Single-stranded small deoxyribonucleic acid targeting multiple classes of viruses and use thereof

By designing a stable complex between single-stranded small deoxyribonucleic acid (ss-sDNA) and conserved regions of virus-like sequences, the problems of single target, easy hydrolysis, and low delivery efficiency of ds-sRNA were solved, achieving efficient targeted silencing and broad-spectrum control of nine types of viruses.

CN120624441BActive Publication Date: 2026-07-24GUIZHOU UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510724270.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2026-07-24
Estimated Expiration
2045-05-29

AI Technical Summary

Technical Problem

In existing technologies, double-stranded small RNAs (ds-sRNAs) targeting viruses suffer from insufficient target breadth, easy hydrolysis, and low delivery efficiency, making it difficult to effectively prevent and control co-infections of multiple virus types.

Method used

A single-stranded small deoxyribonucleic acid (ss-sDNA) was designed with the nucleotide sequence 5'-ACAGGGTTTTCACCCTTCCTT-3', a length of 21nt, and a single-stranded linear structure. It can form a stable double-stranded complex with the conserved region of a virus-like sequence, achieving efficient targeted silencing.

Benefits of technology

This ss-sDNA can significantly inhibit the titers of 9 types of viruses, reducing them by 10%-39%, and the disease index by 3.3%-17.4%. It also has good permeability and persistence in plant cells, with a continuous effect lasting for more than 6 days.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624441B_ABST
    Figure CN120624441B_ABST
Patent Text Reader

Abstract

The application discloses a kind of single-chain small deoxyribonucleic acid targeting multiple viruses and application thereof.The nucleotide sequence of the single-chain small deoxyribonucleic acid is 5'-ACAGGGTTTTCACCCTTCCTT-3', which targets the highly conserved region of 9 kinds of viruses infecting tomato, realizes the synergistic silencing effect of "one target multi-control". Compared with traditional ds-sRNA, the ss-sDNA of the application shows higher stability and viroid RNA interference efficiency in plants. Experiments prove that, compared with ds-sRNA, 20-25 μM concentration of ss-sDNA foliar spraying or stem injection can reduce the titers of 9 kinds of viruses and plant disease index by 10%-39% and 3.3%-17.4% respectively. The application provides a new type of nucleic acid pesticide for viroid disease, which is efficient, broad-spectrum and environment-friendly.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant gene silencing control technology, and in particular to a single-stranded small deoxyribonucleic acid that targets multiple virus types and its applications. Background Technology

[0002] Viroids are a class of small, single-stranded, closed RNA molecules. Smaller than viruses, with genomes ranging from 240 to 430 bp, they lack the protein coat typically found in viruses, making them the smallest known pathogens. Viroids can be classified into two families: Pospiviroidae (potato tuber viroids) and Avsunviroidae (avocado sunspot viroids). They infect the apical meristems and reproductive organs of plants, exhibiting high infection rates and a wide host range, making them important quarantine and seed-transmitted pathogens. Viroids can cause stunted growth, reproductive organ malformations, and loss of marketability. Due to their relatively recent discovery, and because their symptoms are similar to viral diseases, they are often treated as viral diseases for control purposes, resulting in limited effectiveness.

[0003] There are at least 30 known diseases affecting tomatoes, of which more than 10 can cause significant yield reductions, and new and prevalent diseases are increasingly emerging. Previous studies have detected various viral viroids on tomato seeds and plants, including Citrus exocortis viroid, Columnea latent viroid, Pepper chat fruitviroid, Potato spindle tuber viroid, Tomato chlorotic dwarf viroid, Tomato planta machoviroid, and Tomato apical stunt viroid, indicating that tomatoes can be infected with a variety of viruses.

[0004] Traditional methods for controlling viral diseases (such as antiviral protein induction and capsid protein vaccines) are completely ineffective against viroids because viroids lack a protein coat. Host plants can induce the degradation of the viroid genome through post-transcriptional silencing. Double-stranded small RNAs (ds-sRNAs) targeting viroid genome sequences have been developed. Serving as a template for the post-transcriptional silencing mechanism, ds-sRNAs, when applied as nucleic acid pesticides, can target and degrade viroid genome sequences. Although ds-sRNA application technology provides a new approach to plant disease resistance, the ds-sRNA developed for the application of RNA interference (RNAi) against viroids faces the following key obstacles: 1. The target breadth of currently developed ds-sRNAs is insufficient: There are diverse types of viroids in the field, and multiple viroids often cause co-infection. Conventional targeted ds-sRNA designs based on single viroid sequences are difficult to effectively cover multiple pathogens; 2. Easily hydrolyzed in vivo: ds-sRNA is easily degraded rapidly by RNases in plants, resulting in a short half-life; 3. Delivery efficiency needs to be improved: ds-sRNA has a large molecular weight (>50nt), and usually needs to be combined with some nanomaterials to improve cell penetration. Summary of the Invention

