A snp molecular marker affecting reproductive traits of goats and application thereof

Abstract

The application belongs to the field of biotechnology and livestock breeding technology, and relates to a SNP molecular marker affecting goat reproductive traits and application, wherein the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, the 102th site in the sequence of SEQ ID NO. 1 is G or C, and the reproductive trait refers to the number of offspring of a goat. LGR4 The application finds an effective SNP molecular marker affecting the number of offspring of a goat, and is used for identifying the number of offspring of a goat. By screening goats through the molecular marker, GG homozygous genotype individuals are retained, and CC homozygous genotype individuals and CG heterozygous genotype individuals are eliminated, so that the reproductive performance of the goat can be improved.

Description

Technical Field

[0001] The invention belongs to the technical field of biotechnology and livestock breeding, and relates to a SNP molecular marker affecting goat reproductive traits and an application thereof. Background Art

[0002] The development of the sheep farming industry is crucial for improving the economy and people's living standards. In recent years, with economic development and rising living standards, market demand for mutton has continued to increase, even to the point where supply is insufficient to meet demand. However, due to outdated farming methods and a poor production infrastructure, the current state of the sheep farming industry still cannot meet this demand. Therefore, improving the efficiency of mutton production through scientific means is a crucial task for the sheep farming industry.

[0003] Lambing traits are a crucial indicator of ewe reproductive performance, directly impacting the development and economic profitability of goat breeding farms. Lambing traits are extremely complex quantitative traits, regulated by multiple biological processes. Lambing number per parity is a crucial parameter for evaluating reproductive performance in goats, objectively reflecting a ewe's reproductive potential. To further improve goat lambing, it is crucial to identify molecular markers that influence reproductive traits. Summary of the Invention

[0004] To solve the above problems, the present invention provides a SNP molecular marker affecting goat reproductive traits and its application.

[0005] The present invention is achieved through the following technical solutions:

[0006] Use of a SNP molecular marker affecting reproductive traits of goats in any of the following:

[0007] S1: Application in identification of reproductive traits in goats.

[0008] S2: Application in goat genetic breeding.

[0009] The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the 102 bp position in the SEQ ID NO.1 sequence is G or C.

[0010] The reproductive traits refer to the number of lambs born per parity.

[0011] SEQ ID NO. 1: ACTTAGGGGAGTGGTTAGTGGGATACATAGACTCTAGTCCATATGCAAATACGCGAACGTGTACTTTTCCTGTGAGAACAGCATTTTGTTTACCATGTCAACTCGAATCATTTCTTAGACAAACAATGTTTCTCCACAGGACCTTGACAGGTACGAAGATAAGCAGCATACCCAGTAATTTGTGCC.

[0012] Preferably, the goat is a Haimen goat, a Bo-za goat or a Hainan black goat.

[0013] Preferably, the identification of goat reproductive traits is to identify the goat's per parity litter size trait using the SNP molecular markers.

[0014] Preferably, the identification of goat reproductive traits specifically comprises the following steps:

[0015] Extract genomic DNA from goat blood.

[0016] PCR amplification of the SEQ ID NO. 1 sequence in goat genomic DNA was performed using PCR primers to obtain a PCR amplification product;

[0017] The PCR amplification products were sequenced to detect that the number of lambs born in the second parity of ewes with the genotype GG at the 102bp site in the SEQ ID NO.1 sequence was higher than that of ewes with the CC genotype, and the average number of lambs born in the second, third and fourth parities of ewes with the GG genotype was higher than that of ewes with the CC genotype.

[0018] Preferably, the PCR primers include an upstream primer F1 and a downstream primer R1; the nucleotide sequence of the upstream primer F1 is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer R1 is shown in SEQ ID NO.3.

