Glycosyltransferase UGT85A1 mutant and application thereof

By performing site-directed mutagenesis on the glycosyltransferase UGT85A1, the mutant formed significantly improved the efficiency of catalyzing tyrosol to produce salidroside and hydroxytyrosol to produce hydroxysalidroside, solving the problem of low catalytic efficiency in the existing technology and enhancing the potential for industrial application.

CN120608033APending Publication Date: 2025-09-09TIANJIN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410253929.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-03-06
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

The low efficiency of existing glycosyltransferases in catalyzing the production of salidroside from tyrosol has hindered its industrial application.

Method used

By performing site-directed mutagenesis on the glycosyltransferase UGT85A1, mutants with mutations in any one or more of P20, D88, I89, C93, G114, C128, W147, T149, Y157, F204, M214, F217, A218, E221 or F403 are formed, thereby improving the efficiency of catalyzing tyrosol to produce salidroside and hydroxytyrosol to produce hydroxysalidroside.

Benefits of technology

The mutated glycosyltransferase UGT85A1 mutant significantly improved the efficiency of catalyzing tyrosol to produce salidroside and hydroxytyrosol to produce hydroxysalidroside, enhanced the microbial conversion ability, and has good industrial application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004728884760000091
    Figure BDA0004728884760000091
  • Figure BDA0004728884760000101
    Figure BDA0004728884760000101
  • Figure BDA0004728884760000131
    Figure BDA0004728884760000131
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to a glycosyl transferase UGT85A1 mutant and application thereof. The invention provides a glycosyl transferase UGT85A1 mutant. The glycosyl transferase UGT85A1 mutant is obtained by mutating one or more of the 20th site, the 88th site, the 93th site, the 114 site, the 128 site, the 147th site, the 149th site, the 157th site, the 204 site, the 214th site, the 217th site, the 218th site, the 2221th site and the 403th site of glycosyl transferase UGT85A1 (an amino acid sequence shown as SEQ ID NO.1) from arabidopsis thaliana. Experiments prove that the mutated glycosyl transferase protein can improve the catalytic activity of catalyzing tyrosol glycosylation to generate salidroside, and can improve the catalytic activity of hydroxytyrosol glycosylation to generate hydroxysalidroside at the same time. The glycosyl transferase UGT85A1 mutant protein is expressed in microorganisms, the capacity of microbial conversion of tyrosol to generate salidroside and the capacity of microbial conversion of hydroxytyrosol to generate hydroxysalidroside are obviously enhanced, and the industrial application prospect is good.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a glycosyltransferase UGT85A1 mutant and an application thereof. Background Art

[0002] Salidroside is a natural small molecule with important biological activities such as hypoxia resistance, anti-tumor, antiviral, and skin protection. It has been used in health care products, cosmetics, and pharmaceutical industries and has extremely high commercial value.

[0003] Using tyrosol as a substrate, glycosyltransferases can efficiently convert tyrosol into salidroside. This reaction offers advantages such as high positional selectivity, a green process, and high efficiency. Efficient glycosyltransferases not only enable efficient enzymatic reactions but can also be used in cell factories to produce salidroside, demonstrating their potential for significant application.

[0004] However, the current glycosyltransferases that catalyze the production of salidroside from tyrosol have low efficiency, hindering its industrial application. Summary of the Invention

[0005] In view of this, the present invention provides mutants of glycosyltransferase UGT85A1 and their uses. The present invention provides mutants of glycosyltransferase UGT85A1 and their uses in the preparation of salidroside and hydroxysalidroside. Experiments have shown that the mutants have significantly improved efficiency in catalyzing the glucosylation of tyrosol to produce salidroside compared to UGT85A1 composed of the amino acid sequence shown in SEQ ID NO. 1, and experiments have shown that partial mutants have significantly improved efficiency in catalyzing the glucosylation of hydroxytyrosol to produce hydroxysalidroside compared to UGT85A1 composed of the amino acid sequence shown in SEQ ID NO. 1.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a mutant of glycosyltransferase UGT85A1, which includes mutations in any one or more of P20, D88, I89, C93, G114, C128, W147, T149, Y157, F204, M214, F217, A218, E221 or F403.

[0008] In some specific embodiments of the present invention, the glycosyltransferase UGT85A1 has:

[0009] (I), the amino acid sequence shown in SEQ ID NO.1; or

[0010] (II) a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence as shown in (I); or

[0011] (III) A sequence having a homology of 90% or more to the amino acid sequence shown in (I) or (II).

[0012] In some specific embodiments of the present invention, the glycosyltransferase UGT85A1 encoding nucleic acid has:

[0013] (I), the nucleotide sequence shown in SEQ ID NO.2; or

[0014] (II) a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I) but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0015] (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar functions as the nucleotide sequence shown in (I) or (II); or

[0016] (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).

[0017] In some specific embodiments of the present invention, the mutation of P20 includes but is not limited to mutation to A or S; and / or

[0018] Mutations of D88 include, but are not limited to, mutations to A, I, or L; and / or

[0019] Mutations of I89 include but are not limited to mutations to A, V; and / or

[0020] Mutations of C93 include but are not limited to mutations to A; and / or

[0021] Mutations of G114 include, but are not limited to, mutations to D, K, E, I, or S; and / or

[0022] Mutations of C128 include, but are not limited to, mutations to G, A, or S; and / or

[0023] Mutations of W147 include but are not limited to mutation to A; and / or

[0024] Mutations of T149 include but are not limited to mutation to A; and / or

[0025] Mutations of Y157 include, but are not limited to, mutation to A; and / or

[0026] Mutations of F204 include but are not limited to mutation to A; and / or

[0027] Mutations of M214 include but are not limited to mutations to A or F; and / or

[0028] Mutations of F217 include but are not limited to mutations to A, Y, Q, H, K, N, T, V, C, E or S; and / or mutations of A218 include but are not limited to mutations to V; and / or

[0029] Mutations of E221 include, but are not limited to, mutation to A; and / or

[0030] Mutations of F403 include, but are not limited to, mutations to A, E, S, or Y.

[0031] In some specific embodiments of the present invention, the mutant includes any of the following:

[0032] (I), G114D, F217H, C128G, A37S; or

[0033] (II), G114D, F217H, and C128G; or

[0034] (III) G114D, F217H; or

[0035] (IV), G114K and F217Q; or

[0036] (V), P20A; or

[0037] (VI), P20S; or

[0038] (VII), D88A; or

[0039] (VIII), D88I; or (IX), D88L; or (X), I89A

[0040] (XI), I89V; or (XII), C93A

[0041] (XIII), G114E; or (XIV), G114K; or (XV), C128A

[0042] (XVI), C128G; or (XVII), W147A

[0043] (XVIII), T149A

[0044] (XIX), Y157A

[0045] (XX), F204A

[0046] (XXI), M214A; or (XXII), M214F; or (XXIII), F217A

[0047] (XXIV), F217Y; or

[0048] (XXV), F217Q; or

[0049] (XXVI), F217H; or

[0050] (XXVII), F217K; or (XXVIII), A218V; or (XXIX), E221A

[0051] (XXX), F403A; or

[0052] (XXXI), F403E; or (XXXII), F403S; or

[0053] (XXXIII), F403Y.

[0054] The present invention also provides a nucleic acid molecule encoding the mutant.

[0055] In some embodiments of the present invention, the nucleic acid molecule has:

[0056] (I) The nucleotide sequence as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.35, except that one or more base positions in Table 2 are changed, the rest are the same as SEQ ID NO. No.2 sequence is exactly the same; or

[0057] (II) a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I) but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0058] (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar functions as the nucleotide sequence shown in (I) or (II); or

[0059] (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).

[0060] The present invention also provides an expression cassette comprising the nucleic acid molecule.

[0061] The present invention also provides a recombinant expression vector, which includes the expression cassette and a skeleton vector.

[0062] In some specific embodiments of the present invention, the backbone carrier comprises PET28a, PUC19, and PRS403.

[0063] The present invention also provides a host comprising:

[0064] (I), the nucleic acid molecule; and / or

[0065] (II), the expression cassette; and / or

[0066] (III) the recombinant expression vector.

[0067] In some embodiments of the present invention, the host comprises Escherichia coli and / or Saccharomyces cerevisiae.

[0068] In some specific embodiments of the present invention, the Escherichia coli includes Escherichia coli BL21 (DE3) and / or Escherichia coli DH5α.

[0069] In some specific embodiments of the present invention, the Saccharomyces cerevisiae comprises Saccharomyces cerevisiae CEN.PK2-1C.

[0070] In some specific embodiments of the present invention, the method for preparing the mutant comprises:

[0071] (I), expressing the above-mentioned glycosyltransferase mutant in the genome of Saccharomyces cerevisiae; and / or

[0072] (II) expressing the glycosyltransferase mutant in Saccharomyces cerevisiae using a plasmid; and / or

[0073] (III), expressing the glycosyltransferase mutant in the Escherichia coli genome; and / or

[0074] (IV) Expressing the above-mentioned glycosyltransferase mutants in Escherichia coli using plasmids.

[0075] The present invention also provides the use of any of the following in the preparation of salidroside and / or hydroxysalidroside:

[0076] (I), the mutant; and / or

[0077] (II), the nucleic acid molecule; and / or

[0078] (III), the expression cassette; and / or

[0079] (IV), the recombinant expression vector; and / or

[0080] (V) the host.

[0081] In some specific embodiments of the present invention, the use comprises:

[0082] Tyrosol is used as a substrate, whole cells obtained by fermentation culture of recombinant bacteria expressing a glycosyltransferase UGT85A1 mutant are used as a biocatalyst, tyrosol is added, a buffer solution with a pH of 5 to 9 is used as a reaction medium, the reaction is carried out at 30 to 37° C. and 0 to 600 rpm, and the reaction liquid is separated and purified to obtain salidroside.

[0083] In some specific embodiments of the present invention, the use comprises:

[0084] A glycosyltransferase UGT85A1 mutant is expressed in a recombinant engineering bacterium, and the glycosyltransferase UGT85A1 mutant protein is purified. Tyrosol and UDP-glucose are added to the reaction medium, and the reaction is carried out at 30-37° C. and 0-600 rpm in a buffer solution with a pH of 5-9. The reaction solution is separated and purified to obtain salidroside.

