Application of POGLUT1 gene in reversing skin fibroblast aging

Abstract

The invention discloses an application of a POGLUT1 gene in reversing senescence of skin fibroblasts. According to the application, by down-regulating expression of POGLUT1 in skin fibroblasts, SA-beta-Gal activity and expression of senescence marker genes p16, p21 and p53 can be reduced, the cell apoptosis number is reduced, and the anti-inflammatory capacity of HSFs is improved, so that the effect of reversing senescence of the skin fibroblasts is achieved. The invention discloses POGLUT1 as a core regulatory gene of MSCs for reversing skin aging, and a molecular regulatory network of the POGLUT1 in a skin aging process through a Notch signal channel, and clarifies a potential molecular mechanism of MSCs for reversing skin aging. The invention provides a new molecular target for clinically treating skin aging related diseases, also provides a new theoretical basis for understanding the effect of MSCs in skin aging, and also lays an important experimental foundation for clinically developing an anti-aging treatment strategy based on MSCs or POGLUT1 targets.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of POGLUT1 gene in reversing aging of skin fibroblasts. Background Art

[0002] Skin fibroblasts are the primary functional cells in the dermis, responsible for synthesizing and secreting extracellular matrix (ECM) components (such as type I and type III collagen, elastin, and hyaluronic acid), maintaining the skin's structural integrity, elasticity, and repair capacity. With aging or the accumulation of environmental stressors (such as ultraviolet radiation and oxidative stress), fibroblasts gradually enter a senescent state, characterized by stagnant proliferation, decreased synthetic function, and an altered secretory phenotype (SASP, senescence-associated secretory phenotype), leading to skin sagging, wrinkle formation, and decreased regenerative capacity.

[0003] In recent years, with the aging population, skin aging has garnered increasing attention. Current treatments for skin aging include topical antioxidants, laser therapy, chemical peels, and injectable fillers. These approaches primarily achieve anti-aging effects by promoting collagen synthesis, improving skin texture, or filling wrinkles. However, these treatments often have short-lived effects and may be associated with side effects, such as skin sensitivity, hyperpigmentation, and the risk of infection. In recent years, MSCs therapy has become a research hotspot in the anti-aging field due to its unique regenerative and repairing capabilities. MSCs possess multipotential differentiation, paracrine effects, and immunomodulatory properties, promoting skin cell regeneration, enhancing collagen synthesis, and improving the skin microenvironment. Studies have shown that MSCs, through the secretion of growth factors (such as EGF and FGF) and extracellular vesicles (EVs), significantly improve skin elasticity, reduce wrinkles, and improve hyperpigmentation. Compared to traditional anti-aging treatments, MSCs therapy offers advantages in long-term efficacy and safety. Furthermore, the immunomodulatory properties of MSCs can reduce inflammation, further delaying the aging process. In summary, MSCs therapy offers a new solution for skin aging. Its regenerative capacity and safety make it an important research direction in the future anti-aging field. However, the mechanism of action of MSCs in treating skin aging requires further investigation.

[0004] The present invention aims to provide a method for reversing aging of skin fibroblasts based on the POGLUT1 gene. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of the POGLUT1 gene in reversing aging of skin fibroblasts.

[0006] The purpose of the present invention is achieved by using the POGLUT1 gene to reverse the aging of skin fibroblasts by downregulating the expression of POGLUT1 in skin fibroblasts to regulate the Notch pathway, thereby reducing SA-β-Gal activity and the expression of aging marker genes p16, p21 and p53, reducing the number of cell apoptosis, and enhancing the anti-inflammatory ability of HSFs, thereby achieving the effect of reversing the aging of skin fibroblasts.

[0007] The present invention has the following beneficial effects: It discloses POGLUT1 as a core regulatory gene for MSCs to reverse skin aging, as well as its molecular regulatory network in the skin aging process through the Notch signaling pathway, elucidating the potential molecular mechanism by which MSCs reverse skin aging. This invention provides a new molecular target for the clinical treatment of skin aging-related conditions, a new theoretical basis for understanding the role of MSCs in skin aging, and an important experimental foundation for the clinical development of anti-aging treatment strategies based on MSCs or POGLUT1 targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 The infection status of plv-shPOGLUT1-HSFs at different MOIs in Example 1 (100×, Bar=200 μm); Figure 2 The results of lentiviral transfection in Example 1 are shown, where A is the lentiviral transfection efficiency under bright field and fluorescence field (40×, Bar=500μm); B is the relative expression level of POGLUT1 in HSFs; C is the POGLUT1 concentration in the supernatant of HSFs; (** represents P <0.01, **** represents P <0.0001); Figure 3 The results of SA-β-Gal activity detection of two groups of HSFs in Example 1, where A is SA-β-Gal staining (40×, Bar=500μm); B is the statistics of SA-β-Gal staining positive rate; **** represents P <0.0001; Figure 4 The HSFsTunel staining results in Example 1 (200×); in A, blue represents cell nuclei, red represents apoptotic cells (Bar = 50 μm), and B represents the mean fluorescence intensity; *** represents P <0.001; Figure 5 The relative expression levels of p16, p21, and p5 RNA in the two groups of HSFs in Example 1 (** represents P <0.01; **** represents P <0.0001); Figure 6 The concentrations of IL-4, IL-6 and IL-17 in the supernatants of two groups of HSFs cells were detected by Elisa in Example 1 (ns represents P >0.05, * represents P <0.05; **** represents P <0.0001); Figure 7 is the infection efficiency of HSFs at different MOIs in Example 2 (100×, Bar = 200 μm); Figure 8 Lentivirus transfection in Example 2 (40×), where A is the lentivirus transfection efficiency under bright field and fluorescence field (Bar = 500 μm); B is the relative expression level of POGLUT1 in HSFs; C is the POGLUT1 concentration in the supernatant of HSFs; (* represents P <0.05, **** represents P <0.0001); Figure 9 The relative expression of Notch1 protein in Example 3, where A is the WB protein band; B is the relative expression analysis of protein; Control group (Control): P4 generation HSF cells; Aging model group (Old-Modle): H2O2-induced senescent cells; Knockdown group (plv-shPOGLUT1): aging model group HSF cells transfected with plv-shPOGLUT1 lentivirus; Overexpression group (plv-POGLUT1): P4 generation HSF cells transfected with plv-shPOGLUT1 lentivirus (* represents P <0.05,** represents P <0.01); Figure 10 The results of SA-β-Gal activity detection of two groups of HSFs in Example 2, where A is the SA-β-Gal staining situation (100×, Bar=200μm); B is the statistical result of SA-β-Gal staining positive rate; Figure 11 The two groups of HSFs in Example 2 are stained with Tunel (200×), where blue in Figure A represents cell nuclei; red represents apoptotic cells (Bar = 50 μm); Figure B shows the comparison of mean fluorescence intensity (MFI) (*** represents P <0.001); Figure 12 is the relative expression level of p16, p21, and p5 RNA in the two groups of HSFs in Example 2 (ns represents P >0.05;* represents P <0.05; ** represents P <0.01); Figure 13 The concentrations of IL-4, IL-6, and IL-17 in the supernatants of two groups of HSFs cells were detected by Elisa in Example 2 (* represents P <0.05; ** represents P <0.01; **** represents P <0.0001); Figure 14 For Example 3 POGLUT1 、 Hes The relative expression of mRNA, where A is POGLUT1 Relative expression of mRNA; B is Hes Relative expression of mRNA; (ns represents P >0.05, * represents P <0.05, ** represents P <0.01, *** represents P <0.001, **** represents P <0.0001) Figure 15 The relative expression of NF-κB protein in Example 3, where A is the WB protein band; B is the relative expression analysis of protein; (* represents P <0.05, ** represents P <0.01); Figure 16 The immunohistochemical images of HSFs in Example 3 (200×, Bar=5m), where A is the immunohistochemical image; B is the statistical results of the p16, p21, and p53 protein positive cell rates; (* represents P <0.05,** represents P <0.01, *** represents P <0.001,**** represents P <0.0001); Figure 17 This is the differential detection of aging-related proteins in macaque skin tissue from Experimental Example 1. Figure A is a heat map of protein molecules in each group; Figure B is a volcano map of protein molecules that are significantly upregulated and downregulated after treatment; Figure 18 This is the Venn diagram of experimental example 1 showing that BMSCs treatment significantly reversed aging-related proteins in macaque skin; Figure 19 This is a box plot of aging-related proteins reversed after BMSCs treatment in Experimental Example 1; A shows 10 proteins that were upregulated with age and downregulated after treatment; B shows 2 proteins that were downregulated with age and upregulated after treatment; Figure 20The SA-β-Gal staining images of HSFs in Experimental Example 1 (100×); A shows the SA-β-Gal staining of HSFs treated with H2O2 at different time and concentrations, Bar = 200 μm; B shows the SA-β-Gal staining positive rate of HSFs in each group; (ns represents P >0.05, ** represents P <0.01, *** represents P <0.001, **** represents P <0.0001); Figure 21 For the aging gene in Experimental Example 1 p16, p21, p53 Relative RNA expression, control group (Control): P4 generation HSF cells, model group (Model): H2O2 induced senescent cell model (* represents P <0.05, ** represents P <0.01); Figure 22 Figure 1 shows the SA-β-Gal staining images of three groups of HSFs in Experimental Example 1 (100×). A shows the SA-β-Gal staining image of HSFs, Bar = 200 μm; B shows the statistical results of the positive staining rate of SA-β-Gal in HSFs (**** represents P < 0.0001). Figure 23 Tunel staining of HSFs in Experiment 1 (200×), where blue in Figure A indicates cell nuclei; red indicates apoptotic cells; Bar = 50 μm, and Figure B shows the comparison of mean fluorescence intensity (MFI); (**** represents P <0.0001); Figure 24 The relative expression levels of aging genes p16, p21, and p53 in the three groups of HSFs in Experimental Example 1; (ns represents P >0.05,* represents P <0.05,** represents P <0.01, **** represents P <0.0001); Figure 25 The expression levels of p16, p21, and p53 proteins in the three groups of HSFs in Experimental Example 1 (100×), where Figure A is immunohistochemical analysis, Bar = 100 μm; Figure B is the positive cell rate; (** represents P <0.01; *** represents P <0.001; **** represents P <0.0001); Figure 26The expression levels of p16, p21, and p53 proteins in HSFs of Experimental Example 1. Figure A is Western Blot analysis; Figure B is the comparison of relative protein expression (*** represents P <0.001; **** represents P <0.0001); Figure 27 The concentrations of inflammatory factors in the supernatants of HSFs of the three groups in Experimental Example 1 (ns represents P >0.05, * represents P <0.05, ** represents P <0.01, *** represents P <0.001, **** represents P <0.0001); Figure 28 Figure 1 shows the cell migration of experimental example 1, where Figure A shows the HSFs migration ability test (40×) Bar = 500 μm; Figure B shows the wound healing rate at 12 h and 24 h (* represents P <0.05, ** represents P <0.01, *** represents P <0.001); Figure 29 This is the statistical diagram of cell activity in Experiment 1; (* represents P <0.1, ** represents P <0.01) Figure 30 The following are the screening diagrams of candidate genes related to aging; Figure A shows the relative expression of candidate gene mRNA; Figure B shows the concentration of POGLUT1 in each group (ns represents P >0.05, * represents P <0.05, ** represents P <0.01, *** represents P <0.001**** represents P <0.0001). DETAILED DESCRIPTION

