Gene detection kit and detection system for carbamazepine medication guidance

By using ARMS and TaqMan fluorescent probe technology, specific primers and probes were designed, and a genetic testing kit for guiding carbamazepine medication was developed. This solves the problems of redundant detection sites and high costs in existing technologies, achieves precise individualized guidance for carbamazepine medication, reduces detection costs and improves detection efficiency.

CN120624629APending Publication Date: 2025-09-12CHONGQING PLOTONG INST OF GENETIC MEDICINE CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510656202.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-21
Publication Date
2025-09-12

AI Technical Summary

Technical Problem

In the existing technology, the genetic testing method for guiding carbamazepine medication has redundant testing sites, high costs, and is unable to completely exclude HLA-A*31:01 and HLA-B*15:02 genotypes, resulting in the inability to effectively predict medication risks.

Method used

Using ARMS technology and TaqMan fluorescent probe technology, we designed specific primers and probes and developed a genetic testing kit for guiding carbamazepine medication. This kit specifically detects HLA-A*31:01 and HLA-B*15:02 genotypes, and combines PCR reaction solution and quality control products to achieve rapid and accurate genetic polymorphism detection.

Benefits of technology

It has achieved high-sensitivity, low-cost, and easy-to-operate personalized medication guidance for carbamazepine, and can quickly and accurately detect HLA-A*31:01 and HLA-B*15:02 genotypes, reduce testing costs, improve testing efficiency, and reduce false positive results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624629A_ABST
    Figure CN120624629A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of carbamazepine medication guidance, and particularly relates to a gene detection kit and detection system for carbamazepine medication guidance, and the kit comprises a primer and a probe for detecting HLA-A * 31: 01 and HLA-B * 15: 02 genes, a primer and a probe for monitoring internal control genes, a PCR reaction liquid, a positive quality control product and a negative quality control product. The use method of the kit comprises the following steps: taking a blood sample containing the EDTA anticoagulant, and carrying out nucleic acid extraction; pre-mixing and packaging the gene detection reagent to respectively obtain a PCR reaction solution 1 and a PCR reaction solution 2 to jointly form a PCR reaction system; adding the obtained DNA into a PCR reaction system, uniformly mixing, and then carrying out PCR amplification; according to the present invention, the gene detection system comprises the kit, the PCR amplification reaction system and the gene typing interpretation system, and the kit and the system have characteristics of high sensitivity, low cost, simple operation, short detection period, intuitive interpretation and the like, and can rapidly and accurately detect the carbamazepine individualized medication gene polymorphism.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of carbamazepine medication guidance, and in particular relates to a gene detection kit and a detection system for carbamazepine medication guidance. Background Art

[0002] Carbamazepine is a neuropathic pain medication primarily used clinically for: 1. Treatment of multiple epileptic seizures, such as complex or simple partial seizures, secondary generalized seizures, and generalized seizures; 2. Treatment of trigeminal neuralgia and pharyngeal neuralgia, and also as a long-term preventive medication after trigeminal neuralgia resolves; 3. Prevention or treatment of manic-depressive disorder, as well as manic-depressive disorder that is refractory to or intolerant of lithium, antipsychotics, or antidepressants. It can be used alone or in combination with lithium and other antidepressants. Occasionally, some patients taking carbamazepine experience severe cutaneous adverse drug reactions, some of which can be life-threatening. Advances in human pharmacogenomics have shown that these severe cutaneous adverse reactions associated with carbamazepine are directly linked to specific human leukocyte antigen (HLA) genes. HLA (Human Leukocyte Antigen) is a protein molecule present on the surface of antigen-presenting cells that is responsible for antigen presentation. It is a sign of mutual recognition between immune cells of different individuals. It is the main genetic marker for the body to "distinguish between friend and foe, identify itself, and exclude aliens". It participates in the immune response and has very important biological functions.

