-145 cells and improving the immune cell function of the cells.

[0074] Test Example 4

[0075] Transfect tRNA ser Effect of -3'PRRSV adjuvant on TLR3 receptor downstream signaling activation after PRRSV infection of Marc-145 cells

[0076] Further detection of tRNA using immunofluorescence assay ser The effects of -3'PRRSV on the expression and distribution changes of two key transcription factors in the downstream TLR3 signaling pathway, NF-κB and IRF3, are shown in the following steps:

[0077] (1) Cell inoculation

[0078] On day 1, sterile 14mm cell slides were placed in 24 wells, and 0.5 mL of 0.1% poly-L-lysine was added to each well. The slides were incubated overnight at room temperature. On day 2, the 0.1% poly-L-lysine in the plate was discarded, and the cell slides were washed three times with sterile PBS. The cells were then cultured at 1×10⁻⁶ ppm. 4 Cells were seeded per well in a plate and cultured at 37°C in a 5% CO2 incubator.

[0079] (2) Adjuvant transfection and viral infection

[0080] The cells were divided into Blank, Al salt adjuvant positive control group, and tRNA group. ser -3'PRRSV treatment group. Cell transfection was performed according to the Pvam instruction manual, tRNA... ser The transfection concentration of PRRSV was 20 nM. 24 h after transfection, the three groups were infected with PRRSV (3 × 10⁻⁶ m³ / h). 6 PFU / mL, TCID50 method).

[0081] (3) Cell fixation

[0082] Discard the cell culture medium, wash three times with PBS, add 500 μL of 4% paraformaldehyde fixative to the culture plate, fix at room temperature for 30 min, discard the paraformaldehyde, and wash three times with PBS.

[0083] (4) Breaking the membrane and sealing

[0084] Remove residual PBS from the culture plate, add 1 mL of 0.5% Triton X-100, incubate at room temperature for 20 min, wash with PBS 3 times for 5 min each time, add 1 mL of 3% BSA blocking solution to the culture plate, and block at room temperature for 1 h.

[0085] (5) Incubate antibodies

[0086] Discard the blocking buffer. Dilute the antibody according to the instructions, and add NF-κB or IRF-3 primary antibody to the 24-well plate. Incubate overnight at 4°C. Wash three times with PBS for 5 minutes each time. Add 1:500 fluorescent secondary antibody to the 24-well plate, wrap in aluminum foil to protect from light, and incubate on a horizontal shaker at room temperature for 1 hour.

[0087] (6) Cell nuclear staining and mounting

[0088] Discard the fluorescent secondary antibody, wash three times with PBS for 5 min each time, add 500 μL of DAPI staining solution to each well, incubate in the dark on a horizontal shaker at room temperature for 10 min, then discard the DAPI, wash three times with PBS for 5 min each time, mount the slides, and finally observe and photograph them using a laser scanning confocal microscope. The results are as follows. Figure 7 , Figure 8 As shown.

[0089] The results are as follows Figure 7 As shown, immunofluorescence assays were used to detect NF-κB expression and distribution in Marc-145 cells after sequential transfection with tRNA-3'PRRSV adjuvant and infection with PRRSV. The results showed that the expression and distribution of NF-κB in the Al salt adjuvant positive control group and tRNA... ser The overall fluorescence intensity of NF-κB in the -3'PRRSV group was higher than that in the Blank group, suggesting that the Al salt adjuvant positive control and tRNA...ser -3'PRRSV promoted NF-κB expression; Al salt adjuvant positive control and tRNA ser The NF-κB fluorescence intensity in the cell nuclei of both groups with -3'PRRSV was significantly enhanced, suggesting the presence of Al salt adjuvant and tRNA. ser -3'PRRSV promotes NF-κB nuclear translocation; compared with Al salt adjuvant, tRNA se The fluorescence intensity of NF-κB in the nuclei of r-3'PRRSV group was slightly enhanced.