[0009] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments, but the present invention is not limited in any way. Any changes or improvements made based on the teachings of the present invention fall within the scope of protection of the present invention.

[0010] The present invention provides the use of the POGLUT1 gene in reversing the aging of skin fibroblasts. This application mainly regulates the Notch pathway by downregulating the expression of POGLUT1 in skin fibroblasts, thereby reducing SA-β-Gal activity and the expression of aging marker genes p16, p21 and p53, reducing the number of cell apoptosis, and improving the anti-inflammatory ability of HSFs, thereby achieving the effect of reversing the aging of skin fibroblasts.

[0011] Example 1 Effect of POGLUT1 knockdown on aging HSFs (1) Lentiviral knockdown vector construction and viral packaging: 1) Vector construction Three interference target sites (CCAGAACGAGATCCTCTCATT, GTCCAAGAGCTGTTACAATTT, GCTGCAAGTTTCCGGTTTAAA) and a negative control (TTCTCCGAACGTGTCACGT) (SEQ ID No. 29-32) were designed for the POGLUT1 gene. The lentiviral vector GV493 (pFU-GW-016) (purchased from Shanghai Gene Gene Technology Co., Ltd.) was digested with AgeI and EcoRI. The oligo-a and b chains were annealed and ligated, and then constructed into the viral vector using T4 ligase. The recombinant vector was verified to be correct by DNA sequencing: 2) Virus packaging: The viral vector was transfected into 293T cells using Lipofectamine 2000 (Invitrogen) along with two helper plasmids, psPAX2 and pMD2.G. The infectious lentivirus was harvested 72 hours after transfection, centrifuged, and the supernatant filtered through a 0.45 μm cellulose acetate filter. Fluorescence-activated cell sorting (FACS) was performed on GFP-positive 293T cells to determine viral titer, which was approximately 1E+9 TU / ml. The cells were then stored at -80°C.

[0012] (2) Cell transfection and transfection efficiency detection 1) Cell inoculation: HSFs cells from the model group were washed with physiological saline, digested with 0.25% trypsin, digested with culture medium, centrifuged, and the supernatant was discarded. The cells were then dispersed with 1 ml of complete culture medium and the cell suspension was diluted to a concentration of 3 × 10 4 10 μl was added to 96-well plates, with a total of 12 wells, of which 3 wells were used as control groups. The cells were cultured at 37°C for 24 h until the cell confluence reached 25%.

[0013] 2) Infection: dilute the virus to a titer of 1×10 8 TU / ml; 5×10 7TU / ml; 1×10 7 TU / ml (MOI = 100; MOI = 50; MOI = 10). Four groups were set up: control: 100 μl of complete medium; M group: 90 μl of complete medium, 10 μl of virus; A group: 86 μl of complete medium, 10 μl of virus, and 4 μl of HiTransG A infection solution; P group: 86 μl of complete medium, 10 μl of virus, and 4 μl of HiTransG P infection solution. Aspirate the medium from each well of a 96-well plate and add the appropriate amount of virus and infection enhancer solution according to the experimental design. Mix thoroughly with a pipette and then culture as usual. Replace the medium with complete medium 12 hours after infection.

[0014] 3) Confirmation of optimal infection conditions: Observe under a microscope 72 hours after infection. The infection conditions and MOI values ​​corresponding to the highest fluorescence expression abundance will serve as the basis for subsequent infection experiments.

[0015] 4) Analysis of transfected cells: The experiment was set up as a no-load group (plv-NC) and a POGLUT1 knockdown group (plv-shPOGLUT1) to detect transfection efficiency.

[0016] 5) qRT-PCR detection POGLUT1 Transfection efficiency: Primer sequences (SEQ ID No. 1-2) and annealing temperatures are shown in Table 1: Table 1 Amplification sequences and annealing temperatures of key molecular primers

[0017] 6) Elisa was used to detect the transfection efficiency of POGLUT1.

[0018] (3) Cell function verification 1) SA-β-Gal staining of HSFs.

[0019] 2) Tunel staining was used to detect cell apoptosis in HSFs.

[0020] 3) Detection of aging marker genes by qRT-PCR p16, p21, p53 Express.

[0021] 4) Elisa assay was used to detect the concentrations of IL-4, IL-6, and IL-17 in the HSF supernatant.

[0022] Test results: (1) Virus titer screening The HSFs of the aging model group were inoculated into a 96-well plate. According to the experimental design, the virus and the corresponding infection enhancement solution were added and mixed. The medium was changed 12 hours after infection. After 72 hours of infection, the cells were observed under a microscope and the infection conditions and MOI values ​​corresponding to the highest fluorescence expression abundance were selected as the subsequent experimental conditions. Figure 1 As can be seen, only a small amount of fluorescence was observed at MOI = 10 and MOI = 50, indicating low lentiviral transfection efficiency. The highest transfection efficiency was achieved at MOI = 100 in Group M. Therefore, Group M MOI = 100 was selected as the subsequent lentiviral transfection condition for evaluation.

