Albumin mRNA detection kit for auxiliary diagnosis of liver cancer

Abstract

The invention discloses an albumin mRNA (messenger Ribonucleic Acid) detection kit for auxiliary diagnosis of liver cancer, which comprises nucleic acid probes with sequences as shown in SEQ ID NO: 1-20 and can be combined with albumin mRNA. The 5'or 3 'tail end of the nucleic acid probe comprises a linker 1 combination region base sequence, the linker 1 combination region base sequences of two adjacent nucleic acid probes are combined to form a linker 1, the linker 1 does not participate in complementary pairing with albumin mRNA, and the nucleic acid probe group is obtained through a cascade amplification process. The albumin mRNA detection kit provides 10 groups of in-situ hybridization probes targeting different areas of albumin mRNA, false negative results caused by RNA degradation can be avoided, mRNA signals can be amplified by hundreds of times through a cascade amplification process, and the sensitivity of an in-situ hybridization detection technology is greatly improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and in particular relates to an albumin mRNA detection kit for auxiliary diagnosis of liver cancer. Background Art

[0002] The liver is the most common metastatic organ for gastrointestinal and pancreatic malignancies, and approximately 10% of hepatocellular carcinomas are accompanied by extrahepatic metastasis at the time of initial diagnosis. Therefore, the diagnosis of hepatocellular carcinoma requires not only the identification of primary liver tumors, such as intrahepatic cholangiocarcinoma and biphenotypic hepatocellular carcinoma, but also the identification of malignant tumors with similar extrahepatic tissue morphologies. Hepatocyte paraffin antigen (HepPar-1) and arginase-1 (Arginase-1, Arg-1) are commonly used markers for hepatocellular carcinoma in pathological diagnosis, but the positive rates of both are not high in poorly differentiated hepatocellular carcinoma. Therefore, the differential diagnosis of poorly differentiated hepatocellular carcinoma is somewhat difficult. The National Health Commission's Medical Administration and Management Bureau's Guidelines for the Diagnosis and Treatment of Primary Liver Cancer (2022 Edition) clearly states: Due to the high heterogeneity of liver cancer histological types, existing liver cancer cell protein markers have a certain degree of insufficiency in diagnostic specificity and sensitivity, and require reasonable combination and objective evaluation, and need to be used in combination with markers of tumors of other systems.

[0003] Albumin is a water-soluble protein secreted by hepatocytes. After being synthesized in the liver, it is secreted into the bloodstream and is responsible for a variety of biological functions, including transporting hormones, fatty acids, and regulating pH. Studies have shown that detecting albumin in hepatic tumor cells can effectively determine whether liver tumor cells are derived from primary hepatocytes. However, because it is a secreted protein and is excreted from the cell once synthesized, conventional immunohistochemistry methods have made it difficult to obtain satisfactory results for in situ detection of albumin. This has led to the use of albumin mRNA in situ hybridization as the preferred method for in situ detection of albumin expression.

[0004] Literature research revealed that Avadhani V et al. at the Emory University Center for Pathology Research in Atlanta used this technique to detect 100% albumin-positive mRNA signals in 22 cases of hepatocellular carcinoma (HCC). Lehrke et al. at the Mayo Clinic in Minnesota, USA, also detected albumin mRNA expression in all 26 HCC samples. These results demonstrate that in situ detection of albumin mRNA in HCC using RNA in situ hybridization (ISH) has a detection rate of 97-100% and is unaffected by tissue sample preparation type (tissue microarray or whole tissue section), demonstrating the high sensitivity of the method.

[0005] However, due to the low expression levels of albumin mRNA, traditional RNA in situ hybridization techniques are unable to detect a clear positive signal, resulting in false negative results. Scientists from ACD, a US company, have developed a detection technology called "RNAScope" that can amplify RNA signals by more than 4,000 times. However, this technology is expensive, and no comparable technology is publicly available in China. Summary of the Invention

[0006] To address the deficiencies of the prior art, the present invention aims to provide an albumin mRNA detection kit for auxiliary diagnosis of liver cancer, providing 10 sets of in situ hybridization probes targeting different regions of its albumin mRNA, which can avoid false negative results caused by RNA degradation and can amplify the mRNA signal hundreds of times through a cascade amplification process.