[0003] On December 12, 2007, the U.S. Food and Drug Administration (FDA) released safety information regarding carbamazepine, stating that carbamazepine can cause dangerous, sometimes fatal, skin reactions (Stevens-Johnson syndrome and toxic epidermal necrolysis), particularly in patients with the human leukocyte antigen allele HLA-B*1502. A moderate association exists between the risk of hypersensitivity reactions and the presence of HLA-A*3101 in patients taking carbamazepine. Furthermore, the Clinical Pharmacogenetics Implementation Consortium (CPIC) published guidelines in 2013 regarding HLA-B genotype and carbamazepine dosing, which were updated in 2017 to include HLA genotype and the use of carbamazepine and oxcarbazepine. Both versions recognize that HLA-A*31:01 and HLA-B*15:02 are associated with serious adverse drug reactions caused by carbamazepine. The Netherlands Pharmacogenomics Working Group also released a report in April 2024 regarding gene-drug interactions between CYP2C9, HLA-A, and HLA-B genes and anti-epileptic drugs. Researchers believe that HLA-B*15:02 carriers are at significantly increased risk for severe cutaneous adverse reactions to phenytoin, carbamazepine, oxcarbazepine, and lamotrigine. For carbamazepine, the risk is also increased in HLA-A*31:01 carriers.

[0004] However, in the existing technologies for carbamazepine medication guidance, only the HLA-B*1502 genotype is tested, and the medication risk of patients with negative HLA-B*15:02 genotype and positive HLA-A31:01 genotype cannot be ruled out. Some existing technologies are used for comprehensive detection of anti-epileptic drug sites, with redundant detection sites, and most cover more than 30 sites. Among these sites, there are a large number of sites for which clinical evidence is unclear. At the same time, multi-site detection methods are limited to expensive time-of-flight mass spectrometry and NGS sequencing methods, which bring unnecessary expenses to clinical patients. As a result, the current application of genetic testing for carbamazepine medication guidance in clinical practice has been poor and has been unable to meet clinical testing needs. Summary of the Invention

[0005] To address the challenges of the prior art, the present invention provides a gene detection kit and system for carbamazepine medication guidance based on ARMS and TaqMan fluorescent probe technology. This kit and system offer high sensitivity, low cost, ease of use, a short detection cycle, and intuitive interpretation, enabling rapid and accurate detection of genetic polymorphisms for personalized carbamazepine medication.

[0006] The present invention solves the technical problem by adopting the following technical solutions:

[0007] The present invention aims to provide a gene detection kit for guiding carbamazepine medication, comprising primers and probes for detecting HLA-A*31:01 and HLA-B*15:02 genes.

[0008] Furthermore, the primer and probe sequences for detecting HLA-A*31:01 and HLA-B*15:02 genes are: SEQ ID NOs. 1-12, as shown in Table 1 below.

[0009] Table 1

[0010] Gene Primer name Sequence number sequence HLA-A*31:01 3101F1 SEQ ID NO.1 AGCGCAGGTCCTCGTTCAA 3101R1 SEQ ID NO.2 CTCACACCATCCAGATGATGTA 3101P1 SEQ ID NO.3 TCCTGCTGGTACCCG 3101F2 SEQ ID NO.4 CTGGTCCCAATACTCAGGCCT 3101R2 SEQ ID NO.5 CCCACTCCATGAGGTATTTCAC 3101P2 SEQ ID NO.6 GGGCGCCGTGGATA HLA-B*15:02 1502F1 SEQ ID NO.7 CGCCGTGTCCGCCG 1502R1 SEQ ID NO.8 GGTCTCACATCATCCAGAGGATG 1502P1 SEQ ID NO.9 GGCGGACTGGTCATACCC 1502F2 SEQ ID NO.10 CATGGCGCCCCGGG 1502R2 SEQ ID NO.11 GCAGGTTCCGCAGGCTC 1502P2 SEQ ID NO.12 GAGATCTGTGTGTTCCGGAC .