[0023] (2) Transfection of skin fibroblasts with plv-shPOGLUT1 Skin fibroblasts of the aging model group were transfected with empty lentivirus (plv-NC), and skin fibroblasts of the aging model group were transfected with knockdown POGLUT1 Lentivirus (plv-shPOGLUT1), the results after transfection are as follows Figure 1 As shown, the transfection efficiency of the plv-NC group and the plv-shPOGLUT1 group reached more than 90% ( Figure 2 A); qRT-PCR results showed ( Figure 2 B) Compared with the plv-NC group, the relative expression level of POGLUT1 mRNA in the plv-shPOGLUT1 group was significantly downregulated ( P <0.0001); Elisa results showed ( Figure 2 C), the POGLUT1 concentration in the cell supernatant of the plv-shPOGLUT1 group was significantly lower than that of the plv-NC group ( P <0.01). Therefore, it was shown that the plv-shPOGLUT1 cell line was successfully constructed.

[0024] (3) Functional verification 1) Detection of SA-β-Gal activity in plv-shPOGLUT1 skin fibroblasts β-galactosidase staining was used to determine the positive rate of senescent cells. Figure 3 It can be seen that the positive rate of the plv-shPOGLUT1 group was significantly lower than that of the plv-NC group ( P <0.0001), and the results showed that knocking down POGLUT1 could reduce the activity of SA-β-Gal in skin fibroblasts.

[0025] 2) Apoptosis rate of plv-shPOGLUT1 skin fibroblasts Tunel was used to detect the apoptosis rate of cells in the plv-NC group and the plv-shPOGLUT1 group. Figure 4 As shown, a small amount of HSFs in the plv-NC group were stained red, while there were almost no red-stained apoptotic cells in the plv-shPOGLUT1 group, which was significantly different from the plv-NC group ( P <0.001). This indicates that knockdown of POGLUT1 can significantly inhibit HSFs apoptosis.

[0026] 3) plv-shPOGLUT1, a marker gene for senescence in skin fibroblasts p16, p21, p53 Expression The results of qRT-PCR detection of aging marker genes in the plv-NC and plv-shPOGLUT1 groups showed that ( Figure 5 ), plv-shPOGLUT1 group p16, p21, p53 The relative expression levels of RNA in the plv-NC group were significantly lower than those in the plv-NC group. P <0.0001, P <0.01, P <0.0001).

[0027] 4) Senescence-associated secretory phenotype of plv-shPOGLUT1 skin fibroblasts Elisa method was used to detect the concentration of inflammatory factors in the cell supernatant of plv-NC group and plv-shPOGLUT1 group. Figure 6 It can be seen that the concentration of anti-inflammatory factor IL-4 in the plv-shPOGLUT1 group was higher than that in the plv-NC group, but the results were not statistically different; the concentration of pro-inflammatory factor IL-6 in the plv-shPOGLUT1 group was significantly lower than that in the plv-NC group ( P <0.0001); the concentration of pro-inflammatory factor IL-17 in the plv-shPOGLUT1 group was significantly higher than that in the plv-NC group ( P <0.05) indicating that knockdown of POGLUT1 could enhance the anti-inflammatory ability of HSFs.

[0028] Example 2 Effect of overexpression of POGLUT1 on P4 generation HSFs Experimental methods: (1) Construction of lentiviral overexpression vector and viral packaging 1) Vector construction: Human POGLUT1 (NM_152305) was obtained from a cDNA library provided by Genechem (Shanghai, China) using the POGLUT1 forward primer: 5'-GAGGATCCCCGGGTACCGGTCGCCACCATGCTTCTGGCCATGGTC-3'; reverse primer: 5'-TCCTTGTAGTCCATACCTAGTTCAGTTTTCAACATTTTGGGAATAATTTG-3' (SEQ ID Nos. 3-4). The lentiviral vector plasmid GV492 (pGC-FU-LAG-CBh-gcGFP-IRES-puromycin) was digested with BamHI and AgeI restriction enzymes and cloned by in-fusion recombination. DNA sequencing confirmed the correctness of the recombinant vector.

[0029] 2) Virus packaging: The recombinant viral vector, along with two helper plasmids, psPAX2 and pMD2.G, was transfected into 293T cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The infectious lentivirus was harvested 72 hours after transfection, removed by ultracentrifugation, and sterilized by filtration through a 0.45 μm cellulose acetate filter. The viral titer was determined by quantitative PCR and was approximately 2.5E+9 TU / ml. The cells were stored at -80°C.

[0030] (2) Cell transfection and transfection efficiency detection The experiment was set up as an empty vector group (plv-NC) and a POGLUT1 overexpression group (plv-POGLUT1) to detect the transfection efficiency for subsequent experiments; (3) Cell function verification; Experimental results: (1) Virus titer screening The fourth generation HSFs were inoculated into a 96-well plate. According to the experimental plan, the virus and the corresponding infection enhancement solution were added to the plate and mixed thoroughly. After 12 hours of infection, the original culture medium in the plate was replaced with complete culture medium. After 72 hours of infection, the fluorescence expression abundance reached the highest value under the microscope. The corresponding infection conditions and MOI values ​​were used as the conditions for subsequent experiments. Figure 7 As can be seen, there was no fluorescence or only a small amount of fluorescence at MOI = 10 and MOI = 50, indicating that the lentiviral transfection efficiency was low. The transfection efficiency was highest at MOI = 100 in Group P. Therefore, MOI = 100 in Group P was selected as the subsequent lentiviral transfection condition for evaluation.

[0031] (2) Transfection efficiency of plv-POGLUT1 skin fibroblasts P4 generation skin fibroblasts were transfected with empty lentivirus (plv-NC) and P4 generation skin fibroblasts were transfected with POGLUT1 overexpressing lentivirus (plv-POGLUT1). Figure 8 As shown in A, the transfection efficiency of the plv-NC group and the plv-POGLUT1 group was above 90%; qRT-PCR results showed ( Figure 8 B) Compared with the plv-NC group, the expression of POGLUT1 in the plv-POGLUT1 group was significantly upregulated ( P <0.05); Elisa results showed ( Figure 8 C), the POGLUT1 concentration in the cell supernatant was significantly increased in the plv-POGLUT1 group compared with the plv-NC group ( P<0.0001). Therefore, it was shown that the plv-POGLUT1 cell line was successfully constructed.

[0032] (3) Functional verification 1) Detection of SA-β-Gal activity in plv-POGLUT1 skin fibroblasts The positive rates of senescent cells in the plv-NC and plv-POGLUT1 groups were detected by SA-β-Gal activity. Figure 10 It can be seen that the positive rate of the plv-POGLUT1 group was significantly higher than that of the plv-NC group ( P <0.001), suggesting that overexpression of POGLUT1 can increase SA-β-Gal activity in skin fibroblasts.

[0033] 2) Apoptosis rate of plv-POGLUT1 skin fibroblasts The cell apoptosis in the plv-NC and plv-POGLUT1 groups was detected by Tunel method. No or only a small amount of HSFs in the plv-NC group were stained red, while a large amount of HSFs in the plv-POGLUT1 group were stained red ( Figure 11 ), which was significantly different from the plv-NC group ( P <0.001). This indicates that overexpression of POGLUT1 can significantly promote HSF apoptosis.

[0034] 3) plv-POGLUT1, a marker gene for senescence in skin fibroblasts p16, p21, p53 Expression Detection of plv-NC group and plv-POGLUT1 group by qRT-PCR p16, p21, p53 The relative expression of mRNA. Figure 12 As shown, HSFs in the plv-POGLUT1 group p16 The relative expression of genes was higher than that in the plv-NC group, but the results were not statistically different; HSFs in the plv-POGLUT1 group p21 The relative expression of genes was significantly higher than that of the plv-NC group ( P <0.05); HSFs in the plv-POGLUT1 group p53 The relative expression of genes was significantly higher than that of the plv-NC group ( P <0.01).