[0085] In some specific embodiments of the present invention, the use comprises:

[0086] On the basis of the saccharomyces cerevisiae capable of synthesizing tyrosol, a glycosyltransferase UGT85A1 mutant is further expressed to obtain the salidroside-producing saccharomyces cerevisiae.

[0087] In some specific embodiments of the present invention, the use comprises:

[0088] Hydroxytyrosol is used as a substrate, whole cells obtained by fermentation culture of recombinant bacteria expressing a glycosyltransferase UGT85A1 mutant are used as a biocatalyst, hydroxytyrosol is added, a buffer solution with a pH of 5 to 9 is used as a reaction medium, the reaction is carried out at 30 to 37° C. and 0 to 600 rpm, and the reaction liquid is separated and purified to obtain hydroxysalidroside.

[0089] In some specific embodiments of the present invention, the use comprises:

[0090] A glycosyltransferase UGT85A1 mutant was expressed in a recombinant engineering bacterium, and the glycosyltransferase UGT85A1 mutant protein was purified. Hydroxytyrosol and UDP-glucose were added to the reaction medium, and the reaction was carried out at 30-37° C. and 0-600 rpm in a buffer solution with a pH of 5-9. The reaction solution was separated and purified to obtain hydroxysalidroside.

[0091] In some specific embodiments of the present invention, the use comprises:

[0092] On the basis of the cerevisiae yeast capable of synthesizing hydroxytyrosol, a glycosyltransferase UGT85A1 mutant is further expressed to obtain the cerevisiae yeast capable of producing hydroxysalidroside.

[0093] The present invention also provides a method for preparing salidroside and / or hydroxysalidroside, which comprises preparing salidroside based on any of the following:

[0094] (I), the mutant; and / or

[0095] (II), the nucleic acid molecule; and / or

[0096] (III), the expression cassette; and / or

[0097] (IV), the recombinant expression vector; and / or

[0098] (V) the host.

[0099] In some specific embodiments of the present invention, the Cas number of the salidroside is: 10338-51-9.

[0100] In some specific embodiments of the present invention, the preparation method comprises preparing salidroside in vitro or preparing salidroside in vivo.

[0101] In some specific embodiments of the present invention, the in vitro preparation of salidroside comprises the following steps:

[0102] Step 1, inserting the nucleic acid molecule encoding the glycosyltransferase UGT85A1 mutant into an Escherichia coli expression vector to obtain the recombinant expression vector;

[0103] Step 2: transforming the recombinant expression vector into Escherichia coli, culturing, inducing expression, breaking the bacteria, centrifuging, eluting impurities, and dialyzing to obtain the mutant;

[0104] Step 3: Mix the mutant with tyrosol and UDP-glucose, and incubate to obtain salidroside.

[0105] In some specific embodiments of the present invention, the E. coli expression vector in step 1 includes PET28a-MBP.

[0106] In some specific embodiments of the present invention, the Escherichia coli in step 2 includes Escherichia coli BL21 (DE3).

[0107] In some specific embodiments of the present invention, the culture medium in step 2 comprises LB medium.

[0108] In some specific embodiments of the present invention, the elution of impurities in step 2 comprises:

[0109] (1) incubating the supernatant after centrifugation with nickel colloid;

[0110] (II) Elute the impurities using a buffer containing 20 mmol / L imidazole;

[0111] (III) collecting the mutant protein using a buffer containing 250 mmol / L imidazole;

[0112] The buffer solution includes: pH 7.5, 50 mmol / L Tris-HCl, 500 mmol / L sodium chloride, and 10% glycerol.

[0113] In some specific embodiments of the present invention, the incubation temperature in step 3 includes 30°C;

[0114] The incubation time includes 1 hour.

[0115] In some specific embodiments of the present invention, the in vivo preparation of salidroside comprises the following steps:

[0116] Step 1, inserting the nucleic acid molecule encoding the glycosyltransferase UGT85A1 mutant into an Escherichia coli expression vector to obtain the recombinant expression vector;

[0117] Step 2: transforming the recombinant expression vector into Escherichia coli, culturing, and inducing expression to obtain wet Escherichia coli cells containing the recombinantly expressed glycosyltransferase UGT85A1 mutant.

[0118] Step 3: Fermenting the wet Escherichia coli cells described in step 2 in M9Y culture medium added with 2 mmol / L tyrosol to obtain salidroside.

[0119] In some specific embodiments of the present invention, the fermentation conditions include incubation at 30° C. and 220 rpm for 8 hours.

[0120] In some specific embodiments of the present invention, the components of the M9Y medium are: 5g / L yeast extract, 1g / L NH4Cl, 6g / LNa2HPO4, 3g / L KH2PO4, 0.5g / L NaCl, 246.5mg / L MgSO4·7H2O, 14.7mg / L CaCl2·2H2O, and 20g / L glucose.

[0121] In some specific embodiments of the present invention, the in vivo preparation of salidroside comprises the following steps:

[0122] Step 1: adding a promoter to the front of the nucleic acid molecule encoding the glycosyltransferase UGT85A1 mutant to form a gene expression cassette and integrating it into the genome of the Saccharomyces cerevisiae strain CEN.PK2-1C to obtain the host;

[0123] Alternatively, the host is obtained by using a plasmid to express a gene expression cassette encoding a glycosyltransferase UGT85A1 mutant in Saccharomyces cerevisiae;

[0124] Step 2: culturing the host to obtain the host seed solution;

[0125] Step 3: inoculating the host seed liquid into a fermentation medium supplemented with tyrosol, and fermenting to obtain salidroside.

[0126] In some specific embodiments of the present invention, the concentration of tyrosol is 5 g / L.

[0127] In some embodiments of the present invention, the fermentation temperature comprises 30°C.

[0128] In some specific embodiments of the present invention, the in vivo preparation of salidroside comprises the following steps:

[0129] Step 1, inserting the nucleic acid molecule encoding the glycosyltransferase UGT85A1 mutant into the PRS403-TEF1p-PGK1t vector to obtain the recombinant expression vector;

[0130] Step 2: transforming the recombinant expression vector into a high-tyrosol-producing Saccharomyces cerevisiae strain to obtain the host;

[0131] Step 3: inoculating the host into YPD medium and culturing to obtain salidroside.

[0132] In some embodiments of the present invention, the fermentation temperature comprises 30°C.

[0133] In some specific embodiments of the present invention, the Cas number of the hydroxysalidroside is: 76873-99-9.

[0134] In some specific embodiments of the present invention, the preparation method comprises preparing hydroxysalidroside in vitro or preparing hydroxysalidroside in vivo.

[0135] In some specific embodiments of the present invention, the in vitro preparation of hydroxysalidroside comprises the following steps:

[0136] Step 1, inserting the nucleic acid molecule encoding the glycosyltransferase UGT85A1 mutant into an Escherichia coli expression vector to obtain the recombinant expression vector;

[0137] Step 2: transforming the recombinant expression vector into Escherichia coli, culturing, inducing expression, breaking the bacteria, centrifuging, eluting impurities, and dialyzing to obtain the mutant;

[0138] Step 3: Mix the mutant with hydroxytyrosol and UDP-glucose, and incubate to obtain hydroxysalidroside.

[0139] In some specific embodiments of the present invention, the E. coli expression vector in step 1 includes PET28a-MBP.

[0140] In some specific embodiments of the present invention, the Escherichia coli in step 2 includes Escherichia coli BL21 (DE3).

[0141] In some specific embodiments of the present invention, the culture medium in step 2 comprises LB medium.

[0142] In some specific embodiments of the present invention, the elution of impurities in step 2 comprises:

[0143] (1) incubating the supernatant after centrifugation with nickel colloid;

[0144] (II) Elute the impurities using a buffer containing 20 mmol / L imidazole;

[0145] (III) collecting the mutant protein using a buffer containing 250 mmol / L imidazole;

[0146] The buffer solution includes: pH 7.5, 50 mmol / L Tris-HCl, 500 mmol / L sodium chloride, and 10% glycerol.

[0147] In some specific embodiments of the present invention, the incubation temperature in step 3 includes 30°C;

[0148] The incubation time includes 1 hour.

[0149] In some specific embodiments of the present invention, the in vivo preparation of hydroxysalidroside comprises the following steps:

[0150] Step 1, inserting the nucleic acid molecule encoding the glycosyltransferase UGT85A1 mutant into an Escherichia coli expression vector to obtain the recombinant expression vector;

[0151] Step 2: transforming the recombinant expression vector into Escherichia coli, culturing, and inducing expression to obtain wet Escherichia coli cells containing the recombinantly expressed glycosyltransferase UGT85A1 mutant.

[0152] Step 3: Fermenting the wet Escherichia coli cells described in step 2 in M9Y culture medium added with 2 mmol / L hydroxytyrosol to obtain hydroxysalidroside.

[0153] In some specific embodiments of the present invention, the fermentation conditions include incubation at 30° C. and 220 rpm for 8 hours.

[0154] In some specific embodiments of the present invention, the components of the M9Y medium are: 5g / L yeast extract, 1g / L NH4Cl, 6g / LNa2HPO4, 3g / L KH2PO4, 0.5g / L NaCl, 246.5mg / L MgSO4·7H2O, 14.7mg / L CaCl2·2H2O, and 20g / L glucose.

[0155] In some specific embodiments of the present invention, the in vivo preparation of hydroxysalidroside comprises the following steps:

[0156] Step 1: adding a promoter to the front of the nucleic acid molecule encoding the glycosyltransferase UGT85A1 mutant to form a gene expression cassette and integrating it into the genome of the Saccharomyces cerevisiae strain CEN.PK2-1C to obtain the host;

[0157] Alternatively, the host is obtained by using a plasmid to express a gene expression cassette encoding a glycosyltransferase UGT85A1 mutant in Saccharomyces cerevisiae;

[0158] Step 2: culturing the host to obtain the host seed solution;

[0159] Step 3: inoculating the host seed liquid into a fermentation medium supplemented with hydroxytyrosol, and fermenting to obtain hydroxysalidroside.

