A method for preparing an opg knock-out non-human animal model

The use of CRISPR/Cas9 gene editing technology to prepare non-human animal models with OPG gene knockout solves the problem that existing technologies are difficult to use to prepare OPG gene knockout models, simplifies the modification process, and provides an experimental tool for studying osteoporosis.

CN120591264BActive Publication Date: 2026-06-05BEIJING LAB ANIMAL RES CENT
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510517091.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2026-06-05
Estimated Expiration
2045-04-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively prepare non-human animal models with OPG gene knockout, resulting in a lack of ideal experimental tools for studying osteoporosis.

Method used

Using CRISPR/Cas9 gene editing technology, gRNAs specifically targeting the OPG gene in non-human animals were designed. The OPG gene was then disrupted through gene editing technology to create an OPG gene knockout non-human animal model.

Benefits of technology

The process of modifying the OPG gene has been simplified and shortened, providing a foundation for studying the physiological and molecular mechanisms of the OPG gene, and offering an ideal animal model for osteoporosis research and new drug development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120591264B_ABST
    Figure CN120591264B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of gRNA targeted to non-human animal OPG gene, preparation method of OPG gene knockout non-human animal model.The preparation method of OPG gene knockout non-human animal model includes the following steps: using gene editing technology, destroy non-human animal OPG gene, for the gRNA targeted to non-human animal OPG gene includes one or two shown in SEQ ID NO:1 And / or SEQ ID NO:2.The present application designs the gRNA specifically targeted to non-human animal OPG gene, using Cas9 protein, OPG gene is knocked out, causes frame shift mutation, to reach the purpose of gene knockout to non-human animal.The method of the present application to non-human animal OPG gene modification is simple and easy to operate, short cycle, using the method of OPG model for research OPG gene physiological mechanism and molecular mechanism provides foundation, while providing important tool for research osteoporosis pathogenesis and drug development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a method for preparing an OPG gene knockout non-human animal model. Background Technology

[0002] Osteoporosis, also known as osteoporotic osteoporosis, is a systemic bone disease characterized by relatively less cartilage, making it susceptible to minor structural damage and resulting in recurrent cartilage fractures. According to a survey report from Europe and the United States, the number of people suffering from chronic osteoporosis in my country and around the world has exceeded 1.02 billion, and this number is projected to rise to 1.36 billion within the next 20 years. As biological tissue, bone is constantly formed and absorbed; the balance between osteoblasts and osteoclasts affects bone health. Osteoprotegerin (OPG), as an osteoclastogenesis inhibitor, mainly affects the balance between osteoblasts and osteoclasts through two mechanisms. First, it directly inhibits osteoclast (OC) activity by regulating the expression of proteases and their inhibitors. Second, it forms the OPG / RANK / RANKL signaling pathway together with receptor activator of nuclear factor-κB (RANK) and receptor activator of nuclear factor-κB ligand (RANKL). RANK and RANKL binding can stimulate OC differentiation and maturation, while OPG competitively binds to RANKL, inhibiting normal OC differentiation, thereby reducing bone resorption and disrupting the balance between osteoblasts and osteoclasts, leading to osteoporosis. Therefore, animal models with OPG gene mutations will provide a powerful experimental tool for the study and treatment of human osteoporosis.

[0003] In view of this, the present invention is proposed. Summary of the Invention

[0004] The purpose of this invention is to provide a method for preparing an OPG gene knockout non-human animal model, which can prepare an OPG gene knockout non-human animal model.

[0005] In a first aspect, the present invention provides a gRNA that targets the OPG gene in non-human animals, wherein the nucleotide sequence of the gRNA is one or both of the following shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0006] Specifically, the gRNA comprises a nucleotide sequence partially complementary to the OPG gene in non-human animals.

[0007] Specifically, the non-human animal OPG gene is shown in SEQ ID NO:3.

