TsRNA for predicting, diagnosing or monitoring diffuse large B-cell lymphoma, kit and application thereof

Abstract

The invention relates to the technical field of biological medicine detection, and discloses tsRNA for predicting, diagnosing or monitoring diffuse large B-cell lymphoma, a kit and application of the tsRNA. The marker comprises one or more of six tsRNAs including tsRNA-Leu-CAG, tsRNA-Pro-CG, tsRNA-Gln-CTG, tsRNA-Cys-GCA, tsRNA-Leu-AAG, tsRNA-Lys-CTT and the like, and the nucleotide sequence of the marker is as shown in SEQ ID NO. 1-6; the nucleotide sequence of the marker is as shown in SEQ ID NO. By detecting the change of the expression level of tsRNA in peripheral blood serum, early diagnosis, dynamic monitoring of treatment response and prognosis evaluation of DLBCL can be realized.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection technology, and in particular to tsRNA, a kit and applications thereof for predicting, diagnosing or monitoring diffuse large B-cell lymphoma. Background Art

[0002] Diffuse large B-cell lymphoma (DLBCL), the most aggressive subtype of non-Hodgkin's lymphoma, presents significant challenges in clinical diagnosis and treatment. Although the R-CHOP immunochemotherapy regimen has significantly improved patient prognosis, approximately 40% of patients still develop primary drug resistance or relapse after treatment, which is the main cause of death in refractory DLBCL patients. Therefore, the development of novel biomarkers for early diagnosis of DLBCL, dynamic assessment of treatment response, and prognostic prediction is of great clinical significance for improving patient survival outcomes.

[0003] The pathogenesis of diffuse large B-cell lymphoma (DLBCL) is extremely complex, with significant heterogeneity in its biological characteristics and clinical manifestations. Currently, commonly used clinical efficacy monitoring systems have significant limitations: serum markers such as lactate dehydrogenase (LDH) and β2-microglobulin lack disease specificity; and imaging studies (CT / PET-CT), while capable of detecting deep lymph node lesions, carry the risk of radiation exposure, are expensive, and have difficulty identifying inflammatory responses, leading to a certain false-positive rate. Therefore, developing novel markers with high sensitivity and specificity, and establishing non-invasive, cost-effective, and dynamically monitorable liquid biopsy technologies, are effective approaches to achieving precise diagnosis and treatment for patients with DLBCL.

[0004] tsRNA (tRNA-derived small RNAs) are a class of regulatory noncoding small RNAs produced by specific enzyme cleavage of tRNA. tsRNA plays a crucial role in tumorigenesis and progression by participating in biological processes such as cellular stress response, epigenetic regulation, protein translation, ribosome biogenesis, and immune response. Furthermore, tsRNA possesses a unique secondary structure and methylation modifications, conferring high stability. It can be widely distributed in various body fluids, such as serum and saliva, in the form of free or extracellular vesicles, and exhibits tissue specificity. These properties make it an ideal liquid biopsy biomarker. However, studies investigating the use of tsRNA as a biomarker for the early diagnosis and therapeutic response monitoring of diffuse large B-cell lymphoma have been limited. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide tsRNA, kits and applications thereof for predicting, diagnosing or monitoring diffuse large B-cell lymphoma, which can achieve early diagnosis of DLBCL, dynamic monitoring of treatment response and prognosis assessment by detecting changes in tsRNA expression levels in peripheral blood serum.

[0006] The present invention solves the above technical problems through the following technical means:

[0007] In a first aspect, the present invention provides a method for detecting the expression level of a tsRNA marker for use in preparing a kit for predicting, diagnosing, or monitoring diffuse large B-cell lymphoma, wherein the marker comprises one or more of the following six tsRNAs:

[0008] tsRNA-Leu-CAG, the nucleotide sequence is shown in SEQ ID NO.1;

[0009] tsRNA-Pro-CGG, the nucleotide sequence is shown in SEQ ID NO. 2;

[0010] tsRNA-Gln-CTG, the nucleotide sequence is shown in SEQ ID NO. 3;

[0011] tsRNA-Cys-GCA, the nucleotide sequence is shown in SEQ ID NO. 4;

[0012] tsRNA-Leu-AAG, the nucleotide sequence is shown in SEQ ID NO.5;

[0013] tsRNA-Lys-CTT, the nucleotide sequence is shown in SEQ ID NO.6.

[0014] Preferably, the detection reagent is a detection primer for a tsRNA marker.

[0015] Preferably, the detection primers include the following primers:

[0016] Universal upstream primer for detecting 6 tsRNAs: the nucleotide sequence is shown in SEQ ID NO.7;

[0017] Downstream primer for detecting tsRNA-Leu-CAG: nucleotide sequence is shown in SEQ ID NO.8;

[0018] Downstream primer for detecting tsRNA-Pro-CGG: nucleotide sequence is shown in SEQ ID NO.9;

[0019] Downstream primer for detecting tsRNA-Gln-CTG: the nucleotide sequence is shown in SEQ ID NO.10;

[0020] Downstream primer for detecting tsRNA-Cys-GCA: nucleotide sequence is shown in SEQ ID NO.11;

[0021] Downstream primer for detecting tsRNA-Leu-AAG: nucleotide sequence is shown in SEQ ID NO.12;

[0022] Downstream primer for detecting tsRNA-Lys-CTT: the nucleotide sequence is shown in SEQ ID NO.13.