[0007] In order to achieve the above objectives, the present invention adopts the following technical solutions:

[0008] An albumin mRNA detection kit for auxiliary diagnosis of liver cancer patients, comprising:

[0009] A nucleic acid probe set comprising nucleic acid probes having sequences as shown in SEQ ID NOs: 1-20, for binding to an albumin mRNA target; wherein the 5' or 3' end of the nucleic acid probe comprises a linker 1 combination region, wherein the base sequences of the linker 1 combination regions of two adjacent nucleic acid probes are combined to form a base sequence linker 1, wherein the base sequence linker 1 does not participate in complementary pairing with the albumin mRNA and is 12-16 bp in length, and linker 1 specifically comprises one of the following pairing combinations:

[0010] The 5' end sequence of SEQ ID NO: 1 and the 3' end sequence of SEQ ID NO: 2;

[0011] The 5' end sequence of SEQ ID NO:3 and the 3' end sequence of SEQ ID NO:4;

[0012] The 5' end sequence of SEQ ID NO:5 and the 3' end sequence of SEQ ID NO:6;

[0013] The 5' end sequence of SEQ ID NO:7 and the 3' end sequence of SEQ ID NO:8;

[0014] The 5' end sequence of SEQ ID NO:9 and the 3' end sequence of SEQ ID NO:10;

[0015] The 5' end sequence of SEQ ID NO: 11 and the 3' end sequence of SEQ ID NO: 12;

[0016] The 5' end sequence of SEQ ID NO: 13 and the 3' end sequence of SEQ ID NO: 14;

[0017] The 5' end sequence of SEQ ID NO: 15 and the 3' end sequence of SEQ ID NO: 16;

[0018] The 5' end sequence of SEQ ID NO: 17 and the 3' end sequence of SEQ ID NO: 18;

[0019] The 5' end sequence of SEQ ID NO: 19 and the 3' end sequence of SEQ ID NO: 20.

[0020] The nucleic acid probe AMP1 used for signal amplification has a sequence shown in SEQ ID NO:21. It can not only bind to the linker 1 of the adjacent probe among the nucleic acid probes shown in SEQ ID NO:1-20, but also has an "Ω"-shaped structure, consisting of three parts: a bottom "target binding region", a neck "complementary pairing region" and a top "signal amplification region".

[0021] The nucleic acid probe AMP2 for signal amplification has a sequence shown in SEQ ID NO: 22. It can not only bind to the signal amplification region sequence in the nucleic acid probe shown in SEQ ID NO: 21, but also has a base sequence at its 5' end that is not complementary to the signal amplification region sequence, namely the base sequence linker 2, which is 52 bp in length.

[0022] The nucleic acid probe AMP3 used for signal amplification has a sequence shown in SEQ ID NO:23. It can not only bind to the base sequence linker 2 in the nucleic acid probe shown in SEQ ID NO:22, but also has a base sequence at its 3' end that is not complementary to linker 2, with a length of 44 bp, namely the base sequence linker 3.

[0023] The nucleic acid probe AMP4 used for signal amplification has a sequence shown in SEQ ID NO:24. It can not only bind to linker 3 in the nucleic acid probe shown in SEQ ID NO:23, but also has a base sequence at its 5' end that is not complementary to linker 3, with a length of 72 bp, namely the base sequence linker 4.

[0024] The nucleic acid probe AMP5 used for signal amplification has a sequence shown in SEQ ID NO: 25. It can not only bind to linker 4 in the nucleic acid probe shown in SEQ ID NO: 22, but also has digoxigenin molecules modified at its 5' and 3' ends, and can be recognized by digoxigenin antibodies.