[0019] Preferably, the goat genetic breeding is to increase the number of lambs born per offspring by selecting individuals with homozygous GG genotype as parents.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] A SNP molecular marker that affects goat reproductive traits, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, the 102 bp position in the SEQ ID NO.1 sequence is G or C, and the reproductive trait refers to the number of lambs born per parity. LGR4 An effective SNP molecular marker affecting goat litter size has been discovered, which can be used to identify goat litter size per parity. Using this molecular marker, goats can be screened to retain individuals with the GG homozygous genotype and eliminate individuals with the CC homozygous genotype and the CG heterozygous genotype. This can improve goat reproductive performance and accelerate goat breeding progress, thus having high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] 图1 for LGR4 Results of 2% agarose gel electrophoresis of the pooled PCR amplification products using primer P1 at the g.24848960 G>C site, where M represents DL2000 Plus DNA Marker and 1 represents Haimen goat. LGR4 g.24848960 G>C; 2 represents Bosnia-Herzegovina goat LGR4 g.24848960 G>C; 3 represents Hainan black goat LGR4 g.24848960 G>C.

[0024] 图2 for LGR4 Sequencing diagram of the PCR amplification product of the g.24848960 G>C site using primer P1; the arrow indicates the mutation site.

[0025] 图3 for LGR4 Correlation analysis of g.24848960 G>C and the average number of lambs born in the first, second and multiparous goats; 图3 In the LGR4 The correlation analysis diagram of g.24848960 G>C and the number of lambs born in the first parity of goats; B is the correlation analysis diagram of the second parity and the average number of lambs born in multiparities. DETAILED DESCRIPTION

[0026] To facilitate understanding of the present invention, the present invention will be described more fully below, along with preferred embodiments of the present invention. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present invention.

[0027] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0028] The beneficial effects of the present invention are described below through specific examples.

[0029] Example 1, goat LGR4 Typing and identification of gene SNP molecular markers

[0030] 1. Experimental Animals and Sample Collection

[0031] This study collected lambing data from the first four parities of 1,100 purebred Haimen goats from the Yangtze River Delta White Goat Conservation and Reproduction Research Institute in Haimen District, Nantong City, and the Haimen goat farm of Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd. Lambing data were collected from 308 Boer-cross goats (Haimen goats x Boer goats) from Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd. and 324 purebred Hainan Black goats from the Xueguli Happy Ecological Ranch in Sanya, Hainan Province. All goats were healthy and raised under identical conditions and environments. 10 mL of blood was collected from the jugular vein of pregnant ewes, placed in anticoagulant tubes containing EDTA, and stored at -20°C. Phenotypic information, such as lamb number, was collected for subsequent association analysis.

[0032] 2. Main instruments

[0033] Pipettes were purchased from Eppendorf, electronic balances were purchased from HENGJI, microwave ovens were purchased from Galanz, refrigerators were purchased from Haier, handheld centrifuges were purchased from SCILOGEX, model S1010E, vortexers were purchased from Dalong, digital constant temperature water baths were purchased from Changzhou Putian, model HH-G2, high-speed refrigerated centrifuges were purchased from Eppendorf, model 5424R), micro-spectrophotometers were purchased from NANODROP2000, PCR instruments were purchased from Applied Biosystems, electrophoresis apparatuses were purchased from Beijing Liuyi, model DYY-6C, and fully automatic digital gel imaging systems were purchased from Tanon, model Tanon-4100.

[0034] 3. Main Reagents

[0035] The TIANGEN blood genomic DNA extraction kit and 50×TAE were purchased from Solarbio, agarose was purchased from BIOWEST, 2×Taq Plus Master Mix II Dye Plus was purchased from Vazyme, model P213-03, 10000×TS-GelRed nucleic acid gel dye was purchased from TSINGKE, model TSJ003, and DL2000 Plus DNA Marker was purchased from Vazyme, model MD102-02.

[0036] 4. Methods

[0037] 4.1. Extraction of genomic DNA from goat blood

[0038] Five hours in advance, remove the goat blood from the -20°C freezer and thaw it in a 4°C refrigerator. After confirming that the blood is completely thawed, extract DNA from the whole blood according to the instructions of the TIANGEN Blood Genomic DNA Extraction Kit.

[0039] DNA concentration and quality were measured using a micro-spectrophotometer, where OD 260 / 280 Should be between 1.80, OD 260 / 230 The concentration should be 1.80. DNA samples that pass the test should be stored in a -20℃ refrigerator.

[0040] 4.2 Primer design for candidate SNP sites

[0041] Use the Ensembl database, the website is https: / / asia.ensembl.org / index.html, to search LGR4 Genotyping primers were designed using Primer Premier 5 software based on the gene-related SNP loci. The SNP loci and primer information are shown in Tables 1 and 2.