[0035] 4) Senescence-associated secretory phenotype of plv-POGLUT1 skin fibroblasts The concentrations of inflammatory factors in the cell supernatants of the plv-NC group and the plv-POGLUT1 group were detected by ELISA. Figure 13 It can be seen that the concentration of anti-inflammatory factor IL-4 in the plv-POGLUT1 group was significantly lower than that in the plv-NC group (P <0.05); the concentration of pro-inflammatory factor IL-6 in the plv-POGLUT1 group was significantly higher than that in the plv-NC group ( P <0.0001); the concentration of pro-inflammatory factor IL-17 in the plv-POGLUT1 group was significantly higher than that in the plv-NC group ( P <0.01).

[0036] Example 3 Study on the mechanism of POGLUT1 reversing aging of skin fibroblasts Experimental methods: (1) qRT-PCR detection POGLUT1、Hes Relative expression of mRNA: Primer sequences (SEQ ID No. 1-2 and 5-6) and annealing temperatures are shown in Table 2: Table 2 Primer amplification sequences and annealing temperatures of key regulatory factors

[0037] (2) Western blot detection of Notch1 and NF-κB protein expression; (3) IHC detection of p16, p21, and p53 protein expression; Experimental results: 1. Skin Fibroblasts POGLUT1、Hes Relative expression of mRNA POGLUT1 modifies NOTCH receptors through glycosylation to ensure their normal folding, transport and signal transduction. Hes is a downstream target gene of NOTCH. Hes plays a key role in cell differentiation and participates in feedback regulation. POGLUT1, NOTCH pathway and Hes jointly regulate cell fate determination and tissue development. qRT-PCR was used to detect skin fibroblasts in the control group, aging model group, plv-POGLUT1 group and plv-shPOGLUT1 group. POGLUT1、Hes Relative mRNA expression levels (control group (Control): P4 HSF cells; aging model group (Old-Modle): senescent cells induced by H2O2; knockdown group (plv-shPOGLUT1): aging model group HSF cells transfected with plv-shPOGLUT1 lentivirus; overexpression group (plv-POGLUT1): P4 HSF cells transfected with plv-shPOGLUT1 lentivirus); from Figure 14 It can be seen that compared with the control group, the aging model group POGLUT1 and Hes The relative expression levels of P <0.001, P <0.05, plv-POGLUT1 group POGLUT1 and HesThe relative expression levels of P <0.01, P <0.0001); compared with the aging model group. plv-shPOGLUT1 group POGLUT1 The expression level was significantly reduced ( P <0.001), Hes The expression level was decreased but the result was not significant ( P >0.05).

[0038] 2. Expression of Notch1 protein in skin fibroblasts POGLUT1 can cause diseases by affecting the Notch signaling pathway and interacting with microRNA. In mammals (including humans), four receptors, Notch 1, 2, 3, and 4, have been found. The expression of Notch 1 protein was detected by WB, and the results showed that ( Figure 9 ) Compared with the control group, the histone expression in the aging model was significantly increased ( P <0.001), and the overexpression group was significantly increased ( P <0.05); compared with the aging model group, the expression of knockdown histones was significantly reduced ( P <0.05), indicating that aging is closely related to Notch1 protein expression, and knockdown of POGLUT1 can downregulate Notch1 protein expression. POGLUT1 deficiency can reduce Notch1 receptor ligand binding, thereby inhibiting the Notch1-mediated Notch signaling pathway.

[0039] 3. Relative expression of NF-κB protein in skin fibroblasts NF-κB, as a type of transcription factor, regulates the expression of genes related to inflammation, immune response, cell survival, and proliferation. It affects NOTCH signaling by regulating the expression of NOTCH ligands (such as Jagged1, Delta-like 1) or receptors (Notch 1, 2, 3, 4). In inflammatory responses, NF-κB activation can upregulate the expression of NOTCH ligands and enhance NOTCH signaling. NF-κB protein expression was detected using Western blotting. The results are as follows: Figure 15 As shown, the relative expression of NF-κB protein in the aging model group and the plv-POGLUT1 group was significantly increased compared with the control group ( P <0.01, P <0.05)); the relative expression of NF-κB protein in the plv-shPOGLUT1 group was significantly decreased compared with the aging model group ( P <0.05).

[0040] 4. Expression of p16, p21, and p53 proteins in skin fibroblasts p16, p21, and p53 play a key role in cell senescence. NOTCH signaling affects the aging process by regulating these proteins. IHC was used to detect the expression of p16, p21, and p53 proteins. The results are as follows: Figure 16 As shown in Figure 2, the relative expression levels of p16, p21, and p53 proteins in the aging model group were significantly increased compared with the control group ( P <0.05, P <0.001, P <0.01); compared with the control group, the relative expression levels of p16, p21, and p53 proteins in the plv-POGLUT1 group were significantly increased ( P <0.001, P <0.0001, P <0.01); compared with the aging model group, the relative expression levels of p16, p21, and p53 proteins in the plv-shPOGLUT1 group were significantly decreased ( P <0.001, P <0.01, P <0.001). These results indicate that POGLUT1 can reverse skin aging through the Notch signaling pathway.

[0041] In summary, downregulating POGLUT1 expression in skin fibroblasts can reduce SA-β-Gal activity and the expression of aging marker genes p16, p21, and p53, decrease cell apoptosis, and enhance the anti-inflammatory capacity of HSFs, thereby reversing skin fibroblast aging. Experimental Example 1: Validation of POGLUT1 as a key regulatory gene for bone marrow mesenchymal stem cells (BMSCs) in regulating macaque skin aging.

[0042] 1. Materials 1.1 Animal Source The Kunming Institute of Zoology, Chinese Academy of Sciences, provided experimental macaques, including five juvenile macaques, aged 3 years, weighing (3.64 ± 0.45) kg; four young macaques, aged 7–8 years, weighing (4.46 ± 0.55) kg; four elderly macaques, aged 23–27 years, weighing (5.37 ± 0.99) kg; and six elderly therapeutic macaques, aged 23–27 years, weighing (5.40 ± 0.53) kg. All experimental animals were maintained under specific environmental conditions: a temperature of 22–25°C, a humidity of 55–65%, simulating a natural day-night cycle, and a 12-hour light cycle. The animals were housed in the animal laboratory of the 920th Hospital of the Joint Logistics Support Force of the Chinese People's Liberation Army. The laboratory's sanitary conditions meet the standards, and the relevant licensing and approval procedures are complete, meeting the environmental standards for animal husbandry. The experimental animal production license number is SCXK (Yunnan) K2017-0003, the experimental animal use license number is SYXK (Military) 2012-003, and the experimental animal ethics approval number is Lunshen 2019-032 (Ke)-01.

[0043] 1.2 Cell line source Bone marrow mesenchymal stem cells (BMSCs) from infant macaques and human umbilical cord mesenchymal stem cells (hUCMSCs) were supplied by the cell bank of the 920th Hospital of the Joint Logistics Support Force of the People's Liberation Army, a registered institution for stem cell clinical research. Human skin fibroblasts (HSFs) were purchased from Auris Biotech (Shanghai) Co., Ltd. These cells have been tested and confirmed to have passed mycoplasma detection procedures and have positive short tandem repeat (STR) identification results.

[0044] 2. Experimental methods 2.1 Proteomic analysis of macaque skin tissue 2.1.1 Animal grouping The macaques were divided into a juvenile group (5), a young-adult group (5), an elderly group (4), and an elderly-treated group (6). After 7 days of routine feeding, the 10 naturally aged macaques showed no abnormalities in their physical condition. Six of them were selected and infused with juvenile macaque BMSCs via femoral vein. The infusion dose was set at 1×10 7 cells / kg, infused once a day for three consecutive infusions.