[0025] The benefits of the present invention lie in that the albumin mRNA detection kit provides 10 groups of in situ hybridization probes targeting different regions of its albumin mRNA, which can avoid false negative results caused by RNA degradation, and can amplify the mRNA signal hundreds of times through a cascade amplification process, greatly increasing the sensitivity of the in situ hybridization detection technology. It can assist pathologists in differentially diagnosing patients with liver cancer and intrahepatic bile duct cancer, and provide a basis for clinicians to formulate treatment plans. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a schematic diagram of the signal amplification principle of the albumin mRNA detection kit of the present invention;

[0027] Figure 2 The staining results of the albumin mRNA detection kit of the present invention are (A: albumin mRNA distribution in normal liver tissue; B: albumin mRNA distribution in hepatocellular carcinoma tissue; C: albumin mRNA distribution in intrahepatic cholangiocarcinoma tissue; D: albumin mRNA distribution in hepatoid adenocarcinoma tissue);

[0028] Figure 3 The denaturation conditions for nucleic acids in tissue samples in Example 3 were explored (A: incubation at 100°C for 5 min; B: incubation at 100°C for 10 min; C: incubation at 100°C for 15 min);

[0029] Figure 4 This is a comparison chart of different repair methods in Example 4 (A: repair using distilled water; B: repair using EDTA repair solution). DETAILED DESCRIPTION

[0030] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0031] Example 1. Design of Albumin mRNA In Situ Hybridization Detection Probe

[0032] like Figure 1 As shown, the albumin mRNA in situ hybridization detection probe consists of two parts: a complementary pairing region and a linker region. The complementary pairing region can complement the base sequence of albumin mRNA to achieve probe binding; the linker region can bind to the AMP1 probe to achieve cascade signal amplification. Similarly, the AMP2-AMP4 probes also contain two parts: a complementary pairing region and a linker region, and their functions are the same as those of the albumin mRNA in situ hybridization detection probe. The sequences of the albumin mRNA in situ hybridization detection probe and signal amplification probe are shown in Table 1.

[0033] Table 1. Sequences of albumin mRNA in situ hybridization detection probes and signal amplification probes

[0034]

[0035]

[0036] The length of Linker 1 is a range because it is not a single continuous sequence, but is formed by the complementary combination of the ends of two nucleic acids. Specifically:

[0037] The 5' end sequence of SEQ ID NO: 1 + the 3' end sequence of SEQ ID NO: 2 → together constitute the complete Linker 1;

[0038] The 5' end sequence of SEQ ID NO: 3 + the 3' end sequence of SEQ ID NO: 4 → together constitute the complete Linker 1;

[0039] The 5' end sequence of SEQ ID NO: 5 + the 3' end sequence of SEQ ID NO: 6 → together constitute the complete Linker 1;

[0040] The 5' end sequence of SEQ ID NO: 7 + the 3' end sequence of SEQ ID NO: 8 → together constitute the complete Linker 1;

[0041] The 5' end sequence of SEQ ID NO: 9 + the 3' end sequence of SEQ ID NO: 10 → together constitute the complete Linker 1;

[0042] The 5' end sequence of SEQ ID NO: 11 + the 3' end sequence of SEQ ID NO: 12 → together constitute the complete Linker 1;

[0043] The 5' end sequence of SEQ ID NO: 13 + the 3' end sequence of SEQ ID NO: 14 → together constitute the complete Linker 1;

[0044] The 5' end sequence of SEQ ID NO: 15 + the 3' end sequence of SEQ ID NO: 16 → together constitute the complete Linker 1;

[0045] The 5' end sequence of SEQ ID NO: 17 + the 3' end sequence of SEQ ID NO: 18 → together constitute the complete Linker 1;

[0046] The 5' end sequence of SEQ ID NO: 19 + the 3' end sequence of SEQ ID NO: 20 → together constitute the complete Linker 1.