[0160] In some specific embodiments of the present invention, the concentration of hydroxytyrosol is 2.5 g / L.

[0161] In some embodiments of the present invention, the fermentation temperature comprises 30°C.

[0162] In some specific embodiments of the present invention, the in vivo preparation of hydroxysalidroside comprises the following steps:

[0163] Step 1, inserting the nucleic acid molecule encoding the glycosyltransferase UGT85A1 mutant into the PRS403-TEF1p-PGK1t vector to obtain the recombinant expression vector;

[0164] Step 2: transforming the recombinant expression vector into a high-hydroxytyrosol-producing Saccharomyces cerevisiae strain to obtain the host;

[0165] Step 3: inoculating the host into YPD medium and culturing to obtain hydroxysalidroside.

[0166] In some embodiments of the present invention, the fermentation temperature comprises 30°C.

[0167] The present invention includes but is not limited to the following beneficial effects:

[0168] The present invention provides a UGT85A1 mutant. The glycosyltransferase mutant is obtained by mutating one or more of positions 20, 88, 89, 93, 114, 128, 147, 149, 157, 204, 214, 217, 218, 221, and 403 of the glycosyltransferase UGT85A1 from Arabidopsis thaliana (amino acid sequence shown in SEQ ID NO. 1). Experiments in the present invention demonstrate that the mutated glycosyltransferase protein can enhance the catalytic activity of catalyzing the glycosylation of tyrosol to salidroside and the conversion of hydroxytyrosol to hydroxysalidroside. Expression of the UGT85A1 mutant glycosyltransferase protein in microorganisms significantly enhances the microorganism's ability to convert tyrosol to salidroside and hydroxytyrosol to hydroxysalidroside, and has promising prospects for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0169] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0170] Figure 1 The standard curve of tyrosol is shown;

[0171] Figure 2 The standard curve of salidroside is shown;

[0172] Figure 3 The standard curve of hydroxytyrosol is shown;

[0173] Figure 4 The standard curve of hydroxysalidroside is shown;

[0174] Figure 5A graph showing the comparison of salidroside production in the transformation medium of 5 g / L tyrosol in the culture medium of Saccharomyces cerevisiae CEN.PK2-1C expressing different mutants of the glycosyltransferase UGT85A1 with excellent effects;

[0175] Figure 6 The figure shows the comparison of salidroside production in the transformation medium of 5 g / L tyrosol by expressing different mutants of glycosyltransferase UGT85A1 with poor or even inactive effects in Saccharomyces cerevisiae CEN.PK2-1C;

[0176] Figure 7 A comparison of salidroside yields in pure enzyme reactions of different UGT85A1 mutants is shown (Note: Assuming the specific enzyme activity of the wild-type UGT85A1 protein is 1, the specific enzyme activity of the G114D single mutant protein is 1.22, the G114D / F217H double mutant protein is 2.42, the triple mutant protein G114D / F217H / C128A is 5.53, and the G114D / F217H / C128S is 6.54. The highest specific enzyme activity of G114D / F217H / C128G is 7.08);

[0177] Figure 8 A graph showing a comparison of salidroside production by expressing different UGT85A1 mutants in a high-tyrosol-producing Saccharomyces cerevisiae strain is shown (Note: The wild-type high-tyrosol-producing strain with the original UGT85A1 gene inserted had a salidroside production of 0.0644 g / L, the high-tyrosol-producing strain with the double mutant G114D / F217H genes inserted had a salidroside production of 1.607 g / L, and the high-tyrosol-producing strain with the triple mutant G114D / F217H / C128G genes inserted had the highest salidroside production of 2.639 g / L, which is about 41 times that of the wild-type, demonstrating a significant improvement).

[0178] Figure 9 A graph showing the comparison of hydroxysalidroside production in the transformation medium of 2.5 g / L hydroxytyrosol in the culture medium of Saccharomyces cerevisiae CEN.PK2-1C expressing different mutants of the excellent glycosyltransferase UGT85A1;

[0179] Figure 10A comparison of hydroxysalidroside production by expressing different UGT85A1 mutants in a high-hydroxytyrosol-producing Saccharomyces cerevisiae strain is shown (Note: the wild-type high-hydroxytyrosol-producing strain with the original UGT85A1 gene inserted had a hydroxysalidroside production of 0.0618 g / L, the high-hydroxytyrosol-producing strain with the single mutant G114D gene inserted had a hydroxysalidroside production of 0.0735 g / L, the high-hydroxytyrosol-producing strain with the double mutant G114D / F217H genes inserted had a hydroxysalidroside production of 0.56 g / L, and the high-hydroxytyrosol-producing strain with the triple mutant G114D / F217H / C128G genes inserted had the highest hydroxysalidroside production of 1.057 g / L, which was about 17 times that of the wild-type, and the improvement effect was significant). DETAILED DESCRIPTION

[0180] The present invention discloses mutants of the glycosyltransferase UGT85A1 and their applications. Those skilled in the art can refer to the disclosure herein and appropriately modify process parameters to achieve their desired effects. It should be noted that all similar substitutions and modifications apparent to those skilled in the art are considered encompassed by the present invention. The methods and applications of the present invention have been described through preferred embodiments. It is apparent that those skilled in the art can modify, alter, and combine the methods and applications described herein to implement and apply the technology of the present invention without departing from the disclosure, spirit, and scope of the present invention.

[0181] The present invention addresses the shortcomings of the glycosyltransferase UGT85A1 and provides a UGT85A1 mutant, an engineered bacterium, and its use in the preparation of salidroside and hydroxysalidroside. The glycosyltransferase is modified through site-directed and site-saturation mutagenesis methods to enhance its reactivity towards tyrosol, effectively improving the enzymatic activity of the resulting mutant. This overcomes the low activity of glycosyltransferases in the prior art. Therefore, this patent utilizes enzyme engineering methods to modify the glycosyltransferase UGT85A1 from Arabidopsis thaliana, obtaining a mutant with high catalytic activity.

[0182] One of the technical solutions of the present invention provides a glycosyltransferase mutant, wherein the glycosyltransferase mutant is obtained by replacing one or more amino acid residues at positions 20, 88, 89, 93, 114, 128, 147, 149, 157, 204, 214, 217, 218, 221, and 403 of the amino acid sequence of UGT85A1 shown in SEQ ID NO.1 with a new amino acid sequence formed by other amino acid residues. Compared with the UGT85A1 composed of the amino acid sequence shown in SEQ ID NO.1, the mutant has a significantly improved efficiency in catalyzing the glucosylation of tyrosol to produce salidroside, and also has a significantly improved efficiency in catalyzing the glucosylation of hydroxytyrosol to produce hydroxysalidroside.

[0183] Specifically, it is preferred that the UGT85A1 mutant is a mutant in which the amino acid sequence shown in SEQ ID NO.1 is mutated into one of the following:

[0184] (1) Glycine at position 114 mutated to aspartic acid, phenylalanine at position 217 mutated to histidine, cysteine ​​at position 128 mutated to glycine, and alanine at position 37 mutated to serine; (2) Glycine at position 114 mutated to aspartic acid, phenylalanine at position 217 mutated to histidine, and cysteine ​​at position 128 mutated to glycine; (3) Glycine at position 114 mutated to aspartic acid, and phenylalanine at position 217 mutated to histidine; (4) Glycine at position 114 mutated to lysine, and phenylalanine at position 217 mutated to glutamine. Amide; (5) Proline at position 20 mutated to Alanine; (6) Proline at position 20 mutated to Serine; (7) Aspartic acid at position 88 mutated to Alanine; (8) Aspartic acid at position 88 mutated to Isoleucine; (9) Aspartic acid at position 88 mutated to Leucine; (10) Isoleucine at position 89 mutated to Alanine; (11) Isoleucine at position 89 mutated to Valine; (12) Cysteine ​​at position 93 mutated to Alanine; (13) Glycine at position 114 mutated to Lysine; (14) Glycine at position 114 mutated to Glutamic Acid; ( 15) Cysteine ​​at position 128 mutated to alanine; (16) Cysteine ​​at position 128 mutated to glycine; (17) Tryptophan at position 147 mutated to alanine; (18) Threonine at position 149 mutated to alanine; (19) Tyrosine at position 157 mutated to alanine; (20) Phenylalanine at position 204 mutated to alanine; (21) Methionine at position 214 mutated to alanine; (22) Methionine at position 214 mutated to phenylalanine; (23) Phenylalanine at position 217 mutated to alanine; (24) Phenylalanine at position 217 mutated to alanine. (25) Phenylalanine at position 217 mutated to tyrosine; (26) Phenylalanine at position 217 mutated to histidine; (27) Phenylalanine at position 217 mutated to lysine; (28) Alanine at position 218 mutated to valine; (29) Glutamic acid at position 221 mutated to alanine; (30) Phenylalanine at position 403 mutated to alanine; (31) Phenylalanine at position 403 mutated to glutamic acid; (32) Phenylalanine at position 403 mutated to serine; (33) Phenylalanine at position 403 mutated to tyrosine.

[0185] The gene encoding the protein is also within the protection scope of the present invention, and the gene sequence is shown in the sequence listing.