[0045] 2.1.2 DIA quantitative proteomic analysis (1) Total protein extraction Macaque skin tissue samples from each group were removed from a -80°C freezer, placed in a tube along with grinding beads, and then ground in a grinder at 4°C. An appropriate amount of SDT solution was added based on the amount of macaque skin tissue, followed by DTT at 1 / 100 the volume of SDT. The samples were vortexed to mix thoroughly and then placed in an ice-water bath for 5 minutes of sonication to ensure complete lysis. After lysis, the samples were incubated at 95°C for 8 to 15 minutes. After the reaction, they were quickly removed and cooled in an ice bath for 2 minutes. The supernatant was then centrifuged and IAM solution was added to the resulting solution. The solution was then wrapped in foil and allowed to react for 1 hour in the dark. Acetone was then added and the solution was allowed to settle for 2.5 hours. The solution was then centrifuged, the supernatant discarded, and the precipitate collected. The precipitate was resuspended in acetone, centrifuged, collected, and air-dried to obtain the total protein. The total protein was dissolved in an appropriate amount of DB buffer for subsequent experiments.

[0046] (2) Protein test Protein concentrations of macaque skin protein solutions from each group were determined using the BCA protein concentration assay kit (Abbkine KTD3001) according to the manufacturer's instructions. Protein concentrations of macaque skin tissue samples from each group were calculated. Samples were loaded and subjected to SDS-PAGE gel electrophoresis, stained with Coomassie Brilliant Blue, and then destained until clear bands were visible.

[0047] (3) Proteolysis When processing a protein sample, the first step is to remove the protein sample and add DB protein dissolution buffer to the sample, bringing the total volume to 100 μl. Trypsin and 100 mM TEAB buffer are added, mixed, and the digestion reaction is carried out at 37°C for 4 hours. After the 4-hour reaction, trypsin and CaCl2 are added again to continue the digestion reaction overnight. Once the digestion is complete, formic acid is added, the pH is adjusted to <3, the sample is mixed again, and the sample is centrifuged at room temperature. After centrifugation, the supernatant is carefully removed and the sample is passed through a C18 desalting column at a slow flow rate. The desalting column is then washed three times in a row with the wash buffer. The filtrate is then eluted with the eluent and the filtrate is collected and lyophilized.

[0048] (4) Construction of DDA spectral library 1) Fraction separation.

[0049] Prepare mobile phases A and B separately. After the solutions are prepared, measure an appropriate amount of solution A and pipette it into a 15ml centrifuge tube to mix the lyophilized powder. The resulting solution is then placed at room temperature and centrifuged. After centrifugation, the resulting solution is analyzed using an L-300PLC system. Set the column temperature of the Waters BEH column to 45°C, and perform gradient elution. During elution, collect one tube per minute, and finally combine the collected solutions into four fractions. Each of the four fractions is lyophilized. Once lyophilization is complete, add an appropriate amount of 0.1% formic acid to each fraction for dissolution.

[0050] 2) DDA mode liquid quality inspection Prepare mobile phases A and B in sequence. For each fraction, accurately extract 4 μg of supernatant, add 0.8 μl of iRT reagent, and mix thoroughly. Divide each mixture into two equal portions, taking half the volume from each for subsequent on-machine testing. For on-machine testing, perform elution via liquid chromatography. Use a Nanospray Flex™ (ESI) ion source coupled to a mass spectrometer. Set the appropriate parameters, adjust the voltage, and set the temperature. Use data-dependent acquisition (DDA) mode on the mass spectrometer to determine the primary mass spectrometry resolution. During a full scan, screen and fragment the top 40 parent ions for ion intensity, then perform secondary mass spectrometry detection. Generate raw data (.raw).

[0051] (5) DIA mode liquid quality detection Mobile phases A and B must be prepared in advance. For each sample, accurately extract 4 μg of supernatant and add 0.8 μl of iRT reagent. After thorough mixing, divide the mixture into two equal portions, taking half of each volume for testing. Before testing, carefully set all test parameters to ensure proper instrument operation. Once the test is complete, raw mass spectrometry data will be generated in the ".raw" format.

[0052] (6) Data analysis 1) Protein identification and quantification Using the search software Spectronaut - Pulsar (Biognosys), we searched the protein database against the DDA scan mode data. We set search parameters, filtered the search results, and performed FDR validation, retaining only credible peptides and proteins with an FDR below 1%.

[0053] DIA data is entered into the database search software, which references the DDA database built by Pulsar. During the analysis process, ion pair chromatographic peaks are first extracted, followed by product ion matching. Once matching is complete, peak areas are calculated. This series of operations enables simultaneous qualitative and quantitative analysis of peptides.

[0054] 2) Analysis of aging-related proteins and differentially expressed proteins: First, the quantitative proteomics data were screened, i.e. proteins expressed in less than 50% of samples were removed, and then the KNN algorithm was used to fill in the data. R software was used to perform regression analysis on macaque skin proteomics data (young, young, and old) to obtain proteins that changed significantly with age ( P <0.05). T-test was then used to statistically analyze the protein expression levels of the elderly treatment group VS the elderly group, and proteins with significant differences between the elderly treatment group and the elderly group were defined as differentially expressed proteins ( P <0.05, |logC|>1; DEP). Finally, the aging-related proteins and the treatment differentially expressed proteins were intersected to obtain proteins whose expression changed with age but was reversed after treatment, and these proteins were used as candidate genes for subsequent experimental verification.

[0055] 2.2 Establishment and evaluation of skin fibroblast aging model 2.2.2 Establishment of skin fibroblast aging model (1) Cell recovery and fluid replacement: Take out the HSFs cryopreservation tube from the liquid nitrogen tank of the cell bank, and place it in a 37℃ constant temperature water bath prepared in advance with tissue forceps to quickly melt the liquid in the cryopreservation tube. Use sterile gauze to dry the outside of the cryopreservation tube and spray and wipe it with 75% alcohol for disinfection. Then, pass the transfer window into the sterile cell room and place it on the operating table. Use a Pasteur pipette to transfer the cryopreservation solution to a centrifuge tube, centrifuge at 1200r for 5 minutes, discard the supernatant, add 1ml of DMEM / F12 complete culture medium, blow off the cell sediment in the centrifuge tube and place it in a culture flask, and then use a pipette to measure 15ml of culture medium and transfer it into the T 75 Culture flasks and culture in an incubator. 75 The culture flask was removed from the incubator and observed under a microscope. The cells were observed to be in good adherent growth condition. The culture flask was then sprayed and wiped with 75% alcohol for disinfection and placed on a sterile operating table. The original culture medium was poured out and the flask was washed once with normal saline. The liquid in the flask was completely poured out. A small amount of remaining liquid that could not be poured out was aspirated with a Pasteur pipette and then added with DMEM / F12 complete culture medium.

[0056] (2) Cell passage: Take out the cell culture flask from the 37℃ cell culture incubator, spray it with 75% alcohol for disinfection, wipe the culture flask with sterile gauze, and observe the cells growing attached to the wall under an optical microscope. When the degree of fusion is about 90%, discard the original culture medium, add physiological saline to cover the bottom of the flask and wash twice, pour out the liquid in the flask, and use a pipette to suck out the residual liquid at the bottle mouth, then add 0.25% trypsin to cover the amount of cells at the bottom of the flask, spray it with 75% alcohol for disinfection, put it in the incubator for digestion for 1 minute, and then observe it under a microscope. After observing that the cells are shrinking and bright, tap the culture flask and observe it under a microscope again. It is found that the cells have fallen off and floated in the culture medium, and then add 2-3 times the amount of trypsin in DMEM / F12. Complete medium was used to terminate digestion, centrifuged, and the supernatant was discarded. Complete medium was added to the suspension, and the cells were resuspended. The Aubrey counting plate and coverslip were wiped with alcohol. Then 10 μl of cell suspension was taken to rinse the pool on one side of the Aubrey counting plate for counting, and another 10 μl of cell suspension was taken to rinse the pool on the other side of the Aubrey counting plate for counting. Then, the volume of cell suspension required was calculated according to the subsequent experimental plan, and the cells were inoculated into culture plates or culture bottles, and then cultured in an incubator.