[0008] In a second aspect, the present invention provides a method for preparing an OPG gene knockout non-human animal model, comprising the following steps: using gene editing technology to destroy the non-human animal OPG gene, wherein the gRNA used to target the non-human animal OPG gene includes one or both of the gRNAs shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0009] Preferably, the gene editing technology is any one of zinc finger nuclease-based gene editing technology, TALEN gene editing technology, or CRISPR / Cas9 gene editing technology; more preferably, the gene editing technology is CRISPR / Cas9 gene editing technology.

[0010] Those skilled in the art will understand that, upon learning of a highly efficient gene-editing region (in this application, the non-human animal OPG gene), they can use any gene-editing method, such as zinc finger nuclease-based gene-editing technology, TALEN gene-editing technology, CRISPR / Cas (e.g., CRISPR / Cas9) gene-editing technology, and other gene-editing methods discovered in the future, to edit the learned highly efficient gene-editing region, optimize gene-editing conditions, and achieve the purpose of efficient editing. Therefore, this application covers technical solutions for gene knockout of the non-human animal OPG gene identified in this application using any available gene-editing method.

[0011] Preferably, the method for preparing an OPG gene knockout non-human animal model includes the following steps:

[0012] Prepare a gene editing solution containing Cas9 and gRNA for targeting the OPG gene in non-human animals;

[0013] Delivering gene-editing fluid into non-human animal fertilized eggs;

[0014] After delivery, the fertilized eggs were cultured and transplanted into pseudopregnant mice to obtain a non-human animal model of OPG gene knockout.

[0015] Preferably, the method further includes the following steps: mating non-human animal models with OPG gene knockout to obtain heterozygous or homozygous offspring.

[0016] Preferably, the delivered fertilized eggs are cultured to two-cell transplantation into pseudopregnant mice.

[0017] Preferably, the gene editing solution is delivered into non-human animal fertilized eggs via electroporation, and the specific operation of electroporation is known in the art.

[0018] Specifically, gene editing fluid can be prepared using various methods known in the art.

[0019] Preferably, the molar ratio of Cas9 to gRNA in the gene editing solution is (2-3):(2-5), for example, it can be 1:1, 2:2.5, 2:3, 2:3.5, 1:2, 2:4.5, 2:5, 2.5:2, 2.5:3, 2.5:3.5, 2.5:4, 2.5:4.5, 3:2, 3:2.5, 3:3.5, 3:4, 3:4.5, 3:5, etc.

[0020] Preferably, the gRNA used to target the OPG gene in non-human animals is a gRNA obtained after screening and confirming its knockout efficiency.

[0021] Preferably, the screening of knockout efficiency includes the following steps: constructing the designed gRNA into a vector backbone, delivering it to recipient cells, and then screening to obtain gRNAs with high knockout efficiency.

[0022] Preferably, the cells are delivered to the recipient cells via liposome transfection.

[0023] Preferably, the carrier skeleton includes any one of PX459, PX330, PX260, PX334, PX335, PX458, PX461, PX462, PX551 and PX552; more preferably, the carrier skeleton is PX459.

[0024] In a third aspect, the present invention provides an OPG gene knockout non-human animal model, which is obtained by the above-described method for preparing an OPG gene knockout non-human animal model.

[0025] Preferably, the non-human animal described in this invention is a mouse.

[0026] In a fourth aspect, the present invention provides a method for preparing an OPG gene knockout mouse model, which utilizes CRISPR / Cas9 gene editing technology to destroy the mouse OPG gene, and the gRNA used to target the mouse OPG gene includes one or both of the gRNAs shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0027] In one specific embodiment, the gRNA used to target the mouse OPG gene is shown in SEQ ID NO:2.

[0028] In one specific embodiment, the mouse is a C57BL / 6J mouse.

[0029] Specifically, the method for preparing the OPG gene knockout mouse model includes the following steps:

[0030] Prepare a gene editing solution containing Cas9 and gRNA for targeting the mouse OPG gene;

[0031] Gene-editing fluid was electrotransfected into mouse zygotes;

[0032] The fertilized eggs after electroporation were cultured to two-cell stage and then transplanted into pseudopregnant mice to obtain the F0 generation of OPG gene knockout mice.