[0047] The binding sites for the probe and AMP 1 are established through the complementary ends of the two nucleic acid segments. However, the spacing between the two nucleic acid segments varies, resulting in differences in the length of Linker 1. For example, when the original spacing between SEQ ID NO:1 and SEQ ID NO:2 is large, Linker 1 needs to be shortened to avoid redundancy. When the original spacing between SEQ ID NO:3 and SEQ ID NO:4 is small, Linker 1 needs to be extended to compensate. By increasing or decreasing the length of Linker 1, the naturally occurring spacing differences between different probe pairs are offset, ensuring that the binding site of AMP 1 is always located in the same position. The sequences of SEQ ID NOs:1-20 are all divided into three parts: a target binding region (for example), a linker region (the underlined sequence constitutes Linker 1, see Table 1), and a spacer region. The spacer region separates the linker region from the target binding region, exposing the linker for binding to the signal amplification probe. The length of the spacer sequence is determined by the spacing between the two adjacent probe groups.

[0048] For example, in SEQ ID NO:1, the target binding region is CATCTCGACGAAACACACCCCT, the linker region is CAACAACGACAG, and the spacer region is AAA. In SEQ ID NO:2, the target binding region is ACCGATGAGCAACCTCACTCTT, the linker region is GACAGCAACAAC, and the spacer region is AAA. Because the distance between SEQ ID NO:1 and SEQ ID NO:2 is large, the spacer sequence is 6 bases (3 bases in SEQ ID NO:1 and SEQ ID NO:2).

[0049] It's worth noting that the AMP1 probe consists of three main parts: a "target binding region" at the bottom, a "complementary pairing region" at the neck, and a "signal amplification region" at the top. The base sequence of the "target binding region" is complementary to the linker region of the albumin mRNA in situ hybridization probe and is 24 bp long. The base sequence of the "signal amplification region" is 20 bp long. To ensure the stability of the "Ω" structure, the base sequence of the "complementary pairing region" generally has a melting temperature above 50°C.

[0050] Example 2: Staining Effect of Albumin mRNA Detection Kit

[0051] To increase the sensitivity of albumin mRNA in situ hybridization detection, the present invention mixed the probes corresponding to SEQ ID NOs: 1-20, and then applied the following operating procedures to test the staining effect of the albumin mRNA detection kit of the present invention.

[0052] like Figure 2As shown, the albumin mRNA detection kit of the present invention has high staining intensity, no non-specific staining, and strong contrast.

[0053] The operating procedures of the albumin mRNA detection kit of the present invention are as follows:

[0054] S1. Dewaxing: Dewax the paraffin sections in xylene, remove excess liquid, place in anhydrous ethanol, and air dry.

[0055] S2. Endogenous peroxidase blocking: Add 80-100 μL of 3% hydrogen peroxide blocking solution to the dried sections. Incubate at room temperature in the dark for 10 minutes, then wash with pure water. Dehydrate in a gradient of 75%, 95%, and 100% ethanol for 2 minutes each, and air dry.

[0056] S3. Protein Digestion: Add 80-100 μL of 100 μg / mL pepsin digestion solution to the dried sections. Incubate at 37°C for 5-10 min, then wash with purified water. Dehydrate in a gradient of 75%, 95%, and 100% ethanol for 2 min each, and air dry.

[0057] S4. Nucleic Acid Denaturation: Place the dried sections in pre-boiled EDTA antigen retrieval solution. Incubate at 100°C for 15 minutes, then quickly cool in cold water. Dehydrate in a gradient of 75%, 95%, and 100% ethanol for 2 minutes each, and air dry.

[0058] S5. Probe hybridization: Add 80-100 μL of 5-10 ng / mL albumin mRNA probe to the dried sections. Incubate at 37°C for 2 hours and then rinse in PBS for 3 minutes.

[0059] S6. Signal Amplification I: Add 80-100 μL of 5-10 ng / mL signal amplification probe AMP 1 to the washed sections. Incubate at 37°C for 30 min, then rinse in PBS for 3 min.