[0057] (3) H2O2 induced cell senescence: After cell counting, the cell concentration was adjusted to 5×10 3 pieces / cm 3 , inoculated into six-well plates, and placed in an incubator for culture. Observe cell growth. When the cell confluence is approximately 70%, mix 990 μl of complete culture medium and 10 μl of 3% H2O2 solution. The H2O2 concentration is now 8.82093 μM. Calculate the final H2O2 concentrations of 0 μM, 50 μM, 100 μM, 150 μM, 200 μM, and 250 μM. The required diluted H2O2 solution is 0 μl, 11.34 μl, 22.67 μl, 34.01 μl, 45.35 μl, and 56.68 μl, respectively. Discard the original culture medium in the six-well plate and add the calculated H2O2 solution of each concentration to each well. Add complete culture medium to each well until the volume is 2 ml. Mix thoroughly and place in a cell culture incubator for induction according to the experimentally designed induction time.

[0058] (4) SA-β-Gal staining of HSFs: SA-β-Gal staining was performed on HSFs cultured in six-well plates at H2O2 concentrations of 0μM, 50μM, 100μM, 150μM, 200μM, and 250μM for 24h, 48h, 72h, and 96h. After removing the culture medium from each well of the six-well plate using a 1000μl pipette, PBS was added to wash the wells with a Pasteur pipette. 1ml of fixative solution was then added to each well, wrapped with tin foil, and fixed at room temperature in the dark for 1min. After washing with PBS, a staining working solution (Solution A: Solution B: X-Gal solution = 94:1:5) was prepared. 1ml of the prepared staining working solution was added to each well, the lid was closed, and the edges of the six-well plate were sealed with sealing film to prevent the staining solution in the six-well plate from evaporating and drying. Subsequently, the six-well plate was placed in a 37°C incubator and incubated overnight in the dark. After incubation, the staining conditions were observed under a microscope and corresponding images were collected.

[0059] (5) qRT-PCR detection of HSFs p16, p21, p53 Gene expression levels 1) Total RNA Extraction: Discard the culture medium, wash twice with saline, trypsinize, and centrifuge. Collect the HSF pellets from the control and model groups. Control group (control): P4 HSF cells; Model group (model): H2O2-induced senescence cell model. Use a 1000μl pipette to pipette 750μl of Buffer RLF into a centrifuge tube and repeatedly pipette the cell pellet to fragment the DNA. Place a genomic DNA filter cartridge in a collection tube, transfer the cell lysate to the cartridge, and centrifuge at 14,000×g. Discard the cartridge and add 750μl of 70% ethanol to the collection tube and mix thoroughly. Place an RNase-Free Rapid Pure RNA Adsorption Column in the collection tube, transfer the mixture from the collection tube to the cartridge, and centrifuge. Discard the waste solution and return the cartridge to the collection tube. Pipette 500μl of Buffer RW into the cartridge, centrifuge, discard the waste solution, and return the cartridge to the collection tube. Then, add 500 μl of Buffer RW2 to the adsorption column, centrifuge, discard the waste liquid, and return the adsorption column to the collection tube (repeat once). Centrifuge, discard the waste liquid, and let the adsorption column stand for 10 minutes to air-dry the liquid inside the adsorption column. After drying, place the adsorption column in a new collection tube. Add 20 μl of enzyme-free water, incubate at room temperature for 2 minutes, and centrifuge to obtain the RNA solution. The concentration of each RNA solution sample was determined using a nucleic acid micro-quantitator.

[0060] 2) RNA reverse transcription: reaction system configuration

[0061] Incubate at 50°C for 15 min, incubate at 85°C for 5 sec, and place on ice.

[0062] 3) qRT-PCR reaction system

[0063] Place the eight-tube strip into the gene amplification instrument and set the reaction program 95℃30s; (95℃10s-60℃30s)40cycles, 4℃-∞.

[0064] The primer amplification sequences (SEQ ID No. 7-14) and annealing temperatures are shown in Table 1 .

[0065] Table 1 Primer amplification sequences and annealing temperatures

[0066] 2.3 Establishment of a co-culture system of MSCs and senescent HSFs 2.3.1 Establishment of a co-culture system of MSCs and senescent HSFs (1) Resuscitate P4 hUCMSCs. When the cell confluence reaches 90%, discard the original culture medium, wash with PBS, and digest with trypsin. Discard the culture medium. Centrifuge, discard the supernatant, and use a pipette to remove any remaining liquid at the tip of the centrifuge tube. Subsequently, add 1 ml of culture medium to resuspend the cells, count them, and set aside the resulting cell suspension for subsequent experimental operations.

[0067] (2) According to the experimental plan, the counted HSFs were plated onto the lower chamber of a 6-well Transwell plate. A control group (Control): P4 HSF cells; a model group (Model): H2O2-induced senescent cell model; and a co-culture group (Co-culture): hUCMSCs co-cultured with senescent cells. When the cell confluence in the co-culture group reached 60%, the supernatant was discarded and 1 ml of complete culture medium was added to each well. The hUCMSCs suspension diluted according to the experimental plan (mesenchymal stem cells: skin fibroblast ratio of 1:1) was injected into the upper chamber of the Transwell and cultured for 72 h.

[0068] (3) SA-β-Gal staining of HSFs: HSFs from the control group, model group, and co-culture group were stained. After sealing with sealing film, the six-well plate was placed in a 37°C incubator and incubated overnight. The staining of HSFs was observed under a microscope, and images were collected. The positive cell rate was then calculated using imageJ software.

[0069] (4) Tunel staining to detect cell apoptosis in HSFs: 1) Cell Slides: For HSFs in the control, model, and co-culture groups, discard the supernatant and wash with saline. Subsequently, digest the cells with trypsin and terminate the digestion with culture medium. Centrifuge the cells. After centrifugation, add 1 ml of culture medium to resuspend the cells and count them. Add 10 μl of complete culture medium to the designated placement of the slide in a six-well plate, allowing the slide to adhere to the bottom of the plate. Place the slide in the well. Add 200 μl of cell suspension to a 24 mm cell slide. Once the cells have adhered, add 2 ml of complete culture medium.

[0070] 2) Fixation: Discard the original culture medium and use a 1000μl pipette to aspirate 2ml of cell fixative solution. Let it stand at room temperature for 15 minutes, then discard. Use a Pasteur pipette to aspirate PBS and wash the cell slides in the six-well plate three times, each time for 5 minutes.

[0071] 3) Cell membrane permeabilization: Carefully remove the cell slide from the six-well plate, shake dry, and place on a coverslip. Use a pipette to draw 100 μl of membrane permeabilization solution and drop it into the circle drawn by the histochemical pen. Incubate at room temperature for 20 minutes and then wash with PBS.

[0072] 4) Add reaction solution: Mix TdT and dUTP reagent in a ratio of 1:9, add to the circle, place the well plate in a humidified chamber, and incubate at 37°C.

[0073] 5) DAPI counterstaining of cell nuclei: Wash the cell slides from the control, model, and co-culture groups three times with PBS, each wash lasting 5 minutes. After aspirating the PBS from the slides with a pipette, add a drop of DAPI staining solution to the circle marked with a histochemical pen and incubate at room temperature in the dark for 10 minutes.

[0074] 6) Sealing: Wash the cell slides from the control, model, and co-culture groups with PBS three times using a Pasteur pipette, each for 5 minutes. Gently shake off the liquid on the slides and seal them on a glass slide.

[0075] 7) Microscopic Examination, Photography, and Statistical Analysis: Cell slides from the control, model, and co-culture groups were observed under a fluorescence microscope and images were collected. Cell nuclei appeared blue, while nuclei of apoptotic cells appeared red. Statistical analysis of the collected images was performed using ImageJ software.

[0076] (5) qRT-PCR detection of HSFs p16, p21, p53 Relative mRNA expression level: The specific operation method is the same as 2.2.2(5).

[0077] (6) Detection of p16, p21, and p53 expression levels in HSFs by immunohistochemical staining 1) Cell climbing, fixation, and membrane disruption.

[0078] 2) Serum blocking: Add 3% BSA to the histochemical circle and block for 30 minutes.