[0005] The purpose of this invention is to provide a single-stranded small deoxyribonucleic acid (ss-sDNA) targeting multiple viroids and its applications, thereby addressing the problems existing in the prior art. Through molecular characteristic optimization and innovative silencing mechanisms, it achieves highly efficient targeted silencing of viroid RNA genomes. This single-stranded small deoxyribonucleic acid (ss-sDNA) can target and silence nine tomato-related viroids, and its application methods are particularly suitable for the precise control of complex infectious diseases, laying a technical foundation for the development of universal novel nucleic acid pesticides for viroid diseases.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a single-stranded small deoxyribonucleic acid (SDNA) with the nucleotide sequence 5'-ACAGGGTTTTCACCCTTCCTT-3' (SEQ ID NO.1) and a length of 21 nt. Its spatial conformation is a single-stranded linear structure, which can form a stable double-stranded complex with conserved regions of viroid sequences.

[0008] The present invention also provides the application of the single-stranded small deoxyribonucleic acid described above in the preparation of pesticide formulations for the prevention and control of viruses.

[0009] Preferably, the single-stranded small deoxyribonucleic acid (ss-sDNA) is used to target and silence the sequence conserved regions of the following nine viruses: Potato spindle tuber viroid (MW311909.1), Tomato chlorotic dwarf viroid (OM867867.1), Tomato apical dwarf viroid (JN872142.1), Mexican papitaviroid (L78459.1), Tomato planta macho viroid (K00817.1), Chrysanthemum dwarf viroid 1 (KX096367.1), Chrysanthemum dwarf viroid 2 (MN718672.1), and Pepper fruit cracking viroid (…). Chat fruitviroid (JF742638.1) and Columnea latent viroid (JF446917.1). The base matching rate within the target region was 100%.

[0010] The present invention also provides a method for preventing and controlling tomato viruses, including the step of infecting tomato plants with the single-stranded small deoxyribonucleic acid.

[0011] Preferably, the infection method includes foliar spraying or stem injection of the tomato plant.

[0012] Preferably, the infection concentration of the single-stranded small deoxyribonucleic acid is 10–25 μM.

[0013] More preferably, the infection concentration of the single-stranded small deoxyribonucleic acid is 20–25 μM.

[0014] Preferably, the infection cycle of the single-stranded small deoxyribonucleic acid is: once every 3 days, for a total of 3 times.

[0015] Preferably, the infection period of the single-stranded small deoxyribonucleic acid is within 1 to 2 days after the initial appearance of symptoms.

[0016] The present invention also provides a pesticide formulation for preventing and controlling viroids, the pesticide formulation comprising the aforementioned single-stranded small deoxyribonucleic acid.

[0017] Preferably, the viroids include: potato spindle tuberviroid, tomato chlorotic dwarfviroid, tomato apical stunt viroid, Mexican papita viroid, tomato planta macho viroid, chrysanthemum stuntviroid, pepper chat fruit viroid, and columnealatent viroid.

[0018] The present invention discloses the following technical effects:

[0019] (1) This invention addresses the bottlenecks in viroid control, such as poor stability, single target, and low delivery efficiency of ds-sRNA. Through systematic research, our team has achieved the following breakthroughs: We have designed and validated for the first time a single-stranded small deoxyribonucleic acid (ss-sDNA) molecule (5'-ACAGGGTTTTCACCCTTCCTT-3'). Through molecular characteristic optimization (21nt single-stranded structure, 50% reduction in molecular weight compared to traditional dsRNA) and innovative silencing mechanism (using DNA to mimic RNA, inducing post-transcriptional silencing), we have achieved highly efficient targeted silencing of viroid RNA genomes. This ss-sDNA targets conserved sequences of nine types of viruses that can infect tomatoes, with a 100% binding rate to the target region.