[0060] S7. Signal Amplification II: Add 80-100 μL of 5-10 ng / mL signal amplification probe AMP 2 to the washed sections. Incubate at 37°C for 30 min, then rinse in PBS for 3 min.

[0061] S8. Signal Amplification III: Add 80-100 μL of 5-10 ng / mL signal amplification probe AMP 3 to the washed sections. Incubate at 37°C for 15 minutes, then rinse in PBS for 3 minutes.

[0062] S9. Signal Amplification IV: Add 80-100 μL of 5-10 ng / mL signal amplification probe AMP 4 to the washed sections. Incubate at 37°C for 30 min, then rinse in PBS for 3 min.

[0063] S10. Signal Amplification V: Add 80-100 μL of 5-10 ng / mL signal amplification probe AMP 5 to the washed sections. Incubate at 37°C for 15 minutes, then rinse in PBS for 3 minutes.

[0064] S11. Antibody Binding: Add 30-50 μL of HRP-labeled Digoxin antibody to the washed sections, incubate at 37°C for 30 min, and then rinse in PBS for 3 min.

[0065] S12. Color development: Add 80-100 μL of freshly prepared DAB working solution to the sections and incubate at room temperature for 5-10 min.

[0066] S13. Counterstaining, Dehydration, and Mounting: Rinse off excess DAB solution with purified water, then add 10-30 μL of hematoxylin staining solution. Incubate at room temperature for 10-30 seconds. Dehydrate in a gradient of 75%, 95%, and 100% ethanol for 2 minutes each. Air dry, and mount the slides with neutral gum.

[0067] S14. Slide reading: Observe the probe hybridization under a microscope. Positive staining is localized in the cytoplasm.

[0068] Example 3: Exploring denaturation conditions for albumin mRNA in tissue samples

[0069] Albumin mRNA in tissue samples can form secondary structures. This method uses high-temperature boiling repair, incubating at 100°C for 5, 10, and 15 minutes, followed by rapid cooling in cold water. This eliminates the secondary structure of the albumin mRNA, allowing the probe of the present invention to bind successfully. The operating procedures of the albumin mRNA detection kit of this example are the same as those of Example 2.

[0070] like Figure 3 As shown in the figure, albumin mRNA in tissue samples can achieve the best staining effect by incubating at 100℃ for 15min under high temperature boiling repair.

[0071] Example 4: Comparison of different repair methods

[0072] Based on the relevant conclusions in Example 3, the present invention further compared the repair effects of distilled water and EDTA repair solution, both of which were incubated at 100° C. for 15 minutes. The operation process of the albumin mRNA detection kit of this example is the same as that of Example 2.

[0073] The results are as follows Figure 4 As shown in the figure, when albumin mRNA in tissue samples was incubated at 100℃ for 15min, the staining effect of EDTA repair solution was better than that of distilled water.

[0074] In summary, the albumin mRNA detection kit of the present invention explores the optimal nucleic acid denaturation conditions in liver cancer tissue section samples. Compared with distilled water and citric acid antigen repair solution, the EDTA antigen repair solution has higher positive intensity, lower staining background, and stronger contrast. More importantly, the kit of the present invention can assist pathologists in differential diagnosis of patients with hepatocellular carcinoma and intrahepatic bile duct carcinoma, provide a reference basis for clinicians when formulating treatment plans, and improve the quality of life of liver cancer patients. Finally, the kit of the present invention also provides 10 groups of in situ hybridization probes targeting different regions of its albumin mRNA, which can avoid false negative results caused by RNA degradation, and based on the cascade amplification process, amplify the mRNA signal hundreds of times, greatly increasing the sensitivity of the in situ hybridization detection technology.

[0075] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solutions obtained by equivalent replacement or equivalent transformation fall within the scope of protection of the present invention.