[0186] Table 1 Amino acid / nucleotide sequence of UGT85A1

[0187] SEQ ID NO.1 UGT85A1 amino acid sequence SEQ ID NO.2 UGT85A1 nucleotide sequence

[0188] The specific sequence information is as follows:

[0189] SEQ ID NO.1 (UGT85A1 amino acid sequence)

[0190] MGSQIIHNSQKPHVVCVPYPAQGHINPMMRVAKLLHARGFYVTFVNTVYNHNRFLRSRGSNALDGLPSFRFESIADGLPETDMDATQDITALCESTMKNCLAPFRELLQRINAGDNVPPVSCIVSDGCMSFTLDVAEELGVPEVLFWTTSGCAFLAYLHFYLFIEKGLCPLKDESYLTKEYLEDTVIDFIPTMKNVKLKDIPSFIRTTNPDDVMISFALRETERAKRASAIILNTFDDLEHDVVHAMQSILPPVYSVGPLHLLANREIEEGSEIGMMSSNLWKEEMECLDWLDTKTQNSVIYINFGSITVLSVKQLVEFAWGLAGSGKEFLWVIRPDLVAGEEAMVPPDFLMET KDRSMLASWCPQEKVLSHPAIGGFLTHCGWNSILESLSCGVPMVCWPFFADQQMNCKFCCDEWDVGIEIGGDVKREEVEAVVRELMDGEKGKKMREKAVEWQRLAEKATEHKLGSSVMNFETVVSKFLLGQKSQD*

[0191] SEQ ID NO.2 (UGT85A1 nucleotide sequence)

[0192]

[0193] Table 2 Nucleotide sequence of the mutant (except for the different bases at the mutation site, the rest are exactly the same as SEQ ID NO.2)

[0194]

[0195]

[0196] The mutants described in the present invention can be used in vitro or in vivo. The in vivo application involves constructing the following yeast strains and fermenting and expressing metabolites: ① expressing the glycosyltransferase mutant in the Saccharomyces cerevisiae genome; ② expressing the glycosyltransferase mutant in Saccharomyces cerevisiae using a plasmid; ③ expressing the glycosyltransferase mutant in the Escherichia coli genome; ④ expressing the glycosyltransferase mutant in Escherichia coli using a plasmid. The in vitro application involves transforming the gene encoding the glycosyltransferase mutant into Escherichia coli, generating a recombinant vector to express the protein, and then incubating the protein with a substrate in vitro to obtain the metabolite.

[0197] Regarding the in vitro application of glycosyltransferase mutant proteins, the present invention provides:

[0198] A recombinant vector comprising a nucleic acid encoding the aforementioned glycosyltransferase mutant. In some embodiments of the present invention, the backbone vector of the recombinant vector is PET28.

[0199] Also provided is a host cell for transforming or transfecting the recombinant vector. In some embodiments, the host cell is Escherichia coli. In some specific embodiments, the host cell is Escherichia coli BL21 (DE3).

[0200] The method for preparing the mutant of the present invention comprises: fermenting the host cell to obtain a fermentation broth containing the mutant. After obtaining the fermentation broth, the mutant can be purified, or the fermentation broth can be used alone as an enzyme for the reaction.

[0201] The present invention also provides a method for preparing salidroside, which comprises mixing a substrate with the mutant or the mutant obtained by the preparation method, and incubating the mixture to obtain salidroside.

[0202] In the present invention, the substrates are tyrosol and UDP-glucose, the incubation buffer is 50 mmol / L Tris-HCl (pH=7.5), the concentration of the tyrosol substrate is 2 mmol / L, the concentration of UDP-glucose is 5 mmol / L, and the incubation condition is 30° C. for 1 hour.

[0203] The method for comparing mutants and wild-type proteins in the present invention involves reacting different UGT85A1 mutants expressed in the aforementioned Saccharomyces cerevisiae with the substrate tyrosol in a whole-cell reaction, or reacting different UGT85A1 mutants expressed in Escherichia coli with the substrate tyrosol in a whole-cell reaction, or co-incubating different extracted recombinant UGT85A1 mutant proteins with tyrosol and UDP-glucose, and comparing the conversion rates of tyrosol to salidroside by the different mutant proteins and the wild-type protein. This experiment uses high-performance liquid chromatography to detect the amount of salidroside produced to determine the conversion rate. Specific experimental methods and data are provided in the inventive method.

[0204] The catalytic efficiency of the glycosyltransferase mutant UGT85A1 for tyrosol is significantly higher than that of the wild type, and the mutant has good application prospects.

[0205] In addition, the present invention also provides a method for preparing hydroxysalidroside, which comprises mixing a substrate with the mutant or the mutant obtained by the preparation method, and incubating the mixture to obtain hydroxysalidroside.

[0206] In the present invention, the substrates are hydroxytyrosol and UDP-glucose, the incubation buffer is 50 mmol / L Tris-HCl (pH=7.5), the concentration of the hydroxytyrosol substrate is 2 mmol / L, the concentration of UDP-glucose is 5 mmol / L, and the incubation condition is 30° C. for 1 hour.

[0207] The method for comparing mutants and wild-type proteins in the present invention involves reacting different UGT85A1 mutants expressed in the aforementioned Saccharomyces cerevisiae with the substrate hydroxytyrosol in a whole-cell reaction, or using different UGT85A1 mutants expressed in Escherichia coli to react with the substrate hydroxytyrosol in a whole-cell reaction, or co-incubating different extracted recombinant UGT85A1 mutant proteins with hydroxytyrosol and UDP-glucose, and comparing the differences in the conversion rates of hydroxytyrosol to hydroxysalidroside catalyzed by the different mutant proteins and the wild-type protein. This experiment uses high-performance liquid chromatography to detect the amount of hydroxysalidroside produced to determine the conversion rate. The specific experimental methods and data are described in the inventive method.

[0208] The glycosyltransferase mutant UGT85A1 of the present invention has significantly higher catalytic efficiency for hydroxytyrosol than the wild type, and has good application prospects.

[0209] The applications of the mutant UGT85A1 of the present invention include:

[0210] 1. Expression of glycosyltransferase UGT85A1 mutant protein and its application in vitro

[0211] 1) The gene encoding the glycosyltransferase UGT85A1 mutant was inserted into the Escherichia coli expression vector PET28a-MBP to obtain a recombinant vector.

[0212] 2) The above recombinant vector was transformed into the expression Escherichia coli BL21 (DE3).

[0213] 3) The above strains were inoculated into LB medium (50 μg / mL kanamycin) and cultured overnight.

[0214] 4) Transfer the cells to LB medium (50 μg / mL kanamycin), grow to OD600 = 0.6-0.8, add IPTG at a final concentration of 0.2 mmol / L, and induce expression overnight at 16°C and 220 rpm.

[0215] 5) Collect the cells, disrupt the cells, and centrifuge to collect the supernatant. After incubation with nickel colloid, use a buffer low in imidazole (20 mmol / L imidazole) to elute contaminants. Then, use a buffer containing 250 mmol / L imidazole to collect the mutant protein. Buffer: 50 mmol / L Tris-HCl, pH 7.5, 500 mmol / L sodium chloride, 10% glycerol.

[0216] 6) The eluted protein was dialyzed into a buffer solution of 50 mmol / L Tris-HCl, pH 7.5, 500 mmol / L sodium chloride, and 10% glycerol.

[0217] 7) The protein obtained in steps 1) to 6) above was incubated with tyrosol and UDP-glucose at 30° C. for 1 hour.

[0218] 8) The yield of salidroside was detected by high performance liquid chromatography.

[0219] 9) The protein obtained in steps 1) to 6) above was incubated with hydroxytyrosol and UDP-glucose at 30° C. for 1 hour.

[0220] 10) The yield of hydroxysalidroside was detected by high performance liquid chromatography.

[0221] 2. Application in engineered strains of Saccharomyces cerevisiae

[0222] 1) A promoter is added to the front of the gene encoding the glycosyltransferase UGT85A1 mutant to form a gene expression cassette and integrated into the genome of the Saccharomyces cerevisiae strain; or a plasmid is used to express the gene expression cassette encoding the glycosyltransferase UGT85A1 mutant in Saccharomyces cerevisiae.

[0223] 2) The engineered Saccharomyces cerevisiae bacteria expressing the glycosyltransferase UGT85A1 mutant protein obtained above were cultured to obtain a Saccharomyces cerevisiae seed liquid.

[0224] 3) inoculating the brewer's yeast seed liquid into a fermentation medium with or without tyrosol added, and fermenting to obtain a fermentation liquid.

[0225] 4) Detect the yield of salidroside using high performance liquid chromatography.

[0226] 5) The cerevisiae yeast seed solution in the above 2) is inoculated into a fermentation medium with or without hydroxytyrosol added thereto, and fermented to obtain a fermentation liquid.

[0227] 6) Detect the yield of hydroxysalidroside using high performance liquid chromatography.

[0228] Experiments of the present invention demonstrate that, compared with the wild-type glycosyltransferase UGT85A1, the expression of a mutant glycosyltransferase UGT85A1 in Saccharomyces cerevisiae can effectively convert tyrosol in the Saccharomyces cerevisiae or tyrosol in the culture medium into salidroside, significantly increasing the yield of salidroside and showing good prospects for industrial application. Furthermore, compared with the wild-type glycosyltransferase UGT85A1, the expression of a mutant glycosyltransferase UGT85A1 in Saccharomyces cerevisiae can effectively convert hydroxytyrosol in the Saccharomyces cerevisiae or hydroxytyrosol in the culture medium into hydroxysalidroside, significantly increasing the yield of hydroxysalidroside and showing good prospects for industrial application.

[0229] 3. Application in Escherichia coli

[0230] 1) The gene encoding the glycosyltransferase UGT85A1 mutant was inserted into the Escherichia coli expression vector PET28a-MBP to obtain a recombinant vector.

[0231] 2) The above recombinant vector was transformed into the expression Escherichia coli BL21 (DE3).

[0232] 3) The above strains were inoculated into LB medium (50 μg / mL kanamycin) and cultured overnight.

[0233] 4) Transfer the cells to LB medium (50 μg / mL kanamycin), grow to OD600 = 0.6-0.8, add IPTG at a final concentration of 0.2 mmol / L, and induce expression overnight at 16°C and 220 rpm.

[0234] 5) Collecting the bacterial cells to obtain wet Escherichia coli cells containing the recombinantly expressed glycosyltransferase UGT85A1 mutant.

[0235] 6) The above bacteria were added to M9Y medium (ingredients: 5 g / L yeast extract, 1 g / L NH4Cl, 6 g / LNa2HPO4, 3 g / L KH2PO4, 0.5 g / L NaCl, 246.5 mg / L MgSO4·7H2O, 14.7 mg / L CaCl2·2H2O, 20 g / L glucose), 2 mmol / L tyrosol was added, and the culture was incubated at 30°C, 220 rpm for 8 hours to obtain salidroside.