[0020] (2) The ss-sDNA provided by the present invention has a significantly higher titer reduction rate for 9 types of viruses than ds-sRNA, and the titer reduction rate of viroids is concentrated between 10% and 39%.

[0021] (3) The disease index of most viruses was suppressed more than that of ds-sRNA, and the reduction of the plant disease index was mainly concentrated between 3.3% and 17.4%.

[0022] (4) It can penetrate into all tissue cells.

[0023] (5) The persistence is that ss-sDNA can still be detected in various organs 6 days after infection, and the silencing efficiency remains at a high level.

[0024] (6) Advantages compared to existing technologies include: high efficiency: at the same concentration, ss-sDNA silencing efficiency is significantly improved compared to dsRNA; broad spectrum: a single sequence can simultaneously silence 9 types of viruses, while traditional ds-sRNA can only target a single type. Experiments have confirmed that this molecule has better silencing efficiency for viroid genomes than ds-sRNA, a better broad spectrum effect, and strong penetration into plant cells, laying a technical foundation for the development of a universal new nucleic acid pesticide for viroid diseases. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 Photographs of tomato plants infected / uninfected with 9 types of viruses; A: Healthy control; B: Potato tuber spindle viroid; C: Tomato chlorosis dwarf viroid; D: Tomato apical dwarf viroid; E: Mexican poppy viroid; F: Tomato male plant viroid; G: Chrysanthemum dwarfing viroid 1; H: Chrysanthemum dwarfing viroid 2; I: Pepper fruit cracking viroid; J: Latent viroid of the genus *Goldfish Flower*.

[0027] Figure 2 The images show the osmotic localization of ss-sDNA in tomato cells after foliar spraying and stem injection; A: Distribution of ss-sDNA in stems (longitudinal section); B: Distribution of ss-sDNA in petioles (transverse section); C: Distribution of ss-sDNA in leaves (longitudinal section); D: Distribution of ss-sDNA in stem tips (longitudinal section); Red fluorescence indicates cell wall autoluminescence; Green fluorescence indicates ss-sDNA.

[0028] Figure 3 The persistence of ds-sRNA and ss-sDNA in tomato cells was detected 6 days after stem injection; A: presence of ds-sRNA; B: presence of ss-sDNA; red fluorescence indicates cell wall autoluminescence; green fluorescence indicates the presence of small nucleic acid signals. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0033] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0034] Example 1: Screening, artificial synthesis, and inoculation of 9 types of tomato viruses

[0035] 1. Screening of viroid species with conserved sequences of 21 nt or more.

[0036] One hundred viral genome sequences were randomly selected from the NCBI GenBank public bioinformatics database. After downloading them in FASTA format, the homology of the genome sequences was analyzed using sequence alignment tools, and nine types of viruses with 21 nt identical base sequences were screened out, as shown in Table 1.

[0037] Table 19 Information on Test Viruses

[0038]

[0039]

[0040] 2. Artificial synthesis of 9 types of viruses

[0041] The viroid cDNA genome was artificially synthesized using a gene synthesizer, and the sequence information was obtained from NCBI GenBank. The T-easy (Shanghai Zeye, ZY-62479) recombinant plasmid (created by Beijing Qingke) containing the artificially synthesized viroid genome was digested at 37°C using restriction endonucleases Sac I (TaKaRa, Japan) or Spe I (TaKaRa, Japan). The linearized recombinant plasmid containing the target fragment was transcribed in vitro using T7 RNA polymerase (Shanghai Beyotime) according to the manufacturer's instructions and reaction conditions. The RNA viroid whole genome product was stored at -20°C for later use.

[0042] 3. Artificial inoculation of 9 types of viruses on tomatoes

[0043] The in vitro transcription products of nine different viruses were dissolved in 1% K2HPO4 buffer and mechanically inoculated onto the lowest unfolded leaves of four-leaf-one-heart tomato seedlings of the A1isa Craig variety using sterile quartz sand. Approximately 200 ng was inoculated per plant. Inoculation with K2HPO4 buffer served as a negative control. Ten strains of each virus were inoculated as one replicate, with a total of three replicates.

[0044] After inoculation, the plants were cultured in an environment with 18 hours of light / 6 hours of darkness, 20% light intensity, day / night temperature of 25℃ / 18℃, and 80% relative humidity.