[0011] Furthermore, the kit also includes primers and probes for an internal control gene for monitoring, and the internal control gene is GAPDH.

[0012] Furthermore, the primer and probe sequences for detecting the internal control gene GAPDH are SEQ ID NO. 13-15; the sequences are as follows:

[0013] GAPDH-F: SEQ ID NO. 13;

[0014] GGCCACTAGGCGCTC;

[0015] GAPDH-R: SEQ ID NO. 14;

[0016] GCCACCCGCGAACTCA;

[0017] GAPDH-P probe (CY5-5'-3'-BHQ2): SEQ ID NO. 15;

[0018] CACCATGGGGAAGGTG.

[0019] Furthermore, the 5' end fluorescent group of the probe is a FAM, VIC, HEX, CY5, Texas Red or ROX fluorescent reporter group suitable for fluorescent quantitative PCR analysis, and the 3' end quencher group is a TAMRA, BHQ1, BHQ2, MGB or Dabcy1 fluorescent quencher group suitable for fluorescent quantitative PCR analysis.

[0020] Furthermore, the fluorescent group at the 5' end of the probes for the HLA-A*31:01, HLA-B*15:02 genes and the internal control gene is one of FAM, VIC, and CY5, and the quenching group at the 3' end is MGB or BHQ2.

[0021] Furthermore, the kit also includes PCR reaction solution, positive quality control product and negative quality control product.

[0022] The PCR reaction solution contains the hot-start Taq enzyme, UNG enzyme, buffer, magnesium ions, and dNTP substances required for the PCR reaction.

[0023] The method for obtaining positive quality control products is as follows: plasmids are constructed to synthesize sequence gene fragments based on the relevant segment sequence information of the HLA-A*31:01 and HLA-B*1502 genes published in the IPD_IMGT / HLA database, and then the fragments are inserted into the T vector. The Escherichia coli DH5α strain is used for transformation and plasmid extraction, and the plasmids are mixed in equal proportions to obtain the positive quality control product.

[0024] The negative control was deionized water treated with DEPC.

[0025] A method for using a gene detection kit for guiding carbamazepine medication, comprising the following steps:

[0026] 1) Take a blood sample containing EDTA anticoagulant for nucleic acid extraction;

[0027] 2) Premixing and subpackaging the gene detection reagents to obtain PCR reaction solution 1 and PCR reaction solution 2 to form a PCR reaction system;

[0028] 3) adding the DNA obtained in step 1) to the PCR reaction system in step 2), mixing and then performing PCR amplification;

[0029] 4) After the reaction is completed, genotyping is performed.

[0030] Furthermore, the conditions for the UNG enzyme reaction in the PCR amplification in step 3) are: 37° C., 10 minutes; the conditions for the UNG enzyme inactivation are: 95° C., 2 minutes;

[0031] A gene detection system for guiding carbamazepine medication comprises the reagent kit, a PCR amplification reaction system and a genotyping interpretation system.

[0032] The amplification conditions of the PCR amplification reaction system are a two-step method: denaturation: 95°C, 5 seconds; annealing and extension: 58°C, 30 seconds, set fluorescence signal collection; the number of cycles is set to 40.

[0033] Genotyping interpretation system: Under the above-mentioned PCR reaction system and cycling program conditions, an amplification Ct value ≤ 35 is detected, and an amplification curve is drawn based on the reaction results. The three fluorescence detection signals of the test sites No. 1-2 of the positive quality control products and the internal standard should form a logarithmic amplification "S" curve; the negative quality control products No. 1-2 should have no amplification curve or a Ct value of 0; observe whether the fluorescence detection signals of the test sites No. 1-2 form a logarithmic amplification "S" curve.