[0079] 3) Incubation with primary antibodies: Pour off the serum blocking solution and pipette p16, p21, or p53 primary antibodies diluted 1:100 into the cell well plate. Place the cells in a humidified chamber and incubate overnight on a shaker at 4°C.

[0080] 4) Incubation with secondary antibody: Wash the slides in the six-well plate three times with PBS using a Pasteur pipette, each time for 5 minutes. Gently shake dry. Add secondary antibody diluted in antibody diluent to the wells until it covers the cells and incubate at room temperature.

[0081] 5) DAB staining: Wash three times with PBS using a Pasteur pipette, 5 minutes each time. After gently shaking dry, add freshly prepared DAB staining solution to the circle. Rinse the sections with water to terminate the staining.

[0082] 6) Re-staining the cell nucleus: Use a Pasteur pipette to add hematoxylin for re-staining, then wash with water; then add hematoxylin to differentiate, and wash with water; finally, add hematoxylin bluing solution to turn the cell nucleus blue, and wash with water.

[0083] 7) Dehydration and sealing: Dehydrate and seal with neutral gum (the cell side of the coverslip faces down).

[0084] 8) Microscopic examination, image scanning, and imageJ analysis.

[0085] (7) Western blot was used to determine the expression of p16, p21, and p53 proteins in HSFs.

[0086] 1) Total cell protein extraction Wash T with PBS 75 Culture the adherent cells in the flask for 3 times. Press RIPA: cocktail: PMSF = 100:2:1 at T 75 Add an appropriate amount of lysis buffer to the culture flask. Use a Pasteur pipette to transfer the cell lysis buffer to a centrifuge tube. Lyse the cells on ice for 30 minutes. Centrifuge at 4°C for 10 minutes and transfer the supernatant to an EP tube.

[0087] 2) Protein concentration determination: Take the protein solutions of the control group, model group, and co-culture group and determine the protein concentration according to the instructions of the BCA protein concentration assay kit (Abbkine KTD3001).

[0088] 3) Protein denaturation: Mix the measured protein solution and 5× loading buffer in a ratio of 4:1 and add them to a 1.5 ml EP tube. Mix thoroughly with a 1000 μl pipette and denature in a metal bath at 100°C for 10 min.

[0089] 4) 12% SDS-PAGE electrophoresis ① Install the 12% SDS-PAGE precast gel into the electrophoresis tank, add electrophoresis solution, check for leakage, and add electrophoresis solution to the inner tank until it is full and overflows to 1 / 3 of the outer tank; ② Sample loading: Remove the comb from the precast gel and load samples in the order of "3 μl protein marker, 20 g control protein solution, 20 g model histone solution, 20 g co-culture histone solution, and 3 μl protein marker." Once loading is complete, begin electrophoresis. Maintain a constant voltage of 185 V for 25 minutes. Stop electrophoresis when bromophenol blue reaches approximately 1 cm from the bottom. ③ Transfer: Prepare two PVDF membranes. Activate the membranes in an incubation box containing anhydrous ethanol for 2 minutes before use. Pour the transfer solution into a tray and place the transfer clip in the transfer cassette. Spread the transfer clip open and place the filter paper-free sponge, gel, PVDF membrane, and filter paper-free sponge on one side of the black transfer clip in that order. Secure the transfer clip, pour the transfer solution in, and transfer the membranes at a constant current of 400 mA for 0.5 hours. ④ Blocking: Wash the transferred PVDF membrane quickly with TBST once, then place it in the incubation box, and then use a 5ml pipette to add protein-free rapid blocking solution into the incubation box and block for 10 minutes; ⑤ Incubate with primary antibody: In a 15ml centrifuge tube, dilute GAPDH (1:3000), p16 (1:500), p21 (1:500), and p53 (1:500) primary antibodies with primary antibody diluent and prepare them in a 15ml centrifuge tube for later use. Use a 5ml pipette to remove the protein-free rapid blocking solution in the incubation box. After a quick wash with TBST, pour in the prepared primary antibody and incubate on a shaker at 4°C overnight. ⑥ Incubate with secondary antibody: Recover the primary antibody in the incubation box, use a 5ml pipette to aspirate TBST for washing, dilute the secondary antibody (1:3000) in a 15ml centrifuge tube with secondary antibody diluent, and pour into the incubation box for incubation for 30 minutes; ⑦ Chemiluminescence: Mix ECL A and B solutions in a 1:1 ratio and set aside. Pour the luminescent solution into the incubation box. Use tissue forceps to gently pick up the PVDF membrane and place it in the incubation box to soak it. Then place it in a culture dish. Place the culture dish in the chemiluminescence instrument to start chemiluminescence. After exposure is completed, collect images.

[0090] (8) Elisa assay to detect IL-4, IL-6, and IL-17 concentrations in HSFs supernatant 1) Sample collection: T 75 The supernatant of skin fibroblasts in the control group, model group, and co-culture group was transferred to a 15 ml centrifuge tube, centrifuged at 1200 rpm for 10 min, and the supernatant was aspirated for subsequent detection.

[0091] 2) Add samples and antibodies: Set up standard wells, test sample wells, and blank wells for sample addition. Dilute the antibody and add 50 μl to each well. Seal the plate with film, incubate for 2 hours, and wash.

[0092] 3) Add SA-HRP: Dilute SA-HRP to the working concentration, add 1× SA-HRP working solution to each well, incubate for 25 minutes, and wash the plate.

[0093] 4) Color development: Add 90 μl of TMB substrate solution to each well and develop the color for 20 min at room temperature in the dark.

[0094] 5) Add stop solution: Add 50 μl of stop solution to each well.

[0095] 6) Reading: Measure the absorbance at a wavelength of 450 nm using a spectrophotometer.

[0096] (9) HSF cell migration ability test: Cells from the control group, model group, and co-culture group were seeded into six-well plates. After the cells adhered to the plate, the original culture medium was discarded. A 200 μl pipette tip was used to vertically scratch the bottom of the six-well plate along a ruler. The plate was then rinsed with physiological saline to remove the adherent cells that were scratched. Serum-free DEME / F12 medium was then added. Images of the cells in each group were collected at three time points: 0, 12, and 24 h, and analyzed using Image J software.

[0097] (10) HSFs activity monitoring: 10 μl of diluted HSFs cell suspension from the control, model, and co-culture groups was added to each well of a 96-well plate. After shaking, the cells were placed in a cell culture incubator for 24 h. 10 μl of CCK-8 solution was then added to each well and the cells were incubated in the incubator. Finally, the absorbance at a wavelength of 450 nm was measured using a microplate reader, and the cell viability was calculated based on this.

[0098] 2.4 Key gene screening (1) qRT-PCR detection of the expression of the corresponding genes of the candidate proteins: the primer sequences (SEQ ID No. 1-2 and 15-28) and annealing temperatures are shown in Table 2: Table 2 Candidate factor primer amplification sequences and annealing temperatures

[0099] (2) Elisa assay was used to detect the POGLUT1 concentration in HSFs supernatant.

[0100] 2.5 Statistical analysis All statistical data of this experiment were analyzed using Graphpad Prism 10.1.2 statistical analysis software. For comparisons between two groups of data, independent-samples t-test was used; for comparisons between three or more groups of data, one-way ANOVA was used. P When the value was <0.05, the difference was considered statistically significant.

[0101] Experimental results: 1. Protein changes in MSCs against macaque skin aging To explore the molecular mechanism and key regulatory molecules of BMSCs in reversing skin aging, this study screened important functional proteins through proteomics analysis. Using regression analysis, 350 proteins with significant differences in age were screened ( P <0.05) proteins, which are aging-related proteins; 108 proteins with significant differences ( P <0.05, |logC|>1) are proteins with differential expression before and after treatment. The protein expression of each group is shown in Figure 17 A, 66 were upregulated and 42 were downregulated after treatment ( Figure 17 B).