[0045] Thirty days after infection, leaves from 10 plants were collected and combined into one sample. The infection status of various viruses in the leaves was detected by RT-PCR and RT-qPCR, and the symptoms were recorded. Symptoms are as follows: Figure 1 As shown in Table 2, the primers used for RT-PCR and RT-qPCR detection are listed below.

[0046] Table 2 Primers used for detection

[0047]

[0048]

[0049] RT-PCR amplification system (20 μL): 1 μL template, 7 μL ddH2O, 10 μL 2×RealStar Fast SYBR qPCR Mix, and 1 μL each of forward and reverse primers.

[0050] RT-PCR amplification program: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 60℃ annealing for 20 s, 72℃ extension for 30 s, 40 cycles; 95℃ denaturation for 10 s; 65℃ annealing for 60 s, 97℃ extension for 1 s, 37℃ extension for 30 s; store at 4℃.

[0051] Depend on Figure 1It can be seen that all nine types of viruses can affect the normal growth of tomato plants.

[0052] Example 2: Design, synthesis, and aqueous solution preparation of ss-sDNA

[0053] 1. Design of ss-sDNA

[0054] Based on the conserved base sequences of the above nine viruses, a targeted ss-sDNA nucleotide sequence was designed. The nucleotide sequence is 5'-ACAGGGTTTTCACCCTTCCTT-3' (SEQ ID NO.1), with a length of 21 nt. The target regions of the ss-sDNA for the nine viruses are shown in the thickened base region (target region sequence thickened).

[0055] (1) Potato spindle tuber viroid (MW311909.1) is 359 bp long:

[0056] cggaactaaactcgtggttcctgtggttcacatctgacctcctgagcagaaaagaaaaaagaaggcggctcggaggagcgcttcagggatccccggggaaacctggagcgaactggcaaaaaaggacggtggggagtgcccagcggccgacaggagtaattcccgccgaaacagggtttt cacccttcctttcttcgggtgtccttcctcgcgcccgcaggaccacccctcgccccctttgcgctgtcgcttcggctactacccggtgga aacaactgaagctcccgagaaccgctttttctctatcttacttgcttcggggcgagggtgtttagcccttggaaccgcagttggttcct.

[0057] (2) Tomato chlorotic dwarf virus (OM867867.1) is 360 bp long:

[0058] cggaactaaactcgtggttcctgtggttcacacctgacctcctgtgcagaaaagaaaaaagataggcggctcggaggagcgcttcagggatccccggggaaacctggagcgaactggcaaaaggcggcagggagcttgtggaaggcgaaacaggagtaatcccgtgtagaaacagggttttcacccttcctttcttctgcggtttccttcctttgcgcgccactcgacccctcgcccccttgcgctgtcgcttcggcaactacccggtggaaacaactgaagctcccgagaaccgctttttctctatcttgctgctaccggggcgagggtgtttagcccttggaaccgcagttggttcct。

[0059] (3) Tomato apical stunt viroid (JN872142.1) is 364 bp long:

[0060] cgggaactttcttgaggttcctgtggtgctcacctgaccctgcaggcatcaagaaaaaagaatggcgcggaggagaagaagtccttcagggatccccggggaaacctggaggaagtcgaggtcgggggcttcggactactccttcgtgagacaggagtaatccccgctgaaacagggttttcacccttcctttcttcgggtttccttcctctcgcctggagaggtcttcggccctcgcccggagcttctctctggagactacccggtggaaacaactgaagcttcaaccctctcgcgctttttctctatctttgttgctctccgggcgagggtgaaagcccgtggaaccctggaaggagtccct。

[0061] (4) Mexican papita viroid (L78459.1) is 360 bp long:

[0062] cgggatcttttccttgtggttcctgtggttcacacctgacctccagcccaggaaagaaaaaagaaaggcggctcggaggagcgcttcagggatccccggggaaacctggagcgaactggcaaaggagtcgcggctggggagtctcctcagacaggagtaatccccgctgaaacagggttttcacccttcctttcttcgggtttccttcctctgtggtcgacaccctcgcccgcctctctgcgctgtcgcttcggctactacccggtggaaacaactgaagctcccgagaaccgctttttctctatcttgctggcgcaggggcgagggtggaaagccctggaacccgctggatgggtccct。

[0063] (5) Tomato plantamacho viroid (K00817.1) is 360 bp long:

[0064] cgggatcttttccttgtggttcctgtggtacacacctgacctcctgaccagaaaagaaaaaagaattgcggccaaaggagcgcttcagggatccccggggaaacctggagcgaactggcgaaggagtcgcggctggggagtctcccagacaggagtaatccccgctgaaacagggttttcacccttcctttcttcgggtttccttcctctgcggtcgacaccctcgcccgcttctcttgcgctgtcgcttcggagactacccggtggaaacaactgaagctcccaagcgccgctttttctctatcttgctggctccggggcgagggtggaaaaccctggaacccttcgaaaagggtccct。

[0065] (6) Chrysanthemum stunt viroid 1 (KX096367.') is 354 bp long:

[0066] aaagaaatgaggcgaagaagtccttcagggatccccggggaaacctggaggaagtccgacgagatcgcggctggggcttaggaccccactcctgcgagacaggagtaatcctaaacagggttttcacccttcctttagtttccttcctctcctggagaggtcttctgccctagcccggtcttcgaagcttcctttggctactacccggtggaaacaactgaagcttcaacgcctttttttcctatcttctttagcaccgggctagggagtaagcccgtggaaccttagttttgttccctcgggacttacttgtggttcctgtggtgcactcctgaccctgctgctttgaaagaa。

[0067] (7) Chrysanthemum stunt viroid 2 (MN718672.1) is 354 bp in length:

[0068] cgggacttacttgtggttcctgtggtgcactcctgaccctgctgctttgaaagaaaaagaaatgaggcgaagaagtccttcagggatccccggggaaacctggaggaagtccgacgagatcgcggctggggcttaggaccccactcctgcgagacaggagtaatcctaaacagggttttcacccttcctttagtttccttcctctcctggagaggtcttctgccctagcccggtcttcgaagcttcctttggctactacccggtggaaacaactgaagcttcaacgcctttttttcctatcttctttagcaccgggctagggagtaagcccgtggaaccttagttttgttccct。

[0069] (8) Pepper chat fruit viroid (JF742638.1) is 349 bp in length:

[0070] ccggattcttctaagggtgcctgtggtgcctcccccgaagcccgcttagggaaaaagaaaggggaagcaagcatctcctgttcagggatccccggggaaacctggacagaccgggcggagaagcgcacgagcggtaccgtcttctgacaggagtaatcccagtagaaacagggtt ttcacccttcctttcttcgggtttccttcctcagtcgaccggtccgcgtcggccttctcgcgcactgctgtccggctactacccggtggatacaactgacagaggtgctttttcttccacccgacttctaccgacgcggccgggagtgaagctacccgggacccgaggggatct.

[0071] (9) Columnea latent viroid (JF446917.1) is 368 bp long:

[0072] cggaactaaactcgtggttcctgtggttcacacctgaccctgcagccatgcaaaggaaaaagaacgggagagagagcgcaagagcggtctcaggagccccggggcaactcagaccgagcggggtcttgaccagtggcgagcgccctgttcagacaggagtaatcccagcagaaacagggttttc acccttcctttcttctggtttccttcctctgcttcagcggcctcgcccggagtcttgaccagcgcaggttctgacgcgaccggtggcatcac cgagtttcgctcaaagcctcaatctcctttttctcattctagcttggtctccgggcgagggtgtttagcccttggaaccgcagttggttcct.

[0073] 2. Synthesis of ss-sDNA

[0074] ss-sDNA was artificially synthesized using a gene synthesizer (Beijing Qingke), with a single-stranded linear spatial conformation. It was purified by HPLC with a purity of ≥98%.

[0075] 3. Preparation of aqueous solution for ss-sDNA

[0076] ss-sDNA was dissolved in sterile distilled water at room temperature, and the working solutions were prepared at concentrations of 0, 10, 15, 20, and 25 μM.

[0077] Example 3: Application of ss-sDNA in the resistance of virus-infected tomatoes

[0078] 1. Using ds-sRNA as a control, the efficiency of ss-sDNA interaction was detected.