[0236] 7) The yield of salidroside was detected by high performance liquid chromatography.

[0237] 8) The cells from 5) were added to M9Y medium (5 g / L yeast extract, 1 g / L NH4Cl, 6 g / L Na2HPO4, 3 g / L KH2PO4, 0.5 g / L NaCl, 246.5 mg / L MgSO4·7H2O, 14.7 mg / L CaCl2·2H2O, 20 g / L glucose), 2 mmol / L hydroxytyrosol was added, and the mixture was incubated at 30°C, 220 rpm for 8 hours to obtain hydroxysalidroside.

[0238] 9) The yield of hydroxysalidroside was detected by high performance liquid chromatography.

[0239] Unless otherwise specified, the glycosyltransferase UGT85A1 mutant provided by the present invention and the raw materials and reagents used in its application can be purchased from the market.

[0240] The present invention will be further described below in conjunction with the embodiments:

[0241] Example 1: Conversion of Tyrosol to Salidroside and Hydroxytyrosol to Hydroxysalidroside by Whole Cells of Saccharomyces cerevisiae Expressing UGT85A1 Mutant

[0242] 1) The gene encoding glycosyltransferase UGT85A1 (SEQ ID NO. 2) was inserted into the PUC19-TEF1p-PGK1t vector with the TEF1p promoter and the PGK1t terminator to form an expression cassette.

[0243] 2) Point mutations were used to obtain UGT85A1 mutants, and PCR amplification was performed using the primers listed in Table 3 below.

[0244] Table 3 PCR amplification primers

[0245]

[0246]

[0247] PCR amplification conditions are as follows:

[0248] Denaturation was performed at 95°C for 10 minutes, followed by 25 cycles of 98°C for 30 seconds, 58°C for 30 seconds, and 72°C for 5 minutes. Finally, extension was performed at 72°C for 5 minutes. The product was treated with DpnI for 2 hours, and the PCR product was recovered. Transformation into Escherichia coli DH5α was performed, and the plasmid was sequenced and used to confirm its correctness. This yielded an expression cassette for the aforementioned mutant of the glycosyltransferase UGT85A1.

[0249] 3) CRISPR / Cas9-mediated genome knock-in technology was used on the genome of the original strain CEN.PK2-1C (ATCC: MYA-1110); the gene knock-in method uses a plasmid carrying the gene for the Cas9 protein and a sequence for transcribing sgRNA. The transcribed sgRNA binds to the Cas9 protein. Only a gene spacer and homologous recombination fragment that pair with the target gene need to be introduced into the plasmid. The reconstructed plasmid is then introduced into the cell. Because the designed homologous recombination fragment contains an expression cassette for the glycosyltransferase UGT85A1 mutant, the target gene that was severed in the yeast eukaryotic cell is repaired by homologous recombination using the homologous arms on the plasmid as a template, thereby completing the purpose of gene knock-in.

[0250] spacer: CAACAATTGTTACAATAGTA(SEQ ID NO.96)

[0251] Homology arms:

[0252] Left homology arm (SEQ ID NO.97):

[0253] TCGAACGTAAATTAAATGGATGTAAGAAAACTGTATTACATAAGTCATGAAGTAGGCATGCAAGTATATACCTATAGATGCATATAAATCAGTGGAGAAGGCCACTATCCTTCAGAGATCAAAAAACCTTTTTTTATCTTGAAAACGCCCTCATTCCTTTTGGACGTTTTCAAACTTTTGTTCATGCGATTGCAAATTTGAGCCTCTTCTATCTTTCTTGAACACTGGGGGTATTTCAC CATTATCAATTAAGTCATCAATCTCATCGCCTGGCTTACCCCAATTACCCTTGCCGGAACCTTGCTTCTTGATGTGATTTGGAGATTCACCGTAGTTACCAGTGTGCGAAAAGTACTTTGGATCAGCCTTTCCTTCACGTTCGGTCCACTTGTTTGTTCTCGTCATTTTTTCTGATTGGTTGTACACTTGAGCGGTTTGTTACTGTTGATTGTTCGTTTATTTGTATAATTGAGTTTACA

[0254] Right homology arm (SEQ ID NO.98):

[0255] GTAATTAGGGCCAAGAGAGTGACAAAAAGCAAACTTATAAATAGTCCTTTTATACAAATGACAAGTGTTCGCTTCTGCGCTCGCAGCCCCTGTTTTCGAAGGAGTTTCTTAGCCTAAGCTAGGCAGGCGCGCCCCCATTATCTATCCCTTCATTGCTTACTGAGAGGTTTTCCTCCCCCCCTCCCGGTATATTTCCTCCGCTGGAGAAAATTAGTTGTGGGACGGATAGCATCACTTAATTC TGTACCTTTTTGAAACTGGCTTGGTACTTTCTGTTGGATAGCAACATTTCCCGCTGGGATACTTCAACATGGGCTATGAATTTTCTTTTGTCTTTTATCTTTTATCTTTTATCTTTTATCTTTAAATTATTTGAGCTCGGTTAAGTTCATAACTATTGCGTGCCCGAATGGTATTCTTTCAATTCACAACCAAACATTAAAATGAAGAAAGCATACTCTTATATTATATCAATGTCTTTTTCTT

[0256] Thus, an engineered yeast strain expressing the above mutant of glycosyltransferase UGT85A1 on the yeast genome was obtained.

[0257] Construction process (conversion-verification):

[0258] 1. Inoculate the target strain (CEN.PK2-1C) in 4 mL of YPD and shake at 30°C overnight;

[0259] 2. Take 2 mL of bacterial solution and add it to 50 mL of YPD, incubate at 30°C for 6 h, and OD600 = 0.8-1.0;

[0260] 3. Centrifuge at 3000 rpm for 2 min and discard the supernatant.

[0261] 4. Boil the ssDNA sample for 10 minutes and quickly put it into ice;

[0262] 5. Resuspend the cells in 50 mL of sterile water and centrifuge;

[0263] 6. Resuspend with 1 mL of 100 mmol / L LiAc, centrifuge at 12000 rpm for 3 seconds, and aspirate the supernatant.

[0264] 7. Resuspend the cells to a final volume of 500 μL, add approximately 400 μL of 100 mmol / L LiAc, divide into 50 μL / tube, centrifuge, and discard the supernatant;

[0265] 8. Add the "Conversion Mixture" in the following order:

[0266] 240 μL PEG3350 (50%)

[0267] 36 μL 1 mol / L LiAc

[0268] 10 μL ssDNA (10 mg / mL)

[0269] 50 μL 1 μg of Cas9 plasmid with spacer and 10 μg of homology arm fragment

[0270] 9. Vortex each reaction tube until the cells are completely mixed;

[0271] 10. Keep at 30℃ for 30min;

[0272] 11. Heat shock at 42°C for 25 minutes;

[0273] 12. Incubate in YPD medium for 4 hours at 30°C and 220 rpm.

[0274] 13. Coat the plate with YPD-G418 resistant plate.

[0275] The above is the transformation process;

[0276] 14. Colonies grow on the plate to be transformed, and single clones are picked for PCR to obtain the target fragment. Sanger sequencing is used to verify whether the glycosyltransferase UGT85A1 mutant is correctly knocked into Saccharomyces cerevisiae.

[0277] 15. Select the successfully verified clones and culture them in YPD for 24 hours at 30°C and 220 rpm.

[0278] 4) Salidroside fermentation method:

[0279] 1. Cultivate the Saccharomyces cerevisiae strain on a YPD plate to activate the Saccharomyces cerevisiae strain;

[0280] 2. Pick a single clone and culture it in 4mL YPD liquid for 18 hours;

[0281] 3. Transfer 4 mL of YPD culture solution to 50 mL of YPD medium at a ratio of 1.5:50, add 5 g / L tyrosol to the medium, and culture at 30°C and 220 rpm for 96 hours;

[0282] 4. Collect the supernatant of the fermentation liquid to obtain the fermentation liquid containing salidroside.

[0283] 5) Salidroside detection method

[0284] The detection method of the method of the present invention is to detect the content of salidroside by high performance liquid chromatography.

[0285] General HPLC conditions: The fermentation broth / reaction liquid sample volume was 10 μL. The mobile phases were A and D, with A consisting of 0.1% formic acid in water and D consisting of acetonitrile. The HPLC instrument was an Agilent 1260 with an Agilent EC-C18 column (Agilent, 4 μm, 4.6 mm × 150 mm). The mobile phases A and D were 0.1% (v / v) formic acid in water and chromatography-grade acetonitrile. From 0 to 11 minutes, the mobile phases were 94% A and 6% D; from 11 to 14 minutes, the linear gradient of 94% A was reduced to 4% and the linear gradient of 6% D was increased to 96%; from 14 to 16 minutes, the mobile phases were 4% A and 96% D; from 16 to 21 minutes, the mobile phases were 94% A and 6% D. The detection wavelength was 224 nm, the column oven was 35°C, and the flow rate was 1 mL / min. The peak time of salidroside is 8.917min.

[0286] 6) Hydroxysalidroside fermentation method:

[0287] 1. Cultivate the Saccharomyces cerevisiae strain on a YPD plate to activate the Saccharomyces cerevisiae strain;

[0288] 2. Pick a single clone and culture it in 4mL YPD liquid for 18 hours;

[0289] 3. Transfer 4 mL of YPD culture solution to 50 mL of YPD medium at a ratio of 1.5:50, add 2.5 g / L hydroxytyrosol to the medium, and culture at 30°C and 220 rpm for 96 hours;

[0290] 4. Collect the supernatant of the fermentation liquid to obtain the fermentation liquid containing hydroxysalidroside.

[0291] 7) Detection method of hydroxysalidroside

[0292] The detection method of the method of the present invention is to detect the content of hydroxysalidroside by high performance liquid chromatography.