[0042] Table 1 LGR4 Gene SNP site information

[0043]

[0044] Table 2 LGR4 SNP genotyping primer sequences

[0045]

[0046] 4.3. Primer verification of candidate SNP sites

[0047] 4.3.1. Mixed pool production

[0048] From 1100 DNA samples from Haimen goats, 50 were randomly sampled and 1 μL of each was added to the same 1.5 mL centrifuge tube to create a DNA pool for subsequent candidate SNP polymorphism and primer validation. This procedure was repeated with 308 DNA samples from Bo-Zi sheep and 324 DNA samples from Hainan black goats, creating a total of three DNA pools.

[0049] 4.3.2. Pooled PCR Amplification

[0050] (1) PCR amplification system 20 μL: 2× Taq Plus Master Mix II 10 μL; upstream and downstream primers 0.8 μL each; template DNA 1 μL; deionized water 7.4 μL.

[0051] (2) PCR amplification procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 20 s, and extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 5 min; storage at 4°C after PCR.

[0052] 4.3.3. Agarose gel electrophoresis of mixed PCR products

[0053] (1) Prepare 2% agarose gel: Measure 1 g of agarose and 50 mL of 1× TAE and pour into a conical flask. Heat in a microwave on high for 3 min until the solution is clear and transparent. If not, extend the heating time appropriately. Let the solution stand until it is no longer hot, then add 5 μL of nucleic acid dye, mix thoroughly, pour onto a plate, and wait for it to solidify.

[0054] (2) After the agarose gel solidifies, add the sample. The amount of PCR product added is 6 μL, and the amount of DNA marker added is 4 μL. Gently place the agarose gel into the electrophoresis tank filled with 1×TAE. The 1×TAE liquid level should be above the gel surface. Run the gel at 140V for 35 minutes.

[0055] (3) After electrophoresis, transfer the gel to a fully automatic digital gel imaging system for observation.

[0056] The mixed pool DNA was subjected to agarose gel electrophoresis, and the results were as follows 图1 shown. LGR4 The SNP site has a clear band at the 191bp position, which is consistent with the expected fragment size and has no nonspecific miscellaneous bands, indicating that the two pairs of primers have good specificity and can be used for subsequent operations.

[0057] Genotyping

[0058] 4.4.1. PCR amplification of samples

[0059] (1) PCR amplification system 20 μL: 2× Taq Plus Master Mix II 10 μL; upstream and downstream primers 0.8 μL each; template DNA 1 μL; deionized water 7.4 μL.

[0060] (2) PCR amplification procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 20 s, and extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 5 min; storage at 4°C after PCR.

[0061] 4.4.2. Sequencing of sample PCR products and result determination

[0062] The above PCR product and primer P1 were sent to Universal Bio for sequencing. The PCR product sequence is shown in SEQ ID NO.1. The SNP site was LGR4 g.24848960 G>C means, LGR4 The g.24848960 G>C site is located at the 102nd bp of the nucleotide sequence shown in SEQ ID NO.1.

[0063] The sequencing results were compared and analyzed using SnapGene software, and the results were determined based on the sequencing peak graph. LGR4 g.24848960 G>C genotype: When the peak graph shows a single peak C, the genotype is CC; when the peak graph shows a single peak G, the genotype is GG; when the peak graph shows a double peak of C and G, the genotype is CG, such as 图2 shown.

[0064] The above results show that the PCR amplification of goat genomic DNA using primer P1 and the interpretation of genotype by direct sequencing can be used to identify goat genotypes. LGR4 Rapid and accurate typing and identification of gene SNP sites.

[0065] Example 2: Statistical analysis LGR4 Gene SNP polymorphism and its relationship with high reproductive traits in goats

[0066] 4. LGR4 Statistics of genetic parameters of different goat populations at the g.24848960 G>C locus

[0067] According to the primers and methods designed in Example 1, 1100 Haimen goats, 308 Bo cross goats and 324 Hainan black goats were genotyped, and the population genetic parameters of the locus were calculated, including genotype frequency, allele frequency, homozygosity, heterozygosity, effective allele number, polymorphic information content and Hardy-Weinberg equilibrium. P value.