[0034] If the above conditions are met, observe the amplification curve of the sample reaction tube. If both the test signal and the internal standard signal form a logarithmic amplification "S"-shaped curve, the test sample contains the HLA-A*31:01 and HLA-B*15:02 genotypes. If no test signal or less than two logarithmic amplification "S"-shaped curves appear, or the Ct value is 0, then the corresponding HLA-A*31:01 and HLA-B*15:02 genotypes are not present. If there is no internal standard signal, retesting is required.

[0035] Compared with the prior art, the beneficial technical effects of the present invention are:

[0036] (1) The present invention analyzes the individual differences in the efficacy of carbamazepine in clinical practice, screens out two genotypes of genes closely related to the efficacy of carbamazepine, prepares a composition for detecting the HLA-A*31:01 and HLA-B*15:02 genes and a detection kit using the composition, and establishes an accurate detection system to provide effective medication guidance for carbamazepine.

[0037] (2) Most existing detection technologies cover a large number of anti-epileptic drugs, and the detection points are too redundant, making them inconvenient for single-drug guidance. Alternatively, some existing technologies only detect the HLA-B*15:02 genotype, which cannot completely eliminate medication risks. Compared with existing detection technologies, the present invention detects both HLA-A*31:01 and HLA-B*15:02 genotypes, accurately guiding carbamazepine medication. It has the characteristics of high sensitivity, low cost, simple operation, short detection cycle, and intuitive interpretation. It can quickly and accurately detect genetic polymorphisms for personalized carbamazepine medication.

[0038] (3) The present invention packages two carbamazepine medication guidance-related gene detection reagents into two storage tubes, each storage tube detects a single gene, and the pre-mixed packaging facilitates detection, reduces costs, improves detection efficiency, and saves samples.

[0039] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention, it can be implemented in accordance with the contents of the specification. In order to make the above contents of the present invention and its objectives, features and advantages more obvious and easy to understand, the specific implementation methods of the present invention are specifically listed below. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the amplification curve of the positive quality control product of the kit of the present invention.

[0041] Figure 2 This is the amplification curve of the negative quality control product of the kit of the present invention. DETAILED DESCRIPTION

[0042] The technical solutions of the present invention are further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely exemplary illustrations and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are encompassed within the scope of protection that the present invention is intended to protect.

[0043] In addition, unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0044] Example 1: Design of primers and probes for the detection system

[0045] Sequence information for common HLA-A and HLA-B genotypes from the IPD_IMGT / HLA database was collated and, through multiple sequence alignment, specific regions for the HLA-A*31:01 and HLA-B*15:02 genotypes were identified. Based on the sequence characteristics of these specific regions, primers and probes were designed for sample testing, and the amplification results were analyzed. The following primer and mismatched MGB probe combinations were developed for the PCR detection system, with the probes containing 5'-end fluorophores FAM, VIC, and CY5, respectively. The sequences of these combinations are shown in Table 2:

[0046] Table 2: Primer probe sequence list

[0047]

[0048] Specifically, this example designed multiple primer-probe combinations. After testing and testing, the three primer-probe combinations described above were found to be effective for detecting the HLA-A*31:01 and HLA-B*15:02 genotypes. The primer-probe combination shown in combination 1 exhibited a late signal onset during amplification testing. This resulted in a minimum detection limit of only 5 ng / μL. Below this concentration, no corresponding amplification curve could be obtained, significantly limiting its clinical use. Furthermore, primer-probe combination 2 was unable to distinguish the highly repetitive genotypes HLA-A*31:06, HLA-A*31:12, HLA-A*31:16, and HLA-B*15:13 and HLA-B*15:25, potentially leading to false-positive results in clinical testing and impacting patient medication selection. By optimizing and adjusting the primer sequences, a highly sensitive and specific primer-probe combination was obtained. The specific sequence is shown in combination 3. This combination can specifically detect the HLA-A*31:01 and HLA-B*15:02 genotypes and does not produce non-specific amplification for other alleles. At the same time, it has a high amplification efficiency and can produce specific amplification curves for low-concentration samples (0.5ng / μL).