[0033] F0 generation mice were crossed with wild-type mice to obtain F1 generation heterozygous mice. F1 generation heterozygous mice were crossed with F1 generation heterozygous mice and F2 generation homozygous mice. The OPG gene knockout homozygous mouse model was obtained by phenotypic identification.

[0034] Specifically, the preparation of a gene editing solution containing Cas9 and gRNA for targeting the mouse OPG gene includes the following steps: synthesizing gRNA for targeting the mouse OPG gene; and mixing the gRNA and Cas9 to obtain the gene editing solution.

[0035] Specifically, the synthesis of the gRNA and Cas9 can be performed using methods known in the art.

[0036] Preferably, the gRNA used to target the mouse OPG gene is the gRNA of the OPG gene obtained after screening and confirming the knockout efficiency using mouse cells.

[0037] Preferably, the screening of knockout efficiency using mouse cells includes the following steps:

[0038] The designed gRNA was constructed into the vector backbone PX459 and transfected into mouse cells using liposomes.

[0039] Puromycin was used to screen for gRNAs with high knockout efficiency, which were then used as gRNAs for the OPG gene after screening and confirmation.

[0040] Preferably, the mouse cells are B16 cells (mouse melanoma cells).

[0041] In a fifth aspect, the present invention provides an OPG gene knockout mouse model, which is obtained by the above-described method for preparing an OPG gene knockout mouse model.

[0042] In a sixth aspect, the present invention provides a vector comprising: a vector backbone and the above-described gRNA.

[0043] Preferably, the carrier skeleton includes any one of PX459, PX330, PX260, PX334, PX335, PX458, PX461, PX462, PX551 and PX552; more preferably, the carrier skeleton is PX459.

[0044] Preferably, the vector sequence is as shown in SEQ ID NO:10 and / or SEQ ID NO:11.

[0045] In a seventh aspect, the present invention provides a cell, tissue, or organ derived from a non-human animal model obtained by the preparation method described above.

[0046] The eighth aspect of the present invention provides the application of the non-human animal model obtained by the above-described method for preparing the OPG gene knockout non-human animal model, and the above-described cell, tissue or organ model system in pharmacological, neurological, immunological, microbiological and medical research.

[0047] The present invention has at least the following beneficial effects:

[0048] The technical solution of this invention involves designing two gRNAs that specifically target the OPG gene in non-human animals, and then using the Cas9 protein to knock out the OPG gene, causing a frameshift mutation, thereby achieving gene knockout in non-human animals. The method for modifying the OPG gene in non-human animals using this invention is simple, easy to implement, and has a short cycle time. The OPG model constructed using this method provides a foundation for studying the physiological and molecular mechanisms of the OPG gene, and also provides an ideal animal model for studying the pathogenesis of osteoporosis and screening new drugs and therapies. Attached Figure Description

[0049] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0050] Figure 1 The results of single nucleotide polymorphism detection of the OPG gene target provided by this invention are shown, where M is a D2000 Maker and the bands are 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp, respectively.

[0051] Figure 2 The identification results of OPG gene knockout mouse melanoma cells provided by this invention.

[0052] Figure 3For the identification of OPG genotype in F2 generation mice provided by the present invention. Detailed Implementation

[0053] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0054] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form includes the plural form unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0055] definition

[0056] The terms “polynucleotide,” “nucleotide,” “nucleotide sequence,” “nucleic acid,” and “oligonucleotide” as used herein are used interchangeably. They refer to polymeric forms of nucleotides (deoxyribonucleotides or ribonucleotides) of any length or similar. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of genes or gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), small RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched-chain polynucleotides, plasmids, vectors, DNA isolated from any sequence, RNA isolated from any sequence, nucleic acid probes, and primers. One or more nucleotides in a polynucleotide may be further modified. The sequence of a nucleotide may be interrupted by non-nucleotide components. Polynucleotides may also be modified after polymerization, for example, by coupling with a labeling agent.