[0090] The results are as follows Figure 8 As shown, this is a sequence of tRNA treatments on cells. ser Following PRRSV adjuvant transfection and PRRSV infection, immunofluorescence assays were performed to detect IRF-3 signaling pathway activation in Marc-145 cells. Results showed that, compared to the Blank group, the Al salt adjuvant positive control and tRNA... ser The IRF-3 fluorescence intensity was significantly enhanced in the -3'PRRSV adjuvant group; simultaneously, compared with the Al salt adjuvant positive control group, tRNA... ser The fluorescence intensity of IRF-3 in the -3'PRRSV group was significantly increased, and the fluorescence intensity in the cell nucleus was also significantly increased, suggesting that tRNA... ser -3'PRRSV activates IRF3 and promotes its dimerization into the cell nucleus.

[0091] In summary, the results indicate that tRNA in Marc-145 cells... ser- 3'PRRSV adjuvant can further activate downstream NF-κB and IRF-3-related molecular signaling pathways by activating TLR3.

[0092] Experimental Example 5

[0093] Transfect tRNA ser Effect of -3'PRRSV adjuvant on viral titer after PRRSV infection of Marc-145 cells

[0094] (1) Construction of a standard curve between viral gene copy number and Ct value

[0095] Viral titer was determined using the external standard method. PEGF-C1 was selected as the vector, and a highly conserved sequence, ORF2, from the virus was inserted into an empty vector to construct a recombinant expression vector. Primers targeting the conserved ORF2 sequence were designed and named ORF2 for qPCR detection of the ORF2 gene fragment. A standard curve between plasmid copy number and Ct value was generated using qPCR to calculate the viral titer in the supernatant.

[0096] (2) Extraction of viral RNA (EZNAViral RNA Kit)

[0097] Marc-145 cells at 5 × 10 4 Cells were seeded per well in 6-well plates. Cell transfection was performed according to the Pvam instruction manual, with tRNA... ser The transfection concentration of -3'PRRSV was 20 nM. Marc-145 cells were infected with live virus 24 h after transfection. Supernatants were collected and viral RNA extracted from the supernatants on days 1, 2, 3, 4, 5, and 6 after infection.

[0098] (3) Determination of virus titer

[0099] The extracted viral RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit. The reverse transcription conditions were: 37℃ / 15min; 80℃ / 15s. Using cDNA from each group as templates, the Ct value of the viral ORF2 sequence was determined by qPCR. The qPCR reaction conditions are shown in Table 4, and the ORF2 qPCR primer sequences are shown in Table 5. The viral titer at each time point was calculated.

[0100] Table 4 qPCR reaction conditions

[0101]

[0102] The results are as follows Figure 9 As shown, this is a transfected tRNA. ser 24 hours after receiving the -3' PRRSV adjuvant, live PRRSV was introduced for infection. Viral titers in Marc-145 cell supernatants were measured on days 1, 2, 3, 4, 5, and 6 post-infection. The results showed that the viral load in the vaccine adjuvant group was significantly higher than that in the Blank group, peaking on days 1 and 2, indicating that tRNA... ser -3'PRRSV adjuvant can significantly enhance the ability of live viruses to infect cells.

[0103] Experimental Example 6

[0104] Preparation of lipid nanoparticles and their effect on tRNA ser -3'PRRSV Packaging Effect Evaluation

[0105] (1) Contains tRNA ser Preparation of -3'PRRSV citrate buffer

[0106] Prepare a 10mM citrate buffer solution with a pH of 4.0. Add 320 μg of tRNA. ser -3'PRRSV was dissolved in 3 mL of citrate buffer to prepare a 107 μg / mL tRNA-containing solution. ser -3'PRRSV in citrate buffer.

[0107] (2) Configuration of lipid nanoparticle synthesis system

[0108] The raw materials for lipid nanoparticles were dissolved in ethanol at a molar ratio of 50:10:37.5:2.5 (MC3 / DSPC / cholesterol / DMG-PEG2000), and the system volume was adjusted to 20 mL.