[0293] General HPLC conditions: The fermentation broth / reaction liquid sample volume was 10 μL. The mobile phases were A and D, with A consisting of 0.1% formic acid in water and D consisting of acetonitrile. The HPLC instrument was an Agilent 1260 with an Agilent EC-C18 column (Agilent, 4 μm, 4.6 mm × 150 mm). The mobile phases A and D were 0.1% (v / v) formic acid in water and chromatography-grade acetonitrile. From 0 to 11 minutes, the mobile phases were 94% A and 6% D; from 11 to 14 minutes, the linear gradient of 94% A was reduced to 4% and the linear gradient of 6% D was increased to 96%; from 14 to 16 minutes, the mobile phases were 4% A and 96% D; from 16 to 21 minutes, the mobile phases were 94% A and 6% D. The detection wavelength was 224 nm, the column oven was 35°C, and the flow rate was 1 mL / min. The peak time of hydroxysalidroside is 5.365min.

[0294] 8) Drawing of standard curve

[0295] 1. Tyrosol standard curve drawing (results are shown in Table 4, Figure 1 )

[0296] Table 4 Tyrosol standard curve

[0297] Tyrosol concentration (g / L) Peak area (mAU) 0.0640625 1674.334 0.128125 3365.454 0.25625 6672.774 0.5125 13175.053 1.025 25271.398

[0298] 2. Salidroside curve drawing (results are shown in Table 5, Figure 2 )

[0299] Table 5 Salidroside standard curve

[0300] Salidroside concentration (g / L) Peak area (mAU) 0.018125 230.765 0.03625 427.984 0.0725 872.114 0.145 1708.424 0.29 3412.371 0.58 6790.552 1.16 13297.739

[0301] 3. Hydroxytyrosol standard curve drawing (results are shown in Table 6, Figure 3 )

[0302] Table 6 Hydroxytyrosol standard curve

[0303] Hydroxytyrosol (g / L) Peak area (mAu) 0.0078125 121.008 0.015625 288.041 0.03125 576.778 0.0625 1183.745 0.125 2394.75 0.25 4715.086 0.5 9306.653 1 18313.314

[0304] 4. Draw the standard curve of hydroxysalidroside (results are shown in Table 7, Figure 4 )

[0305] Table 7 Hydroxysalidroside standard curve

[0306]

[0307]

[0308] 9) The yields of salidroside from mutants expressing different glycosyltransferases UGT85A1 are shown in Table 8 below. The differences between the mutants and the wild type were analyzed using the t-test, and the graphs are shown in Figure 8. Figure 5 As shown:

[0309] Table 8 Salidroside yield in 5 g / L tyrosol in the transformation medium of different excellent glycosyltransferase UGT85A1 mutants expressed in Saccharomyces cerevisiae CEN.PK2-1C

[0310] UGT85A1 Salidroside production (g / L) P-value Significant difference analysis wild type 0.414±0.029 1 No significant difference P20A 4.627±0.117 0.000001303684 P<0.01, extremely significant difference P20S 1.038±0.007 0.00241229 P<0.01, extremely significant difference D88A 2.437±0.076 0.000006597294 P<0.01, extremely significant difference D88I 2.999±0.688 0.0100621 P<0.05, significant difference D88L 2.172±0.027 0.0000002493831 P<0.01, extremely significant difference I89A 0.536±0.032 0.0165239 P<0.05, significant difference I89V 1.777±0.053 0.00202842 P<0.01, extremely significant difference C93A 2.574±0.169 0.00005908098 P<0.01, extremely significant difference G114E 0.823±0.031 0.00682166 P<0.01, extremely significant difference G114K 1.615±0.013 0.000737738 P<0.01, extremely significant difference C128A 0.939±0.034 0.00003674671 P<0.01, extremely significant difference C128G 1.452±0.036 0.000002473645 P<0.01, extremely significant difference W147A 0.716±0.01 0.000003194344 P<0.01, extremely significant difference T149A 0.897±0.02 0.00001541689 P<0.01, extremely significant difference Y157A 1.483±0.02 0.0000005564445 P<0.01, extremely significant difference F204A 1.456±0.01 0.00000001797316 P<0.01, extremely significant difference M214A 1.217±0.019 0.00197317 P<0.01, extremely significant difference M214F 1.031±0.005 0.00237846 P<0.01, extremely significant difference F217A 2.513±0.052 0.0000006097678 P<0.01, extremely significant difference F217Y 1.1±0.631 0.00287857 P<0.01, extremely significant difference F217Q 3.09±0.573 0.0045493 P<0.01, extremely significant difference F217H 2.056±0.579 0.0342367 P<0.05, significant difference F217K 1.35±0.308 0.0273127 P<0.05, significant difference A218V 2.078±0.03 0.000327207 P<0.01, extremely significant difference E221A 1.122±0.071 0.00017218 P<0.01, extremely significant difference F403A 1.451±0.024 0.000003030476 P<0.01, extremely significant difference F403E 1.09±0.331 0.00456758 P<0.01, extremely significant difference F403S 1.24±0.026 0.00001817689 P<0.01, extremely significant difference F403Y 0.837±0.006 0.000686021 P<0.01, extremely significant difference G114K / F217Q 4.02±0.02 0.00000009800609 P<0.01, extremely significant difference G114D / F217H 1.93±0.028 0.0000002110264 P<0.01, extremely significant difference G114D / F217H / C128G 3.88±0.044 0.00000004406214 P<0.01, extremely significant difference G114D / F217H / C128G / A37S 4.17±0.003 0.000000000002490256 P<0.01, extremely significant difference

[0311] 10) The mutants described above all catalyzed tyrosol production in Saccharomyces cerevisiae at higher yields than the wild-type. We also designed other mutants, but these were found to be less effective than the wild-type or inactive. Plasmid construction, PCR amplification conditions, yeast transformation, screening, fermentation, and product detection methods were all consistent with those listed above.

[0312] Specifically, the UGT85A1 mutant that is less effective than the wild type is one in which the amino acid sequence shown in SEQ ID NO. 1 is mutated to one of the following:

[0313] (1) Proline at position 20 mutated to threonine; (2) Proline at position 20 mutated to phenylalanine; (3) Proline at position 20 mutated to valine; (4) Isoleucine at position 89 mutated to alanine; (5) Isoleucine at position 89 mutated to phenylalanine; (6) Cysteine ​​at position 93 mutated to serine; (7) Alanine at position 113 mutated to aspartic acid; (8) Tyrosine at position 157 mutated to phenylalanine; (9) Tyrosine at position 157 mutated to leucine; (10) Phenylalanine at position 217 mutated to aspartic acid; (11) Phenylalanine at position 217 mutated to arginine; (12) Alanine at position 218 mutated to phenylalanine; (13) Alanine at position 218 mutated to isoleucine; (14) Isoleucine at position 308 mutated to phenylalanine; (15) Isoleucine at position 308 mutated to alanine.

[0314] 11) Point mutations were used to obtain UGT85A1 mutants, and PCR amplification was performed using the primers listed in Table 9 below.

[0315] Table 9 PCR primers

[0316]

[0317]

[0318] 12) The yields of salidroside from the mutants expressing different glycosyltransferases UGT85A1 are shown in Table 10 below. The differences between the mutants and the wild type were analyzed using the t-test, and the graphs are shown in Figure 10. Figure 6 As shown:

[0319] Table 10 Salidroside yields in 5 g / L tyrosol in the transformation medium of different mutants of glycosyltransferase UGT85A1 with poor or even inactive expression in Saccharomyces cerevisiae CEN.PK2-1C

[0320] UGT85A1 Salidroside production (g / L) P-value Significant difference analysis wild type 0.414±0.029 1 No significant difference P20T 0 0.00508334 P<0.01, extremely significant difference P20F 0 0.00508334 P<0.01, extremely significant difference P20V 0 0.00508334 P<0.01, extremely significant difference I89A 0.423±0.005 0.795637 P>0.05, no significant difference I89F 0.163±0.082 0.103627 P>0.05, no significant difference C93S 0.395±0.006 0.598811 P>0.05, no significant difference A113D 0.216±0.216 0.460661 P>0.05, no significant difference Y157F 0.051±0.001 0.00662582 P<0.01, extremely significant difference Y157L 0.217±0.013 0.0262895 P<0.05, significant difference F217D 0.356±0.106 0.00586821 P<0.01, extremely significant difference F217R 0.273±0.021 0.060804 P>0.05, no significant difference A218F 0.115±0.094 0.0935903 P>0.05, no significant difference A218I 0.421±0.039 0.906549 P>0.05, no significant difference I308A 0.012±0.004 0.00549597 P<0.01, extremely significant difference I308F 0.056±0.03 0.0138618 P<0.05, significant difference

[0321] 13) The yields of hydroxysalidroside from the mutants expressing different glycosyltransferases UGT85A1 are shown in Table 11. The differences between the mutants and the wild type were analyzed using the t-test, and the graphs are shown in Figure 11. Figure 9 As shown:

[0322] Table 11 Salidroside yields in 2.5 g / L tyrosol in the transformation medium of different mutants of glycosyltransferase UGT85A1 expressing different effects in Saccharomyces cerevisiae CEN.PK2-1C

[0323] UGT85A1 Hydroxysalidroside yield (g / L) P-value Significant difference analysis wild type 0.023±0.003 1 No significant difference G114D / F217H 0.914±0.04 0.000006306841 P<0.01, extremely significant difference G114D / F217H / C128G 2.119±0.051 0.0000005333433 P<0.01, extremely significant difference

[0324] Example 2: Conversion of tyrosol to salidroside by site-directed saturation mutagenesis of UGT85A1 in Escherichia coli to obtain whole cells expressing the UGT85A1 mutant

[0325] Using the gene encoding UGT85A1 protein (SEQ ID NO. 2) as a template, PCR amplification was performed using the primers listed in Table 12 below.

[0326] Table 12 PCR primers

[0327]

[0328] 1) PCR amplification conditions are as follows:

[0329] First, pre-denaturation was performed at 95°C for 10 min, followed by 25 cycles of 98°C for 30 s, 58°C for 30 s, and 72°C for 1 min 30 s; finally, extension was performed at 72°C for 5 min.

[0330] 2) Recover the PCR product from gel to obtain the target fragment.

[0331] 3) The PCR product was transformed into a linearized PET28a-MBP vector with an MBP tag for homologous recombination and ligated for 1 hour, and then transformed into Escherichia coli to obtain recombinant bacteria.