[0049] Example 2: Use of Gene Detection Kit

[0050] 1. Sample collection and processing

[0051] Peripheral blood was collected from patients using a vacuum tube containing EDTA anticoagulant. Nucleic acid extraction was performed using the Chongqing Puji-produced nucleic acid extraction kit (magnetic bead method). The experimental steps were performed according to the instructions.

[0052] 2. Preparation of reaction system

[0053] The reaction system was prepared according to the primer-probe combination 3 in Example 1. The HLA-A*31:01 and HLA-B*15:02 detection systems were reaction solution 1 and reaction solution 2, respectively.

[0054] 3. PCR reaction

[0055] Add the extracted DNA from the sample to the prepared reaction system, using a template amount of 1-200ng. During the PCR reaction, the sample to be tested, the positive control, and the negative control should be run in parallel. Each sample should be added to both reaction solutions for reaction.

[0056] 4. Instrument channel and reaction volume selection

[0057] ① Select the FAM channel (Reporter: FAM, Quencher: MGB), VIC channel (Reporter: VIC, Quencher: MGB), and CY5 channel (Reporter: CY5, Quencher: MGB) to detect amplification;

[0058] ②The reaction volume (Sample Volume) is 25 μL;

[0059] ③ Reference Dye: If using an ABI series PCR instrument, be sure to select "none" in the passive reference setting. For specific detection channel settings, please refer to the operating instructions of each instrument.

[0060] Stage 1: 25°C, 10 minutes;

[0061] Stage 2: 95°C, 2 minutes;

[0062] The third stage: 95°C, 5 seconds; 58°C, 30 seconds, the number of cycles is set to 40; fluorescence is collected at 58°C.

[0063] 5. Experimental results

[0064] After the reaction program is completed, the results are saved and interpreted. If the amplification Ct value is ≤35, it is considered detected; otherwise, it is considered not detected.

[0065] The fluorescence detection signals of FAM, VIC and CY5 in the positive control product No. 1-2 reaction tubes form a logarithmic amplification "S" curve (see Figure 1 ); negative control tubes 1-2 have no amplification curve (see Figure 2 ).

[0066] Example 3: Determination of the genotype determination criteria of the kit

[0067] The CT value of the PCR detection system was directly read according to the detection method in Example 2. The genotype was determined based on the CT values ​​of the FAM and VIC signals of the PCR detection system. Based on the CT values ​​of 35 detected by this kit for 120 human peripheral blood gDNA samples, those with both FAM and VIC signals less than 35 were considered carriers of the gene, and were designated as positive. FAM signals ≤ 35 and VIC signals > 35, as well as VIC signals ≤ 35 and FAM signals > 35, were considered non-carriers of the gene, and were designated as negative.

[0068] Example 4: Accurate Performance Evaluation

[0069] Ten clinical samples were selected and tested according to the detection method of Example 2 and the judgment criteria of Example 3. The gold standard Sanger sequencing method was also used for accuracy comparison. The test results are shown in Table 3.

[0070] Table 3: Accuracy test results

[0071]

[0072] The accuracy test results of each sample were consistent with the comparison results, indicating that the kit and detection system of the present invention have good accuracy.

[0073] Example 5: Detection Limit Performance Evaluation

[0074] Three detection limit reference substances L1, L2, and L3 were selected and diluted with TE buffer to 10 ng / μL, 5 ng / μL, 2.5 ng / μL, 1 ng / μL, and 0.5 g / μL. The detection was performed according to the method of Example 2 and the judgment criteria of Example 3. Each concentration reference substance was tested 20 times. The results are shown in Table 4.

[0075] Table 4: Detection limit test results

[0076] Sample concentration (ng / μL) L1 detection rate L2 detection rate L3 detection rate 10 100% 100% 100% 5 100% 100% 100% 2.5 100% 100% 100% 1 100% 100% 100% 0.5 95% 95% 90% .