[0068] The results are shown in Table 3. LGR4 The g.24848960 G>C locus has three genotypes: CC, CG, and GG in Haimen goats, Bohai goats, and Hainan black goats. In Haimen goats and Bohai goats, CC is the dominant genotype, and C is the dominant allele; in Hainan black goats, CG is the dominant genotype, and G is the dominant allele; all three breeds of goats are moderately polymorphic, with a 0.25 <PIC<0.5,并处于哈代温伯格平衡状态, P >0.05.

[0069] Table 3 LGR4 Genetic parameters of gene population

[0070]

[0071] Note: “ / ” means there is no item.

[0072] 2. LGR4 Association of the g.24848960 G>C locus with high fertility traits in different goat populations

[0073] SAS 8.0 software was used to perform least squares statistical analysis using the GLM procedure. LGR4 g.24848960 G>C Association of different genotypes with litter size in Haimen goats.

[0074] Taking genotype and season as fixed effects, the model is: ijk =μ+G i +S j +e ijk Where, Y ijk is the phenotypic value of individual lambing number; μ is the population mean; G i is the genotype effect; S j is the seasonal effect; e ijk is a random error.

[0075] 2.1. LGR4 Association analysis between the g.24848960 G>C locus and litter size in Haimen goats

[0076] Delete the fixed effects that have no significant association with individual phenotypic values ​​except genotype effects, and perform LGR4 Association analysis between gene SNP sites and litter size in Haimen goats. The results are expressed as "least squares mean ± standard error".

[0077] The results are shown in Table 4 and 图3 As shown, LGR4 g.24848960 G>C The locus was significantly associated with the number of lambs born in Haimen goats. The number of lambs born in the first litter of ewes with CC genotype was significantly higher than that of ewes with CG genotype. The number of lambs born in the second litter of ewes with GG genotype was significantly higher than that of ewes with CC genotype. The average number of lambs born in the second, third and fourth litters of ewes with GG genotype was significantly higher than that of ewes with CC genotype.

[0078] Table 4 LGR4 Association results between gene SNP sites and litter size in Haimen goats

[0079]

[0080] Note: Different lowercase letters in the same column indicate significant differences. P <0.05.

[0081] 2.2. LGR4 Association analysis between the g.24848960 G>C locus and the average litter size from the second to fourth litters in different goat populations

[0082] Delete the fixed effects that have no significant association with individual phenotypic values ​​except genotype effects, and perform LGR4 Association analysis between gene SNP sites and average litter size in Haimen goats, Bo-cross goats and Hainan black goats. The results are expressed as "least squares mean ± standard error".

[0083] The results are shown in Table 5. LGR4 g.24848960 G>C The results of association analysis between the genotypes of Haimen goats, Bo-mix goats and Hainan black goats and the average number of lambs born in the second to fourth litters of the corresponding groups showed a consistent trend.

[0084] Table 5 LGR4 Association results between gene SNP sites and average litter size from the second to fourth litters in different goat populations

[0085] Example 3: Application of SNP molecular markers in identifying reproductive traits of goats

[0086] Identification of goat reproductive traits involves the following steps:

[0087] 1. Collect blood from the goat to be tested and extract blood genomic DNA.

[0088] 2. PCR amplification was performed using primer P1 described in Example 1 with blood genomic DNA as a template, and the genotype was determined by direct sequencing of the PCR amplification product.

[0089] in:

[0090] (1) PCR amplification system 20 μL: 2× Taq Plus Master Mix II 10 μL; upstream and downstream primers 0.8 μL each; template DNA 1 μL; deionized water 7.4 μL.

[0091] (2) PCR amplification procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 20 s, and extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 5 min; storage at 4°C after PCR.

[0092] (3) Sequencing: The PCR product and primer P1 were sent to General Biotech for direct sequencing.

[0093] (4) Genotype determination: detection site LGR4 The number of lambs born in the second parity of ewes with the genotype of g.24848960 G>C was higher than that of ewes with the CC genotype. The average number of lambs born in the second, third and fourth parities of ewes with the GG genotype was significantly higher than that of ewes with the CC genotype.