[0057] The term "CRISPR / Cas9" as used in this article refers to an adaptive immune defense developed by bacteria and archaea over a long period of evolution to combat invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technique for specifically modifying the DNA of target genes. CRISPR / Cas9-based gene editing technology has shown great promise in a range of gene therapy applications, such as hematological diseases, cancer, and other genetic disorders. This technology has already been applied to the precise modification of the genomes of human cells, zebrafish, mice, and bacteria.

[0058] The terms “gRNA,” “guide RNA,” and “CRISPR guide sequence” used herein are used interchangeably and refer to nucleic acids containing sequences that determine the specificity of Cas-binding proteins in the CRISPR / Cas system. The gRNA hybridizes (partially or completely complementary) to a target nucleic acid sequence in the host cell genome. The length of the gRNA or a portion thereof that hybridizes to the target nucleic acid can be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid can be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid is between 10-30 or 15-25 nucleotides.

[0059] As used herein, the term "gRNA" generally refers to single-molecule guide RNA or single-stranded guide RNA in artificial CRISPR / Cas9 systems. It is the RNA that guides the Cas protein to specifically bind to the target DNA sequence and is an important component of CRISPR gene knockout / knock-in systems. The gRNA of this application contains a guide sequence that targets the target sequence. In a preferred embodiment, the sgRNA of this application further comprises a tracrRNA sequence and a crRNA sequence.

[0060] In this application, the "guide sequence" refers to a sequence of approximately 17-20 bp specifying a target site, and can be used interchangeably with "guide sequence" or "spacer." In the context of CRISPR complex formation, the "target sequence" is a sequence designed to be complementary to the guide sequence. Hybridization between the target sequence and the guide sequence promotes CRISPR complex formation. This hybridization requires sufficient complementarity between the "target sequence" and the "guide sequence" to induce hybridization and promote CRISPR complex formation; complete complementarity is not mandatory.

[0061] "Complementarity" means that the "guide sequence" or "guide sequence" and the target nucleotide sequence (the OPG gene in the target knockout mouse gene of this application) can hybridize according to the nucleotide pairing principles discovered by Watson and Crick. Those skilled in the art will understand that the "guide sequence" can hybridize with the target nucleotide sequence as long as there is sufficient complementarity, without requiring 100% perfect complementarity between them. In some embodiments, when optimally aligned using a suitable alignment algorithm, the complementarity between the guide sequence and its corresponding target sequence can be about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. Optimal alignment can be determined using any suitable algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, and algorithms based on the Burrows-WheelerTransform, etc.

[0062] Typically, in the context of an endogenous CRISPR system, the formation of the CRISPR complex (including hybridization of the guide sequence with the target sequence and complexation with one or more Cas proteins) results in the cleavage of one or both strands of the target sequence or in the vicinity of the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs from the target sequence). Not wishing to be limited by theory, the tracr sequence may contain all or a portion of the wild-type tracr sequence (e.g., a wild-type tracr sequence of about or greater than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85 or more nucleotides) or a tracr sequence composed of the above may also form part of the CRISPR complex, for example, by hybridization along at least a portion of the tracr sequence with all or a portion of a crRNA sequence operatively linked to the guide sequence.

[0063] In some implementations, the tracr sequence has sufficient complementarity with the crRNA sequence to hybridize and participate in the formation of the CRISPR complex. Similar to the hybridization of the "target sequence" and "guide sequence," or "guide sequence," perfect complementarity is not required, as long as it is sufficient for its function. In some implementations, under optimal alignment, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% complementarity along the length of the crRNA sequence.