[0332] 4) The extracted plasmid was verified by Sanger sequencing to obtain the expression vector PET28a-MBP-UGT85A1.

[0333] 5) Site-directed saturation mutagenesis: Using the vector PET28a-MBP-UGT85A1 as a template, site-directed saturation mutagenesis was performed at the G114 amino acid site. The primers are shown in Table 13:

[0334] Table 13 Site-directed saturation mutagenesis primers

[0335]

[0336] PCR amplification conditions are as follows:

[0337] First, pre-denaturation was performed at 95°C for 10 min, followed by 25 cycles of 98°C for 30 s, 58°C for 30 s, and 72°C for 5 min; finally, extension was performed at 72°C for 5 min.

[0338] 6) The PCR amplification product was digested with DpnI for 2 h, and the digested product was transformed into E. coli BL21 (DE3) competent cells. Recombinant bacteria containing mutations were obtained by selecting single clones.

[0339] 7) 96 mutants were selected for each point and whole-cell reactions were performed to screen mutants with higher activity.

[0340] Here’s how:

[0341] 96 Escherichia coli carrying mutant gene plasmids were selected and inoculated into 400 μL of a deep-well plate containing a culture medium containing kanamycin (50 μg / mL), and cultured overnight at 37° C. and 700 rpm for 16 to 18 hours.

[0342] The overnight cultured seed solution was transferred to a 1 mL deep-well plate containing kanamycin (50 μg / mL) culture medium at a ratio of 1:50 and cultured at 37°C, 700 rpm for 4 hours to keep the OD600 between 0.6 and 0.8.

[0343] The deep-well plate was placed in an ice bath for 20 to 30 minutes to cool the bacteria, and then IPTG was added to a final concentration of 0.2 mmol / L. Protein expression was induced at 16°C and 700 rpm for 16 to 18 hours.

[0344] Centrifuge, collect the bacteria, and resuspend the cells in M9Y medium. By controlling the bacterial amount, the protein content is indirectly controlled to ensure that the amount of bacteria used in the reaction is consistent.

[0345] The reaction volume was controlled to be 500 μL, the concentration of the exogenously added substrate tyrosol was 2 mmol / L, and the reaction was carried out at 30° C. and 700 rpm for 5 h.

[0346] After the reaction time was over, an equal volume (500 μL) of methanol was added and mixed thoroughly with the reaction solution to terminate the reaction.

[0347] 8) The amount of salidroside produced in the supernatant of the whole-cell reaction solution was measured using high-performance liquid chromatography. The mutants were compared with the wild type, and strains with higher salidroside production were selected. The plasmids were extracted and sequenced. It was found that mutating glycine at position 114 to aspartic acid increased the specific enzyme activity by 17.4%, mutating to isoleucine increased the specific enzyme activity by 15.2%, mutating to serine increased the specific enzyme activity by 15%, and mutating to lysine increased the specific enzyme activity by 1.67%.

[0348] Example 3: Expressing UGT85A1 Combination Mutations in E. coli to Obtain UGT85A1 Mutants with High Catalytic Activity

[0349] 1) Based on Example 2, the G114D mutant was selected to continue iterative saturation mutagenesis of the following amino acid F217, and the primers are shown in Table 14:

[0350] Table 14 Iterative saturation mutagenesis primers

[0351]

[0352] 2) PCR amplification conditions are as follows:

[0353] First, pre-denaturation was performed at 95°C for 10 min, followed by 25 cycles of 98°C for 30 s, 58°C for 30 s, and 72°C for 5 min; finally, extension was performed at 72°C for 5 min.

[0354] 3) The PCR amplification product of the first round was added to DpnI for digestion for 2 hours, and the digested product was transformed into E. coli BL21 (DE3) competent cells, and recombinant bacteria containing mutations were obtained by selecting single clones. 96 mutants were selected for whole-cell reaction and salidroside was detected by high-performance liquid chromatography (the method was consistent with that in Example 2) to screen mutants with higher activity. Based on the mutants with the highest performance in the first round, a second round of mutations was performed, and 96 mutants were selected for enzyme activity detection to screen mutants with higher activity. It was finally found that the specific enzyme activity of the mutants in Table 15 below was improved:

[0355] Table 15 Specific enzyme activity of mutants

[0356] mutant Specific enzyme activity wild type 1 G114D / F217H double mutant 2.43 G114D / F217N double mutant 1.95 G114D / F217T double mutant 1.72 G114D / F217V double mutant 1.62 G114D / F217C double mutant 1.56 G114D / F217E double mutant 1.51 G114D / F217S double mutant 1.47

[0357] 4) Based on the G114D / F217H double mutant, iterative saturation mutagenesis of amino acid C128 was continued. The primers are shown in Table 16 below:

[0358] Table 16 Iterative saturation mutagenesis primers

[0359]

[0360] 5) PCR amplification conditions are as follows:

[0361] First, pre-denaturation was performed at 95°C for 10 min, followed by 25 cycles of 98°C for 30 s, 58°C for 30 s, and 72°C for 5 min; finally, extension was performed at 72°C for 5 min.

[0362] 6) The PCR amplification product was digested with DpnI for 2 h. The digested product was transformed into E. coli BL21 (DE3) competent cells, and recombinant bacteria containing mutations were obtained by selecting single clones. 96 mutants were selected for whole-cell reactions and salidroside was detected by high-performance liquid chromatography (the method was consistent with that in Example 2). Mutants with higher activity were screened, and it was found that the mutants shown in Table 17 below had improved specific enzyme activities:

[0363] Table 17 Specific enzyme activity of mutants

[0364]

[0365]

[0366] Example 4 Expression of glycosyltransferase UGT85A1 mutant and in vitro reaction to prepare salidroside

[0367] 1) Some of the Escherichia coli BL21 (DE3) carrying the UGT85A1 mutants described in Examples 2 and 3 were selected.

[0368] 2) The above strain was inoculated into 4 mL of LB medium (50 μg / mL kanamycin) and cultured overnight.

[0369] 3) Transfer the cells to 1 L LB medium (50 μg / mL kanamycin), grow to OD600 = 0.6-0.8, add IPTG to a final concentration of 0.2 mmol / L, and induce expression overnight at 16°C, 220 rpm.

[0370] 4) Collect the cells, disrupt the cells, and centrifuge to collect the supernatant. After incubation with nickel colloid, use a buffer low in imidazole (20 mmol / L imidazole) to elute contaminants. Then, use a buffer containing 250 mmol / L imidazole to collect the mutant protein. Buffer: 50 mmol / L Tris-HCl, pH 7.5, 500 mmol / L sodium chloride, 10% glycerol.

[0371] 5) The eluted protein was dialyzed into a buffer solution of 50 mmol / L Tris-HCl, pH 7.5, 500 mmol / L sodium chloride, and 10% glycerol.

[0372] 6) 1 μmol of the protein obtained above was incubated with 2 mmol / L tyrosol and 5 mmol / L UDP-glucose at 30° C. for 1 hour to obtain salidroside.

[0373] 7) The amount of salidroside produced in the supernatant was detected by high performance liquid chromatography, and the amount of salidroside produced by the mutant was compared with the amount of salidroside produced by the wild type.

[0374] 8) The specific activities of different mutants are shown in Table 18. The yield of salidroside by pure enzyme reaction is shown in Table 18. Figure 7 As shown:

[0375] Table 18 Salidroside yields from pure enzyme reactions of different UGT85A1 mutants

[0376] UGT85A1 protein Vitality wild type 1 G114D 1.22 G114D / F217H double mutant 2.42 G114D / F217H / C128G triple mutant 7.08 G114D / F217H / C128A triple mutant 5.53 G114D / F217H / C128S triple mutant 6.54

[0377] Example 5: Expressing the UGT85A1 mutant in high-tyrosol-producing Saccharomyces cerevisiae to obtain high-salidroside-producing Saccharomyces cerevisiae

[0378] 1) Using the genome of Saccharomyces cerevisiae CEN.PK2-1C as a template, PCR was used to amplify the ARO2, ARO10, TKL1, RKI1 gene fragments and ARO4, ARO7, and ARO3 fragments;

[0379] 2) Obtaining ARO4 by point mutation K229L , ARO7 G141S , ARO3 D154N mutants;

[0380] 3) Express the above genes using the constitutive promoter of Saccharomyces cerevisiae and construct them into the pRS406 and pRS404 integration plasmids;

[0381] 4) Knockout the PDC1 and PHA2 genes in the aforementioned Saccharomyces cerevisiae using CRISPR-Cas9;

[0382] PDC1-spacer:ATTGGATCTGACTCCTCACG(SEQ ID NO.137);

[0383] PDC1 homology arm (SEQ ID NO.138):

[0384] ACAGCAGAAAATGACGATAGTTCCATAAATATGTATCCCGTGTATGCGTATTT GCCATCCATATCTAAAATTGGCACAATTGAACAACCCTGATAGAAAGGAATCATTTC TGTTGGAAA;

[0385] PHA2-spacer: GGGGGATAGAGGCTGCTGGG (SEQ ID NO. 139);

[0386] PHA2 homology arm (SEQ ID NO.140):

[0387] AGGTACGTATTCCCATCAAGCTGCATTACAACAATTTCAATCAACATCTGATGT TGAGTAAATGTTTTAACCAATTGGAGAACGACACTAGTATAGATTATTCAGTGGTAC CGTTGG;

[0388] 5) The above integration plasmid was integrated into Saccharomyces cerevisiae CEN.PK2-1C to obtain a high-tyrosol-producing chassis Saccharomyces cerevisiae. This was fermented using YPD medium, and the tyrosol yield was 1350 mg / L. This resulted in an engineered Saccharomyces cerevisiae strain with high tyrosol production.

[0389] 6) The gene encoding the UGT85A1 mutant was inserted into the pRS403-TEF1p-PGK1t vector with the TEF1p promoter and the PGK1t terminator to form an expression cassette, and the plasmid was digested with NheI and recovered.