Claims

1. An albumin mRNA detection kit for auxiliary diagnosis of liver cancer, characterized in that: include: A nucleic acid probe set comprising nucleic acid probes having sequences as shown in SEQ ID NOs: 1-20, for binding to an albumin mRNA target, wherein the 5' or 3' end of the nucleic acid probe comprises a linker 1 combination region, the linker 1 combination regions of two adjacent nucleic acid probes combine to form a base sequence linker 1, and the base sequence linker 1 does not participate in complementary pairing with the albumin mRNA; Nucleic acid probe AMP1, used for signal amplification, has a sequence as shown in SEQ ID NO:

21. The nucleic acid probe AMP1 has an "Ω"-shaped structure, comprising a target binding region at the bottom, a complementary pairing region at the neck, and a signal amplification region at the top. The target binding region of the nucleic acid probe AMP1 binds to the base sequence linker 1 of the adjacent probe in the nucleic acid probe set as shown in SEQ ID NOs:1-20; Nucleic acid probe AMP2, used for signal amplification, has a sequence as shown in SEQ ID NO: 22, binds to the signal amplification region of nucleic acid probe AMP1 as shown in SEQ ID NO: 21, and has a base sequence linker 2 at its 5' end; Nucleic acid probe AMP3, for signal amplification, has a sequence as shown in SEQ ID NO: 23, binds to base sequence linker 2 in nucleic acid probe AMP2 as shown in SEQ ID NO: 22, and has a 3' end containing base sequence linker 3; Nucleic acid probe AMP4, for signal amplification, has a sequence as shown in SEQ ID NO: 24, binds to base sequence linker 3 in nucleic acid probe AMP3 as shown in SEQ ID NO: 23, and has a 5' end containing base sequence linker 4; Nucleic acid probe AMP5 is used for signal amplification, and its sequence is shown in SEQ ID NO:

25. It binds to the base sequence linker 4 in the nucleic acid probe AMP4 shown in SEQ ID NO:

22.

2. The albumin mRNA detection kit for auxiliary diagnosis of liver cancer according to claim 1, characterized in that: The length of the base sequence linker 1 is 12 to 16 bp, and specifically includes one of the following pairing combinations: The 5' end sequence of SEQ ID NO: 1 and the 3' end sequence of SEQ ID NO: 2; The 5' end sequence of SEQ ID NO:3 and the 3' end sequence of SEQ ID NO:4; The 5' end sequence of SEQ ID NO:5 and the 3' end sequence of SEQ ID NO:6; The 5' end sequence of SEQ ID NO:7 and the 3' end sequence of SEQ ID NO:8; The 5' end sequence of SEQ ID NO:9 and the 3' end sequence of SEQ ID NO:10; The 5' end sequence of SEQ ID NO: 11 and the 3' end sequence of SEQ ID NO: 12; The 5' end sequence of SEQ ID NO: 13 and the 3' end sequence of SEQ ID NO: 14; The 5' end sequence of SEQ ID NO: 15 and the 3' end sequence of SEQ ID NO: 16; The 5' end sequence of SEQ ID NO: 17 and the 3' end sequence of SEQ ID NO: 18; The 5' end sequence of SEQ ID NO: 19 and the 3' end sequence of SEQ ID NO:

20.

3. The albumin mRNA detection kit for auxiliary diagnosis of liver cancer according to claim 2, characterized in that: The length of the base sequence linker 2 is 52 bp.

4. The albumin mRNA detection kit for auxiliary diagnosis of liver cancer according to claim 3, characterized in that: The length of the base sequence linker 3 is 44 bp.

5. The albumin mRNA detection kit for auxiliary diagnosis of liver cancer according to claim 4, characterized in that: The length of the base sequence linker 4 is 72 bp.

6. The albumin mRNA detection kit for auxiliary diagnosis of liver cancer according to claim 5, characterized in that: The 5' and 3' ends of the nucleic acid probe AMP5 are both modified with digoxigenin molecules.

Images