[0079] ds-sRNA with a positive strand sequence of 5'-ACAGGGTTTTCACCCTTCCTT-3' was synthesized according to the above method. The ds-sRNA was dissolved in sterile distilled water at room temperature, with working solution concentrations of 0, 10, 15, 20, and 25 μM. ds-sRNA and ss-sDNA were sprayed onto nine virus-susceptible tomatoes via foliar spraying. The specific spraying method was as follows: using a 50 μm aperture atomizer, 2 mL of solution was sprayed per plant, ensuring uniform spraying on both sides of the leaves. Infection was performed every 3 days for a total of 3 times. The titers of various viruses in the leaves were detected by RT-qPCR (using the same primers as in Example 1). The titer represents the relative expression level of the viroid. -ΔΔCt The results were obtained by calculation using the method (Livak KJ, Schmittgen TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta DeltaC(T)) Method. Methods. 2001; 25(4):402-408). The experimental results are shown in Table 3. At the same time, the disease index of tomato plants was determined. The calculation method was as follows: Virus disease level 0: no symptoms; level 1: leaves slightly curled; level 2: leaves curled; level 3: level 2 + dwarfing; level 4: level 3 + partial leaf necrosis; level 5: level 4 + fewer leaves falling off; level 6: level 5 + leaf falling off; level 7: level 6 + stem necrosis spots. Disease index = [(number of diseased plants × disease level) / (total number of plants × 7)] × 100. The experimental results are shown in Table 4.

[0080] Table 3. Comparison of silencing genomic levels of ss-sDNA and ds-sRNA against nine tomato viruses (RT-qPCR results, control value normalized to 1).

[0081]

[0082] Table 4. Comparison of the inhibitory efficiency of ss-sDNA and ds-sRNA against nine types of viral diseases in tomatoes (results of disease index detection).

[0083]

[0084]

[0085] As shown in Tables 3 and 4, ss-sDNA was generally more effective than ds-sRNA in inhibiting viroids at all concentrations. Therefore, ss-sDNA was used as the research subject in subsequent studies. The differences in inhibition rates of viroid titers and disease index between the two are shown in Tables 5 and 6, respectively. The 20–25 μM ss-sDNA concentration showed the best effect, with no significant difference between the two concentrations. Therefore, 25 μM ss-sDNA was used for subsequent studies.

[0086] Table 5 shows the difference in inhibition rates of ds-sRNA and ss-sDNA against viroid titers.

[0087]

[0088] Note: The control sample values ​​are normalized to 1.00.

[0089] Table 6 shows the difference in inhibition rates of ds-sRNA and ss-sDNA against the viroid disease index.

[0090]

[0091]

[0092] The results in Tables 5 and 6 show that, compared with ds-sRNA, 25 μM ss-sDNA can reduce the titers of nine types of viruses and the plant disease index by 10%-39% and 3.3%-17.4%, respectively.

[0093] 2. Screening of infection modes

[0094] Foliar spraying: Using a 50μm aperture atomizer, spray 2mL of 25μM ss-sDNA solution per plant, ensuring even coverage on both sides of the leaves. The titers of various viruses in the leaves were detected by RT-qPCR, and the disease index of the tomato plants was also measured.

[0095] Stem injection: 25 μM ss-sDNA solution was injected into the stems of diseased tomatoes 5 cm above the growing substrate using a pipette, with an injection volume of 20 μL. The titers of various viruses in the leaves were detected by RT-qPCR, and the disease index of the tomato plants was also measured.

[0096] Infected once every 3 days, for a total of 3 times. The inhibitory efficiencies of 25 μM ss-sDNA on viroids by foliar spraying and stem injection are shown in Table 7.

[0097] Table 7. Inhibition efficiency of foliar spraying and stem injection against viroids.

[0098]

[0099]

[0100] As shown in Table 7, there was no significant difference in the silencing efficiency of foliar spraying and stem injection for the nine types of viruses, therefore both methods are applicable to this application.

[0101] Example 4 ss-sDNA permeability detection

[0102] 1. ss-sDNA marker

[0103] ss-sDNA was fluorescently labeled using the FAM labeling kit (AM1634, Thermo Fisher Scientific, USA), following the instructions.

[0104] 2. Preparation of the sample to be observed

[0105] 20 μL of labeled ss-sDNA was injected into the middle of the main stem of PSTVd-infected tomatoes. After incubation for 2 hours, tender and unfolded leaves from non-injection sites were selected, and after washing the surface, paraffin sections of petioles and leaves were prepared.

[0106] 3. Observation of ss-sDNA permeability

[0107] Confocal microscopy was performed using a ZEISS LSM780 laser scanning microscope (Germany). FAM-labeled sRNA was excited with a 495 nm laser, and fluorescence was detected at 520 nm. ddH₂O labeling was used as a control. Results are shown below. Figure 2 .Depend on Figure 2 It can be seen that the ss-sDNA fluorescent signal is distributed in most cells, indicating that ss-sDNA has good cell permeability.