[0390] 7) The linearized expression cassette was transformed into a high-tyrosol-producing Saccharomyces cerevisiae strain, and sequencing confirmed that it was successfully integrated into the Saccharomyces cerevisiae genome, thereby obtaining the high-salidroside-producing Saccharomyces cerevisiae strain.

[0391] Example 6 Preparation of Salidroside by Fermentation of Strain Producing Salidroside

[0392] 1. Fermentation method

[0393] 1) culturing the high-salidroside-producing Saccharomyces cerevisiae strain in Example 5 on a YPD plate to activate the Saccharomyces cerevisiae strain;

[0394] 2) Pick a single colony and add it to 4 mL of YPD liquid and culture for 18 hours;

[0395] 3) Transfer 4 mL of YPD culture to 50 mL of YPD at a ratio of 1.5:50 and incubate at 30°C, 220 rpm for 96 hours;

[0396] 4) collecting the supernatant of the fermentation broth to obtain a fermentation broth containing salidroside; and detecting the yield of salidroside by HPLC.

[0397] 2. Test results

[0398] Using wild-type UGT85A1 as a reference and salidroside production as a standard, the production of salidroside by expressing different UGT85A1 mutants based on a high-tyrosol-producing strain was obtained. The specific production is shown in Table 19 below. The differences between the mutants and the wild type were analyzed using a t-test and plotted as shown in Figure 19. Figure 8 Finally, using YPD medium in a shake flask, the UGT85A1 mutant (G114D / F217H / C128G) was expressed with the highest salidroside production, reaching 2.639 g / L, which is 41 times that of the wild type, showing a very good advantage.

[0399] Table 19 Salidroside production by expressing different UGT85A1 mutants in high tyrosol-producing Saccharomyces cerevisiae strains

[0400] High tyrosol-producing strains (expressing different mutants) Salidroside production (g / L) P-value Significant difference analysis wild type 0.064±0.001 1 No significant difference G114D / F217H 1.607±0.136 0.00008721605 P<0.01, extremely significant difference G114D / F217H / C128G 2.639±0.006 0.0000056795 P<0.01, extremely significant difference

[0401] Example 7: Expressing the UGT85A1 mutant in high-hydroxytyrosol-producing Saccharomyces cerevisiae to obtain Saccharomyces cerevisiae capable of producing hydroxysalidroside

[0402] 1. Construction of high-yield hydroxytyrosol strain

[0403] 1) Using the high-tyrosol-producing strain in Example 5 as the base strain, the HpaBC gene (PaHpaB and EcHpaC genes) was integrated into the strain genome to construct a high-hydroxytyrosol-producing strain, which was fermented using YPD medium. The hydroxytyrosol yield was 1120 mg / L.

[0404] 2) The gene encoding the UGT85A1 mutant was inserted into the pRS403-TEF1p-PGK1t vector with the TEF1p promoter and the PGK1t terminator to form an expression cassette, and the plasmid was digested with NheI and recovered.

[0405] 3) The linearized expression cassette was transformed into a high-hydroxytyrosol-producing Saccharomyces cerevisiae strain, and sequencing confirmed that it was successfully integrated into the Saccharomyces cerevisiae genome, thereby obtaining the Saccharomyces cerevisiae capable of producing hydroxysalidroside.

[0406] 2. Fermentation method

[0407] 1) culturing the Saccharomyces cerevisiae strain producing hydroxysalidroside described in 1 above on a YPD plate to activate the Saccharomyces cerevisiae strain;

[0408] 2) Pick a single colony and add it to 4 mL of YPD liquid and culture for 18 hours;

[0409] 3) Transfer 4 mL of YPD culture to 50 mL of YPD at a ratio of 1.5:50 and incubate at 30°C, 220 rpm for 96 hours;

[0410] 4) collecting the fermentation broth supernatant to obtain a fermentation broth containing hydroxysalidroside; and detecting the yield of hydroxysalidroside by HPLC.

[0411] 3. Test results

[0412] Using wild-type UGT85A1 as a reference and hydroxysalidroside production as a standard, the production of hydroxysalidroside by expressing different UGT85A1 mutants based on a high-hydroxytyrosol-producing strain was obtained. The specific production is shown in Table 20 below. The differences between the mutants and the wild type were analyzed using a t-test and plotted as shown in the figure. Figure 10 Finally, the UGT85A1 mutant (G114D / F217H / C128G) was expressed in YPD medium in a shake flask, and the yield of hydroxysalidroside was the highest, reaching 1.057 g / L, which was 17 times that of the wild type, showing a very good advantage.

[0413] Table 20 Hydroxysalidroside production of different UGT85A1 mutants expressed in high hydroxytyrosol-producing Saccharomyces cerevisiae strains

[0414] High tyrosol-producing strains (expressing different mutants) Hydroxysalidroside yield (g / L) P-value Significant difference analysis wild type 0.062±0.005 1 No significant difference G114D 0.074±0.015 0.352824 P>0.05No significant difference G114D / F217H 0.560±0.065 0.000413448 P<0.01, extremely significant difference G114D / F217H / C128G 1.057±0.065 0.00002744402 P<0.01, extremely significant difference

[0415] Table 21HpaBC gene sequence table

[0416] SEQ ID No.133 PaHpaB sequence SEQ ID NO.134 EcHpaC sequence

[0417] SEQ ID NO.141 (PaHpaB nucleotide sequence)

[0418]

[0419] SEQ ID NO.142 (EcHpaC nucleotide sequence)

[0420] ATGCAATTGGACGAACAAAGATTGAGATTCAGAGACGCTATGGCTTCTTTGTCTGCTGCTGTTAACATCATCACTACTGAAGGTGACGCTGGTCAATGTGGTATCACTGCTACTGCTGTTTGTTCTGT TACTGACACTCCACCATCTTTGATGGTTTGTATCAACGCTAACTCTGCTATGAACCCAGTTTTCCAAGGTAACGGTAAGTTGTGTGTTAACGTTTTGAACCACGAACAAGAATTGATGGCTAGACACT TCGCTGGTATGACTGGTATGGCTATGGAAGAAAGATTCTCTTTGTCTTGTTGGCAAAAGGGTCCATTGGCTCAACCAGTTTTGAAGGGTTCTTTGGCTTCTTTGGAAGGTGAAATCAGAGACGTTCAA GCTATCGGTACTCACTTGGTTTACTTGGTTGAAATCAAGAACATCATCTTGTCTGCTGAAGGTCACGGTTTGATCTACTTCAAGAGAAGATTCCACCCAGTTATGTTGGAAATGGAAGCTGCTATCTAA

[0421] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A mutant of glycosyltransferase UGT85A1, characterized in that It includes mutations in any one or more of P20, D88, I89, C93, G114, C128, W147, T149, Y157, F204, M214, F217, A218, E221 or F403.

2. The mutant according to claim 1, wherein The mutation of P20 includes but is not limited to mutation to A or S; and / or Mutations of D88 include, but are not limited to, mutations to A, I, or L; and / or Mutations of I89 include but are not limited to mutations to A, V; and / or Mutations of C93 include but are not limited to mutations to A; and / or Mutations of G114 include, but are not limited to, mutations to D, K, E, I, or S; and / or Mutations of C128 include, but are not limited to, mutations to G, A, or S; and / or Mutations of W147 include but are not limited to mutation to A; and / or Mutations of T149 include but are not limited to mutation to A; and / or Mutations of Y157 include, but are not limited to, mutation to A; and / or Mutations of F204 include but are not limited to mutation to A; and / or Mutations of M214 include but are not limited to mutations to A or F; and / or Mutations of F217 include, but are not limited to, mutations to A, Y, Q, H, K, N, T, V, C, E, or S; and / or Mutations of A218 include, but are not limited to, mutation to V; and / or Mutations of E221 include, but are not limited to, mutation to A; and / or Mutations of F403 include, but are not limited to, mutations to A, E, S, or Y.

3. The mutant according to claim 1 or 2, characterized in that Include any of the following: (I), G114D, F217H, C128G, A37S; or (II), G114D, F217H, and C128G; or (III), G114D, F217H; or (IV), G114K and F217Q; or (V), P20A; or (VI), P20S; or (VII), D88A; or (VIII), D88I; or (IX), D88L; or (X), I89A (XI), I89V; or (XII), C93A (XIII), G114E; or (XIV), G114K; or (XV), C128A (XVI), C128G; or (XVII), W147A (XVIII), T149A (XIX), Y157A (XX), F204A (XXI), M214A; or (XXII), M214F; or (XXIII), F217A (XXIV), F217Y; or (XXV), F217Q; or (XXVI), F217H; or (XXVII), F217K; or (XXVIII), A218V; or (XXIX), E221A (XXX), F403A; or (XXXI), F403E; or (XXXII), F403S; or (XXXIII), F403Y.

4. A nucleic acid molecule encoding the mutant according to any one of claims 1 to 3.

5. The nucleic acid molecule according to claim 4, wherein It has: (1), such as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID The nucleotide sequence shown in NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.35; or (II) a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I) but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar functions as the nucleotide sequence shown in (I) or (II); or (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).

6. An expression cassette, characterized in that Comprising the nucleic acid molecule according to claim 4 or 5.

7. A recombinant expression vector, characterized in that: Comprising the expression cassette and backbone vector as claimed in claim 6.

8. A host, characterized in that include: (I), the nucleic acid molecule according to claim 4 or 5; and / or (II), the expression cassette of claim 6; and / or (III) The recombinant expression vector according to claim 7.

9. Use of any of the following in the preparation of salidroside and / or hydroxysalidroside: (I), the mutant according to any one of claims 1 to 3; and / or (II), the nucleic acid molecule according to claim 4 or 5; and / or (III), the expression cassette according to claim 6; and / or (IV), the recombinant expression vector according to claim 7; and / or (V) The host according to claim 8.

10. A method for preparing salidroside and / or hydroxysalidroside, characterized in that: Including the preparation of salidroside based on any of the following items: (I), the mutant according to any one of claims 1 to 3; and / or (II), the nucleic acid molecule according to claim 4 or 5; and / or (III), the expression cassette according to claim 6; and / or (IV) the recombinant expression vector according to claim 7; and / or (V) the host according to claim 8.