[0109] (3) Preparation of working solution system for RNA encapsulated by lipid nanoparticles

[0110] The lipid nanoparticle synthesis system was combined with tRNA-containing ser -3'PRRSV citrate buffer was microfluidically mixed at a volume ratio of 3:1. Microfluidic parameters were set as follows: ethanol to 5 mL / min flow rate, containing tRNA. ser- The 3' PRRSV was coated with citrate-buffered aqueous solution at a flow rate of 15 mL / min. After coating, the coated tRNA was rinsed with 10 mM citrate-buffered aqueous solution. ser -3'PRRSV was diluted 5-fold. The prepared lipid nanoparticles-tRNA were filtered using a 100kD ultrafiltration tube. ser- The 3' PRRSV system was concentrated and diluted to its original volume with neutral PBS buffer. It was then ultrafiltered again to remove ethanol. The concentrate was diluted to its original volume with neutral PBS buffer containing 10% sucrose, filtered through a 0.22 μm filter for sterilization, and stored in a sealed container at 4°C.

[0111] (4) Lipid nanoparticles encapsulate tRNA ser -3'PRRSV Effect Evaluation

[0112] Gel retardation assays were used to determine whether RNA was encapsulated, and the particle size of the encapsulated particles was measured using a Zeta particle size analyzer.

[0113] The results are as follows Figure 10 As shown, this is a denaturing polyacrylamide urea gel electrophoresis assay for the effect of PEG-LNP on tRNA. ser -3'PRRSV encapsulation status. Results show that tRNA is encapsulated by lipid nanoparticles. ser -3'PRRSV(PEG-LNP-tRNA ser -3'PRRSV) showed no band, suggesting tRNA ser -3'PRRSV can be stably encapsulated in lipid nanoparticles.

[0114] The results are as follows Figure 11 As shown, PEG-LNP encapsulates tRNA. ser-Zeta particle size distribution after 3'PRRSV. The results show that lipid nanoparticles encapsulate tRNA. ser -3'PRRSV(PEG-LNP-tRNA ser The particle size after -3'PRRSV) is between 90-100nm, with an average particle size of 90.58nm, which meets the size requirements for nucleic acid vaccine adjuvant delivery.

[0115] Experimental Example 7

[0116] Animal-level detection of tRNA ser The effect of -3'PRRSV on the body's immune response

[0117] (1) Experimental grouping and vaccination

[0118] Nine 6-8 week old SD rats were divided into a saline group, an Al salt adjuvant positive control group, and a tRNA group. ser -3'PRRSV group, 3 mice per group. Inactivated virus vaccine (150 μg) was mixed with physiological saline (100 μL), Al salt adjuvant (100 μg), or liposome-encapsulated tRNA, respectively. ser -3' PRRSV vaccine adjuvant (100 μg) was mixed. Rats in each group were inoculated on days 0, 7 and 21, respectively.

[0119] (2) Serum sample collection

[0120] Blood was collected from rats at days 0, 7, 14, 21, 28, 35, 42, 49, and 56 using tail-tip sampling. After natural coagulation at room temperature for 30 minutes, the blood was centrifuged at 2000g for 10 minutes. The supernatant serum was collected and stored at -80℃.

[0121] (3) Specific antibody titer detection

[0122] PRRSV-specific IgG antibodies were detected using the IDEXX PRRS X3 ELISA kit. 100 μL (1:100 dilution) of serum sample was added to each well of a microplate, and the plate was incubated at 37°C for 1 hour. After washing, 100 μL of horseradish peroxide (HRP)-conjugated goat anti-rat IgG (1:5000) was added to each well, and the plate was incubated at room temperature for 1 hour. After washing, 100 μL of 3,3',5,5'-tetramethylbenzidine substrate solution was added to each well. The reaction was terminated by adding stop solution after 15 minutes, and the OD value of each well was read using a microplate reader.