[0094] Example 4: Application of SNP Molecular Markers in Genetic Breeding of Goats with High Reproductive Traits

[0095] The method of genetic breeding of goats with high reproductive traits mainly includes the following steps:

[0096] 1. Collect blood from the goat to be tested and extract blood genomic DNA.

[0097] 2. PCR amplification was performed using primer P1 described in Example 1 with blood genomic DNA as a template, and the genotype was determined by direct sequencing of the PCR amplification product.

[0098] in:

[0099] (1) PCR amplification system 20 μL: 2× Taq Plus Master Mix II 10 μL; upstream and downstream primers 0.8 μL each; template DNA 1 μL; deionized water 7.4 μL.

[0100] (2) PCR amplification procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 20 s, and extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 5 min; storage at 4°C after PCR.

[0101] (3) Sequencing: The PCR product and primer P1 were sent to General Biotech for direct sequencing.

[0102] (4) Genotype determination: SnapGene software was used to LGR4 g.24848960 G>C The peak diagram of site sequencing is compared and analyzed, when the peak diagram is single peak C, the genotype is CC; when the peak diagram is single peak G, the genotype is GG; when the peak diagram is C and G double peaks, the genotype is CG.

[0103] 3. LGR4 g.24848960 G>C of the GG genotype can be used as an effective molecular marker for improving the reproductive traits of goats.

[0104] Selecting the GG genotype individual as the parent in goat breeding can improve the number of offspring of the goat. The number of offspring of the GG genotype female goat in the second pregnancy is significantly higher than that of the CC genotype female goat, and the average number of offspring of the GG genotype female goat in the second, third and fourth pregnancies is significantly higher than that of the CC genotype female goat.

[0105] The SNP molecular marker of the present application is used for screening goats, the GG genotype individual is retained for genetic breeding, and the CC and CG genotype individuals are eliminated, so that the breeding goal of improving the reproductive performance of goats can be achieved.

[0106] The technical features of the above-described embodiments can be combined arbitrarily, and in order to make the description simple, all possible combinations of the technical features in the above-described embodiments are not described, however, as long as the combination of the technical features does not exist contradictory, it should be considered as the scope of the present application.

[0107] The above-described embodiments only express several embodiments of the present application, the description is more specific and detailed, but it should not be understood as the limitation of the scope of the patent. For ordinary skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. Use of a primer pair for detecting SNP molecular markers in identifying reproductive traits of female goats, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the 102 bp position in the SEQ ID NO.1 sequence is G or C; The reproductive traits refer to the number of lambs born per parity; The female goat is a Haimen goat, a Bo-mix goat or a Hainan black goat; The number of lambs born in the second litter of female goats with the genotype of GG at the 102bp site of the sequence shown in SEQ ID NO.1 is higher than that of female goats with the CC genotype. The average number of lambs born in the second, third and fourth litters of female goats with the genotype of GG at the 102bp site of the sequence shown in SEQ ID NO.1 is higher than that of female goats with the CC genotype.

2. The use according to claim 1, characterized in that Identifying the reproductive traits of female goats specifically includes the following steps: Extracting genomic DNA from the blood of the female goat to be tested; PCR amplification was performed on the genomic DNA of the female goat using PCR primers to obtain PCR amplification products; The PCR amplification products were sequenced. The results showed that the number of lambs born in the second litter of the female goats with the genotype of GG at the 102bp site of the sequence shown in SEQ ID NO.1 was higher than that of the female goats with the CC genotype. The average number of lambs born in the second, third and fourth litters of the female goats with the genotype of GG at the 102bp site of the sequence shown in SEQ ID NO.1 was higher than that of the female goats with the CC genotype.

3. The use according to claim 2, characterized in that The PCR primers consist of an upstream primer F1 and a downstream primer R1; the nucleotide sequence of the upstream primer F1 is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer R1 is shown in SEQ ID NO.

3.

4. Application of a primer pair for detecting SNP molecular markers in female goat genetic breeding, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the 102 bp position in the SEQ ID NO.1 sequence is G or C; The female goat is a Haimen goat, a Bohai goat or a Hainan black goat; The female goat genetic breeding is to increase the number of lambs born per parity by selecting individuals with a homozygous GG genotype at the 102 bp site of the sequence shown in SEQ ID NO.1 as parents.

Images