[0108] Example 5: Observation of ss-sDNA persistence

[0109] 1. Observation of ss-sDNA resistance to degradation

[0110] Following the procedure described in Example 3, FAM-labeled ds-sRNA and ss-sDNA were injected into PSTVd ​​tomato stems. Samples were taken at 0, 2, 4, 6, 8, and 10 days after injection to observe the appearance of labeled fluorescence in the cells of each tissue. The results are shown in Table 8.

[0111] Table 8. Presence of intracellular fluorescence response at different days after small nucleic acid treatment.

[0112]

[0113] As shown in Table 8, compared with ds-sRNA, ss-sDNA has a longer persistence and stronger resistance to degradation; fluorescence can still be observed 6 days after treatment. Figure 3 The ds-sRNA fluorescence reaction disappeared on day 6.

[0114] 2. Detection of ss-sDNA antiviral efficacy

[0115] Following the procedure described in Example 3, FAM-labeled ds-sRNA and ss-sDNA were injected into the stems of PSTVd ​​tomatoes. Samples were taken at 0, 2, 4, 6, 8, and 10 days post-injection, and the viroid genome titer was detected using RT-qPCR. The results are shown in Table 9. Simultaneously, the disease index of plants at different days after treatment was calculated, and the results are shown in Table 10. Using ds-sRNA as a control, the sustained inhibitory effect of ss-sDNA on PSTVd ​​was comprehensively evaluated.

[0116] Table 9. Changes in PSTVd ​​titers at different days after small nucleic acid treatment.

[0117]

[0118] Table 10 Changes in disease index of infected plants at different days after small nucleic acid treatment.

[0119]

[0120] As shown in Tables 9 and 10, ss-sDNA exhibits stronger and more persistent inhibitory effects on viroid titer and disease index than ds-sRNA, thus demonstrating superior performance.

[0121] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A single-stranded small deoxyribonucleic acid, characterized in that, The nucleotide sequence of the single-stranded small deoxyribonucleic acid is 5'-ACAGGGTTTTCACCCTTCCTT-3'.

2. The application of the single-stranded small deoxyribonucleic acid as described in claim 1 in the preparation of antiviral pesticide formulations, characterized in that, The viroids mentioned are: Potato spindle tuber viroid, Tomato chlorotic dwarf viroid, Tomatoapical stunt viroid, Mexican papita viroid, Tomato planta macho viroid, Chrysanthemum stunt viroid, Pepper chat fruit viroid, and Columnea latentviroid.

3. A method for preventing and controlling tomato viroids, characterized in that, The method includes the step of infecting tomato plants with the single-stranded small deoxyribonucleic acid described in claim 1; the viroids are: Potato spindletuber viroid, Tomato chlorotic dwarf viroid, Tomato apical stunt viroid, Mexican papita viroid, Tomato planta macho viroid, Chrysanthemum stuntviroid, Pepper chat fruit viroid, and Columnealatent viroid.

4. The method for preventing and controlling tomato viroids as described in claim 3, characterized in that, The infection methods include foliar spraying or stem injection of the tomato plants.

5. The method for preventing and controlling tomato viroids as described in claim 3, characterized in that, The infection concentration of the single-stranded small deoxyribonucleic acid is 10~25 μM.

6. The method for preventing and controlling tomato viroids as described in claim 5, characterized in that, The infection concentration of the single-stranded small deoxyribonucleic acid is 20~25 μM.

7. The method for preventing and controlling tomato viroids as described in claim 3, characterized in that, The infection cycle of the single-stranded small deoxyribonucleic acid is: once every 3 days, for a total of 3 times.

8. A pesticide formulation for the prevention and control of viroids, characterized in that, The pesticide formulation includes the single-stranded small deoxyribonucleic acid as described in claim 1; the virus viroids are: Potato spindle tuberviroid, Tomato chlorotic dwarf viroid, Tomato apical stunt viroid, Mexican papita viroid, Tomato planta macho viroid, Chrysanthemum stuntviroid, Pepper chat fruit viroid, and Columnealatent viroid.

Citation Information

Patent Citations

  • Nucleic acid probe and kit for simultaneously detecting multiple tomato viroids and application of nucleic acid probe and kit

    CN113774053A

  • Virus-derived polynucleotides for modifying plants

    CN116964208A