[0077] The detection limit of the kit of the present invention is calculated to be as low as 1 ng / μL using a detection rate of 95% as the minimum detection limit, indicating that the present invention has good sensitivity.

[0078] Example 6: Assessment of Precision

[0079] Three precision reference samples, J1 (plasmids mixed to make all sites heterozygous), J2, and J3 (J2 and J3 were clinical samples), were selected and tested according to the method of Example 2. Two batches were tested every day, and each batch was tested 4 times for 5 days. The coefficient of variation (CV, %) was calculated using the Ct values ​​of the 40 test results of the precision experiment. The results are shown in Table 5.

[0080] Table 5: CV value statistics of precision test

[0081]

[0082]

[0083] The calculation results showed that the intra-batch and inter-batch precision results were both within 5%, indicating that the kit and system of the present invention have good repeatability.

[0084] The serial numbers of the above embodiments of the present invention are for description only and do not represent the advantages or disadvantages of the embodiments.

[0085] The embodiments of the present invention are described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementation methods. The above-mentioned specific implementation methods are merely illustrative and not restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms without departing from the scope of protection of the present invention and the claims, all of which are protected by the present invention.

Claims

1. A gene detection kit for guiding carbamazepine medication, characterized in that: Includes primers and probes for detecting HLA-A*31:01 and HLA-B*15:02 genes.

2. A gene detection kit for guiding carbamazepine medication according to claim 1, characterized in that: The primer and probe sequences used to detect HLA-A*31:01 and HLA-B*15:02 genes are: SEQ ID NO.1-12.

3. A gene detection kit for guiding carbamazepine medication as claimed in claim 2, characterized in that: The kit also includes primers and probes for an internal control gene for monitoring, and the internal control gene is GAPDH.

4. A gene detection kit for guiding carbamazepine medication as claimed in claim 3, characterized in that: The primer and probe sequences used to detect the internal control gene GAPDH are: SEQ ID NO. 13-15.

5. A gene detection kit for guiding carbamazepine medication as claimed in claim 4, characterized in that: The 5'-end fluorescent groups of the probes for HLA-A*31:01 and HLA-B*15:02 genes and the internal control gene are all FAM, VIC or CY5, and the 3'-end quenching groups are all MGB or BHQ2.

6. A gene detection kit for guiding carbamazepine medication according to claim 1, characterized in that: The kit also includes PCR reaction solution, positive quality control product and negative quality control product. The PCR reaction solution includes hot start Taq enzyme, UNG enzyme, buffer, magnesium ions and dNTP substances required for the PCR reaction.

7. A gene detection system for guiding carbamazepine medication, characterized by: The method comprises the kit according to any one of claims 1 to 6, a PCR amplification reaction system and a genotyping interpretation system.

8. A gene detection system for guiding carbamazepine medication as claimed in claim 7, characterized in that: The PCR amplification reaction conditions were a two-step method: denaturation: 95°C, 5 seconds; annealing and extension: 58°C, 30 seconds, with fluorescence signal acquisition set; and the number of cycles was set to 40.

9. A gene detection system for guiding carbamazepine medication as claimed in claim 7, characterized in that: The genotyping interpretation system includes a PCR amplification reaction, where an amplification Ct value ≤ 35 is considered a detection, and an amplification curve is drawn based on the reaction results. The fluorescence detection signal of the positive quality control product forms a logarithmic amplification curve; the negative quality control product has no logarithmic amplification curve or the Ct value is 0; Observe the amplification curve of the reaction tube of the sample to be tested. If both the two signals to be tested and the internal standard signal form a logarithmic amplification curve, the sample to be tested contains two genotypes at the same time. If the two signals to be tested have less than two logarithmic amplification curves or the Ct value is 0, the sample to be tested does not contain two genotypes at the same time. If there is no internal standard signal, retesting is required.