[0102] The aging-related proteins analyzed were intersected with the differentially expressed proteins before and after treatment, ultimately identifying 18 proteins. These 18 proteins showed significant differences with age, and their protein expression was significantly reversed after BMSCs treatment ( Figure 18 ), the specific expression levels are detailed in Table 3. Among these 18 proteins, 10 proteins were originally upregulated with age and downregulated after stem cell treatment; 2 proteins were originally downregulated with age and upregulated after stem cell treatment ( Figure 19 In addition, there were 6 proteins whose expressions showed no obvious pattern among the different groups.

[0103] Table 3 Senescence-related proteins reversed after BMSCs treatment

[0104] 2. Establishment and evaluation of skin senescence cell model 2.1 S-β-Gal activity assay When senescence-specific β-galactosidase performs its catalytic function, X-Gal as a substrate generates a blue product. Under the microscope, senescent cells can be observed to be stained blue. As the H2O2 concentration increases and the staining incubation time prolongs, the staining positive rate gradually increases. The staining positive rate reaches the highest under the condition of H2O2 200μM concentration. There is no significant difference in the staining positive rate under the condition of 250μM concentration and 200μM concentration. However, HSFs show slow growth and death. There is no significant difference in the staining incubation time of 72h and 96h under the condition of 200μM concentration ( Figure 20 Therefore, 200 μM treatment for 72 h was used as the evaluation condition for the subsequent senescent cell model.

[0105] 2.2 Aging marker genes p16, p21, p53 Expression The qRT-PCR method was used to detect the expression of aging marker genes in the control group and the model group. Figure 21 As can be seen from the figure, in the model group p16 The expression of P <0.01); p21 The expression of P <0.01); p53 The expression of P <0.05).

[0106] 3. In vitro verification of the anti-skin aging effect of mesenchymal stem cells 3.1 SA-β-Gal staining The positive staining rate of senescent cells was detected by SA-β-Gal staining. Figure 22 As shown, the positive rate of cells in the model group was significantly higher than that in the control group ( P <0.0001), and the positive rate of cells decreased significantly after co-culture with hUCMSCs ( P <0.0001), indicating that hUCMSCs significantly reduced SA-β-Gal activity.

[0107] 3.2 HSFs apoptosis rate The apoptosis of skin fibroblasts was detected by Tunel staining method, and the results are presented in Figure 23 In the figure, the cell nuclei are stained blue and the apoptotic cells are stained red. It can be clearly seen from the figure that only a small number of cells in the control group are stained red, while a large number of cells in the aging model group are stained red. The fluorescence intensity of the model group is significantly increased compared with the control group ( P <0.0001), while the intensity of the co-culture group decreased, indicating that hUCMSCs co-culture can significantly inhibit HSFs apoptosis ( P <0.0001).

[0108] 3.3 p16, p21, p53 Relative expression of mRNA The relative expression of aging marker gene mRNA was detected by qRT-PCR. The results are shown in the figure. Figure 24 It can be seen that compared with the control group, the p16 The expression of P <0.05), and the expression was decreased after co-culture with hUCMSCs ( P <0.05); compared with the control group, the model group p21 The expression of P <0.001), and the expression was significantly decreased after co-culture with hUCMSCs ( P <0.001); compared with the control group, the model group p53 The expression of P <0.01), and the expression was significantly decreased after co-culture with hUCMSCs ( P <0.01).

[0109] 3.4 Surface antigens p16, p21, p53 The expression level Immunohistochemistry was used to detect the expression of senescence proteins. Figure 25 As shown in Figure 2, the positive rates of p16, p21, and p53 in the model group were significantly higher than those in the control group ( P <0.001, P <0.0001, P <0.0001), the positive rates of the co-culture groups were all decreased, and the decrease in p21 was most significant ( P <0.0001), p16 and p53 also reached significant levels ( P <0.01, P <0.001).

[0110] 3.5 Aging marker proteins p16, p21, p53 Protein expression The total protein of HSFs cells in the control group, model group and co-culture group was extracted, and the expression levels of aging marker proteins p16, p21 and p53 were detected by Western Blot. The results are as follows Figure 26 As shown in Figure 2, the expression of p16 protein in the model group was significantly higher than that in the control group ( P <0.001), and the expression level decreased significantly after co-culture with hUCMSCs ( P <0.0001); the expression of p21 protein in the model group was significantly higher than that in the control group ( P <0.0001), and the expression level in the co-culture group decreased significantly ( P <0.0001); compared with the control group, the expression of p53 protein in the model group was significantly upregulated ( P<0.0001), and the expression level was significantly downregulated after co-culture ( P <0.0001).

[0111] 3.6 Aging-associated secretory phenotype Elisa experiments were performed to detect the concentrations of IL-4, IL-6, and IL-17 in the cell supernatants of the control group, model group, and co-culture group. Figure 27 As shown in the figure, compared with the control group, the concentration of anti-inflammatory factor IL-4 in the model group decreased, but the results were not statistically different. Compared with the model group, the concentration of samples in the co-culture group increased significantly ( P <0.05); the concentrations of pro-inflammatory factors IL-6 and IL-17 in the model group were significantly increased compared with those in the control group ( P <0.0001). Compared with the model group, the concentrations of IL-6 and IL-17 samples in the co-culture group were significantly reduced ( P <0.0001). Therefore, it was shown that hUCMSCs have good anti-inflammatory effect.

[0112] 3. HSFs migration ability detection The cell scratch test is an experimental method used to study cell-related characteristics. The specific operation is to create a scratch on the cell layer and then observe the healing of the cells at different time points to explore the cell migration and repair ability and the interaction between cells. It can be used to observe the effect of hUCMSCs on cell migration and repair. The results are as follows Figure 28 As shown. 12 h and 24 h after scratching, the wound healing rate of the model group was significantly lower than that of the control group ( P <0.001, while the healing rate of the co-culture group was significantly higher than that of the model group ( P <0.001, P <0.05).

[0113] 3.8 HSFs activity detection The CCK-8 (Cell Counting Kit-8) assay can be used to detect cell viability. It is based on the reaction of water-soluble tetrazolium salt (WST-8) with live cell dehydrogenase to generate soluble formazan, which can be used to reflect cell viability by measuring absorbance. The more active and rapid the cell proliferation, the darker the color of the experimental reaction and the higher the corresponding absorbance value. The cell viability rate is then calculated by measuring the absorbance value. The results are as follows: Figure 29 As shown, the OD value of the model group was significantly lower than that of the control group ( P <0.01), and the absorbance value of the co-culture group increased significantly compared with the model group ( P <0.01). This indicates that co-culture with stem cells can enhance cell activity and promote cell proliferation.

[0114] 4. Relative expression analysis of mRNA of candidate genes related to aging Proteomic analysis identified 10 candidate genes associated with aging that were downregulated after treatment. Two of these genes (A0JM9 and EGK-02532) could not be found in the human gene IDs in Genecard, and primers could not be synthesized for subsequent validation experiments. qRT-PCR was used to detect the relative mRNA expression levels of the remaining eight candidate genes associated with aging. Figure 30 A, The mRNA expression of three genes (COLI, TNFAIP2, APOC3) showed an up-regulation trend after co-culture ( P >0.05); the expression of 5 genes (NPNT, CDK5, MMP2, ELMO1, POGLUT1) in the model group was upregulated compared with the control group, and downregulated after co-culture compared with the model group; among them, the downregulation of POGLUT1 after co-culture reached a significant level ( P <0.001). ELISA was used to detect the concentration of POGLUT1 in HSFs supernatant. Figure 30 B shows that compared with the control group, the concentration of the model group samples increased significantly ( P <0.001), and the concentration of samples in the co-culture group was significantly lower than that in the model group ( P <0.05). Therefore, POGLUT1 was identified as a key regulatory gene.

Claims

1. The application of POGLUT1 gene in reversing aging of skin fibroblasts is characterized by By downregulating the expression of POGLUT1 in skin fibroblasts and regulating the Notch pathway, SA-β-Gal activity and the expression of aging marker genes p16, p21 and p53 can be reduced, the number of cell apoptosis can be reduced, and the anti-inflammatory ability of HSFs can be enhanced, thereby reversing the aging of skin fibroblasts.

Images