[0064] As used herein, the term "gene knockout" or "knockout" refers to editing a gene in a cell (e.g., modifying it by insertion, substitution, and / or deletion) to cause the gene to lose its original function (e.g., to be unable to express a functional protein). Various known molecular biology techniques (e.g., gene editing using zinc finger nucleases, TALEN gene editing, and CRISPR / Cas (e.g., CRISPR / Cas9) gene editing) can be used to edit genes in the cellular genome. Gene knockout is not limited to the complete deletion or removal of an entire gene, but only to the point that the gene loses its original function. For example, gene knockout can be achieved by inserting a foreign DNA fragment into the gene, preventing it from expressing a functional protein, or by inserting or deleting one or more bases into the gene, causing a frameshift mutation. For example, the gene knockout described in this application can utilize CRISPR / Cas9 gene editing technology.

[0065] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well-known to those skilled in the art and include, but are not limited to: plasmids; phage particles; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). A vector may contain multiple elements controlling expression, including but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain a replication initiation site.

[0066] As used in this article, the term "delivery" refers to the introduction of biological macromolecules such as nucleic acids and proteins from outside the cell membrane into the cell membrane through certain pathways. Examples of "delivery" include electroporation, liposome transfection, lipid-nanoparticle delivery, viral delivery, and exosome delivery.

[0067] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0068] Example

[0069] The instruments used in this experiment:

[0070] Stereomicroscope (Olympus, SZX7), 37℃ 5% CO2 incubator (Sanyo, MCO15A), inverted fluorescence microscope (Olympus, IX73), heated stage (THERMOPLATE), electroporator (BEX, CUY21 EDIT II), ProFlex PCR System (Thermo Fisher Scientific, ProFlex 3×32well PCR system), gel imaging system (BiO-RAD, Universal Hood II), electrophoresis apparatus (BiO-RAD, PowerPac™ Basic), CO2 incubator (Reward, D180-P), constant temperature low-speed centrifuge (Eppendorf, 5702R), inverted fluorescence microscope (Olympus, IX51), constant temperature water bath (Shanghai Senxin, DKS24), cell counter (Reward, C100), double-person biosafety cabinet (Shandong Boke, BSC-1360IIA2).

[0071] Reagents used in this experiment:

[0072] PBS (Thermo Fisher Scientific, ER0291), MinElute PCR Purification Kit (QIAGEN, 2084), T4 DNA Ligase kit (Novozymes, C301), Phanta Max Super-Fidelity DNA Polymerase (Novozymes, P505), MinElute PCR Purification Kit (Kagegen, 28004), AgeI (Cyclophosphamide, SE1464S), Hyaluronidase (Nanjing Aibei, M2215), M2 culture medium (Sigma, M7167), Tissue culture oil (SAGE, ARF4008P-5P), Pregnant mare serum gonadotropin (PMSG) (Ningbo Sansheng Biotechnology), Human chorionic gonadotropin (hCG) (Ningbo Sansheng Biotechnology), PBS solution (Solepro, P1010), TSINGKE TSE030 T3 Super PCR Mix (TSINGKE, TSE030), Medium-volume Prep Kit (TIANGEN, DP118), Agarose Rapid Gel Extraction Kit (Generay, GK7045-200), PCR Product Purification Kit (Generay, GK2052-100), 5min TA / Blunt-Zero Cloning Kit (Novizan, C601), DMEM (Gibico, C11995500BT), Serum (Anwei, F0601), Penicillin and Streptomycin (Pusitan, PS0526), ​​Transfection Reagent (Beyotime, C0533), Puromycin (Gibico, A11138), Trypsin-EDTA (0.25%) (Thermo, 25200056). SpyCas9 NLS (NEB, M0646T).

[0073] 1. gRNA design

[0074] Two gRNAs, gRNA1 and gRNA2, were designed to knock out the mouse OPG gene (SEQ ID NO:3).