[0123] This invention uses the ELISA method to dynamically monitor the changes in the titer of specific IgG antibodies in rat serum after rats are immunized with inactivated virus vaccines alone or in combination with adjuvants.

[0124] The results are as follows Figure 12 The figure shows the concentration of PRRSV-specific IgG antibodies in rat serum at different time points using ELISA. As can be seen from the figure, compared with the saline group, the concentrations of PRRSV-specific IgG antibodies after injection of Al adjuvant and tRNA significantly decreased. ser The concentration of PRRSV-specific IgG antibodies in the -3' PRRSV adjuvant group increased significantly at all time points; starting from day 7, the concentrations of A1 salt adjuvant and tRNA... ser In the -3'PRRSV adjuvant group, IgG antibody concentrations increased rapidly, peaking on day 21, but tRNA concentrations... ser- The peak IgG antibody concentration in the 3'PRRSV adjuvant group was significantly higher than that in the Al salt adjuvant group. This indicates that tRNA... ser -3'PRRSV, as a vaccine adjuvant for PRRSV, has a significant ability to activate the body's immune response.

[0125] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. The basic principles and main features of the present invention have been described above with specific implementation schemes. Based on the present invention, some modifications or substitutions can be made, but these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of protection claimed by the present invention.

Claims

1. A nucleic acid vaccine adjuvant for porcine reproductive and respiratory syndrome that activates Toll-like receptor 3, characterized in that, The porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant is a recombinant sequence with a human serine tRNA scaffold and a conserved sequence of the 3'UTR in the PRRSV genome embedded at the anticodon loop of the human serine tRNA; the conserved sequence of the 3'UTR is SEQ ID NO.1, and the SEQ ID NO.1 sequence is as follows: nnn cugauugaca cugugccucu aagucaccua uucaauuagg gcgaccgugu ggggguaaaguuuaauugg nnn.

2. The porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant according to claim 1, characterized in that, The recombinant sequence is SEQ ID NO.2, and the SEQ ID NO.2 sequence is as follows: gcagcgaugg ccgagugguu aaggcguugg acucugauug acacuugcc ucuaagucaccuauucaauu agggcgaccg ugugggggua aaguuuaauu ggaauccaau ggggucuccc cgcgcagguucgaacccugc ucgcugcgcc a.

3. The method for preparing the porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant according to claim 2, characterized in that, The specific preparation steps for the porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant are as follows: S1: Obtain the PRRSV genome sequence from the NCBI database and perform comparative analysis on its 3'UTR sequence to obtain the conserved 3'UTR sequence as described in claim 1; S2: The 3'UTR conserved sequence is inserted into the anticodon loop of human serine tRNA to synthesize the recombinant sequence as described in claim 2, and the recombinant sequence is inserted into the plasmid to construct the expression vector; S3: Transform the expression vector into competent Escherichia coli cells to obtain recombinant strains, and culture them in a culture medium to obtain bacterial suspension; S4: Extract total RNA from the bacterial culture obtained in step S3, and purify it by FPLC to obtain recombinant PRRSV-3'UTR.

4. The method for preparing the porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant according to claim 3, characterized in that, The plasmid used in step S2 is the pBSMrna plasmid.

5. The method for preparing the porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant according to claim 3, characterized in that, In step S3, the competent E. coli cells are HST08 or DH5α competent cells, and the culture medium is LB medium or TB medium.

6. The method for preparing the porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant according to claim 3, characterized in that, It also includes the following steps: The recombinant PRRSV-3'UTR was encapsulated using nanoliposomes as a carrier.

7. The use of the porcine reproductive and respiratory syndrome (PRRS) nucleic acid vaccine adjuvant according to claim 1 or 2 in the preparation of a porcine PRRS vaccine.

Images