[0075] The sequence of gRNA1 is: ACCACTCTTATACGGACAGC (SEQ ID NO:1)

[0076] The sequence of gRNA2 is: GGTGAGGAAGGGCGTTACC (SEQ ID NO:2)

[0077] 2. Detection of target single nucleotide polymorphisms

[0078] Using NCBI Primer-BLAST, a pair of primers containing all gRNAs (gRNA1, gRNA2) was designed. Amplification using these primers required genome editing to produce no nonspecific bands. The sequence of the forward primer was GTGGTTAGTGACTTTTGGCTC (SEQ ID NO:4), and the sequence of the reverse primer was CTTTGGAAACAATCCAGACACA (SEQ ID NO:5). The amplified products were detected by 1% agarose gel electrophoresis and sequencing. The agarose gel electrophoresis results are shown below. Figure 1 As shown in the figure, M represents the D2000 Marker, and the bands are 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp. Electrophoresis results show that the target band is 594bp, and the primers show no specific bands. The PCR stock solution containing the target band was sent to the company for sequencing analysis, and the results showed that there was no single nucleotide mutation at the location of the gRNA.

[0079] 3. Plasmid construction

[0080] After mixing the following gRNA-F and gRNA-R synthesized by Qingke Company, annealing was performed according to the procedure in Table 1; the BPiI cloning site was selected, and the PX459 vector was linearized by enzyme digestion, as shown in Table 2; ligation was performed according to the enzyme ligation system in Table 3, the ligation product was transformed, plated, single clones were picked, and finally the successful construction of the vector PX459-gRNA was confirmed by bacterial PCR.

[0081] gRNA1-F: CACCGACCACTCTTATACGGACAGC (SEQ ID NO:6); gRNA1-R: AAACGCTGTCCGTATAAGAGTGGTC (SEQ ID NO:7); gRNA1-F and gRNA1-R anneal to produce sticky ends and link with sticky ends on PX459 to form PX459-gRNA1.

[0082] gRNA2-F: CACCGGTGTGAGGAAGGGCGTTACC (SEQ ID NO:8); gRNA2-R: AAACGGTAACGCCCTTCCTCACACC (SEQ ID NO:9); gRNA2-F and gRNA2-R anneal to produce sticky ends and link with sticky ends on PX459 to form PX459-gRNA2.

[0083] Table 1 gRNA annealing procedure

[0084]

[0085] Table 2. PX459 vector digestion system

[0086]

[0087] Table 3 Enzyme ligation system

[0088]

[0089] 4. Carrier efficiency assessment

[0090] PX459-gRNA1 (SEQ ID NO:10) and PX459-gRNA2 (SEQ ID NO:11) vectors were transfected into mouse melanoma cells (B16), respectively. After 48 hours, puromycin was added for selection culture. Cells were then extracted after another 48 hours for PCR amplification, and the PCR products were identified by 1% agarose gel electrophoresis. The vector efficiency results are shown below. Figure 2 As shown in the figure, the results indicate that gRNA2 knockout is more efficient.

[0091] 5. Preparation of gene editing solution

[0092] Synthesize gRNA2, and SpyCas9 NLS and gRNA2 were mixed in a molar ratio of 3:2 and Opti-MEM culture medium was added by volume to prepare the gene editing solution.

[0093] 6. Delivery of fertilized eggs using gene-editing fluid

[0094] 6.1 Superovulation in female mice

[0095] PMSG and hCG were diluted to 50 IU / ml. Four-week-old female C57BL / 6J mice were intraperitoneally injected with PMSG at 10 IU per mouse. Forty-eight hours after PMSG injection, hCG was injected intraperitoneally at 10 IU per mouse. Immediately after hCG injection, the mice were paired with male mice, with one male mouse paired with one female mouse.

[0096] 6.2 Preparation of culture droplets

[0097] Hyaluronidase digestion drops: Prepare one 200 μL drop of hyaluronidase in a 35 mm culture dish, and prepare five 50 μL drops of culture around it. Cover with mineral oil and preheat in an incubator at 37°C overnight.

[0098] M2 culture drop: Prepare a 100 μL M2 culture drop in a 35 mm petri dish, cover with mineral oil, and preheat in an incubator at 37°C overnight.

[0099] 6.3 Electroporation

[0100] The day after cage placement, the vaginal plug was examined, and female mice with the plug were removed. The female mice were euthanized by cervical dislocation, and their backs were dissected to expose the uterus, fallopian tubes, and ovaries. The fallopian tubes were removed; fat and blood were removed on paper; the dilated portion of the fallopian tube was torn in a digestive oil drop, and the oocytes containing cumulus cells were pulled into hyaluronidase. After 1-2 minutes, the culture dish was rotated clockwise 8-10 times. After digestion, the oocytes were collected and washed three times in M2 culture drops, and cultured in M2 culture medium for at least 2 hours in preparation for electroporation. 5 μL of gene editing solution was added to the gap between the platinum plates of the electrodes. Simultaneously, the fertilized oocytes were transferred to Opti-MEM culture medium, washed three times, and then transferred to gene editing solution for electroporation. After electroporation, the fertilized oocytes were washed three times with M2 culture medium, transferred to M2 culture drops, and cultured overnight in a 37°C 5% CO2 incubator until they reached two-cell stage. The next day, they were transplanted into the fallopian tubes of surrogate mother mice. The tails of the mice were collected for identification after birth.

[0101] 7. Genotyping of OPG gene knockout mice

[0102] Five days after the birth of F2 generation mice, 0.5 cm mouse tails were collected and placed in sterile centrifuge tubes for lysis to extract crude mouse tail DNA. Using the mouse tail DNA as a template, PCR amplification was performed using target single nucleotide identification primers. The amplification system is shown in Tables 4 and 5. The amplification products were identified by 1% agarose gel electrophoresis and sequencing. The agarose gel electrophoresis and sequencing results are shown below. Figure 3 As shown, agarose gel electrophoresis revealed that mice 1-8 all had only one band. Sequencing results showed that mice 1 and 2 were homozygous mice with a 2bp deletion of the OPG gene, and the OPG gene knockout mouse model was successfully constructed.

[0103] Table 4 PCR reaction system

[0104]

[0105] Table 5 Nested PCR Reaction System

[0106]

[0107]

[0108] This invention establishes an OPG gene knockout mouse model using CRISPR / Cas9 technology and forms a stable population of OPG gene knockout mice. This mouse model provides a foundation for studying the physiological and molecular mechanisms of the OPG gene, and also provides an important tool for studying the pathogenesis of osteoporosis and drug development.

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing an OPG gene knockout non-human animal model, characterized in that, The process includes the following steps: using gene editing technology to destroy the OPG gene in non-human animals, and using gRNA to target the OPG gene in non-human animals as shown in SEQ ID NO: 2; The gRNA used to target the OPG gene in non-human animals is obtained after screening and confirming the knockout efficiency. The screening of knockout efficiency includes the following steps: constructing the designed gRNA into the vector backbone, delivering it to the recipient cells, and then screening to obtain gRNAs with high knockout efficiency. The gene editing technology used employs CRISPR / Cas9 gene editing technology, and the specific steps are as follows: Prepare a gene editing solution containing Cas9 and gRNA for targeting the OPG gene in non-human animals; the molar ratio of Cas9 to gRNA in the gene editing solution is (2~3): (2~5); Delivering gene-editing fluid into non-human animal fertilized eggs; After delivery, the fertilized eggs were cultured and then transplanted into pseudopregnant non-human animals to obtain an OPG gene knockout non-human animal model. The non-human animal in question is a mouse; By mating non-human animal models with the OPG gene knocked out, heterozygous or homozygous offspring can be obtained.

2. A carrier, characterized in that, include: The vector backbone and the gRNA as described in claim 1.

Citation Information

Patent Citations

  • OPG gene editing system for constructing osteoporosis cloned porcine nuclear donor cell line and application of OPG gene editing system

    CN112795566A

  • Stable knockout of the ALKBH5 gene in mouse ovarian granulosa cell lines, their construction methods and applications

    CN114934068A

  • Method for gene knockout of mouse and constructed LMNA gene knockout mouse model

    CN116497029A

  • Gene knockout method for mouse and constructed GHR gene knockout mouse model

    CN118389520A

  • Mice lacking expression of osteoprotegerin

    US6087555A