[0023] In a second aspect, the present invention provides a kit for predicting, diagnosing or monitoring diffuse large B-cell lymphoma, comprising: a detection primer for the tsRNA marker according to claim 3.

[0024] Preferably, the kit further comprises reagents for fluorescent quantitative PCR detection method.

[0025] Further preferably, the reagents used in the fluorescence quantitative PCR detection method also include internal reference gene U6 amplification primers.

[0026] Further preferably, the nucleotide sequence of the internal reference gene U6 amplification primer is as shown in SEQ ID NO.14-15.

[0027] Beneficial effects of the present invention:

[0028] (1) The present invention uses high-throughput sequencing technology to systematically analyze the tsRNA expression profiles in the peripheral blood serum of patients with diffuse large B-cell lymphoma and healthy controls, and screens out a 6-tsRNA characteristic combination marker with diagnostic value. This marker is lowly expressed in the serum of DLBCL patients and its expression level is closely related to disease progression. It has the value of assisting in the early diagnosis of DLBCL and the evaluation of therapeutic efficacy.

[0029] (2) This invention confirms for the first time the application value of tsRNA in the diagnosis and treatment of DLBCL. Compared with traditional biomarkers, this detection method has the advantages of minimal invasiveness, simple operation, high sensitivity, and strong specificity, which is conducive to large-scale clinical application. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The expression abundance distribution of eight major small non-coding RNAs (sncRNAs) in the serum of the DLBCL patient group and the healthy control group in Example 2 of the present invention;

[0031] Figure 2 The overall expression difference and cluster heat map analysis of serum tsRNA between the DLBCL patient group and the healthy control group in Example 2 of the present invention;

[0032] Figure 3 Correlation analysis between the risk score (RS) and clinical characteristics of DLBCL patients based on 6-tsRNA markers in Example 2 of the present invention;

[0033] Figure 4 Expression differences and diagnostic efficacy evaluation of the 6-tsRNA marker combination in DLBCL patient groups and healthy controls in Example 3 of the present invention;

[0034] Figure 5 Expression changes of the 6-tsRNA marker combination in Example 3 of the present invention during the treatment of DLBCL patients. DETAILED DESCRIPTION

[0035] The following will be combined with the specific embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention:

[0036] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0037] Example 1

[0038] The markers include one or more of the following six tsRNAs:

[0039] name sequence SEQ ID NO tsRNA-Leu-CAG GUCAGGAUGGCCGAGCGGUC SEQ ID NO 1 tsRNA-Pro-CGG GAUUCUCGCUUCGGGUGCGAG SEQ ID NO 2 tsRNA-Gln-CTG GGACUCUGAAUCCAGCGAUC SEQ ID NO 3 tsRNA-Cys-GCA GGGGGCAUAGCUCAGUGGUAG SEQ ID NO 4 tsRNA-Leu-AAG GGUAGCGUGGCCGAGCGGUC SEQ ID NO 5 tsRNA-Lys-CTT GGGACUCUUAAUCCCAGGGUC SEQ ID NO 6

[0040] An embodiment of the present invention provides a tsRNA kit for predicting, diagnosing or monitoring diffuse large B-cell lymphoma, comprising:

[0041] (1) Detection reagent: including 6 tsRNA marker detection primers, the sequences of which are as follows:

[0042] universal upstream primer, the nucleotide sequence is 5′-GCGAGCACAGAATTAATACGACTC-3 (SEQ ID NO. 7);

[0043] The downstream primer for detecting tsRNA-Leu-CAG has the nucleotide sequence 5′-GTCAGGATGGCCGAGCGGTC-3′ (SEQ ID NO. 8);

[0044] The downstream primer for detecting tsRNA-Pro-CGG has the nucleotide sequence 5′-GATTCTCGCTTCGGGTGCGAG-3′ (SEQ ID NO. 9);

[0045] The downstream primer for detecting tsRNA-Gln-CTG has the nucleotide sequence 5′-GGACTCTGAATCCAGCGATC-3′ (SEQ ID NO. 10);

[0046] The downstream primer for detecting tsRNA-Cys-GCA has the nucleotide sequence 5′-GGGGGCATAGCTCAGTGGTAG-3′ (SEQ ID NO. 11);

[0047] The downstream primer for detecting tsRNA-Leu-AAG has the nucleotide sequence 5′-GGTAGCGTGGCCGAGCGGTC-3′ (SEQ ID NO. 12);

[0048] The nucleotide sequence of the downstream primer used to detect tsRNA-Lys-CTT is 5'-GGGACTCTTAATCCCAGGGTC-3' (SEQ ID NO. 13).

[0049] (2) Fluorescent quantitative PCR reagents, including internal reference gene U6 amplification primers, the sequence of the internal reference gene U6 amplification primers is:

[0050] Upstream primer of the internal reference gene U6: 5′- CTCGCTTCGGCAGCACATATACT-3′ (SEQ ID NO. 14);

[0051] Downstream primer of the internal reference gene U6: 5'-ACGCTTCACGAATTTGCGTGTC-3' (SEQ ID NO. 15).

[0052] Example 2: Analysis of tsRNA Expression in Peripheral Blood Serum of Diffuse Large B-Cell Lymphoma Patients and Healthy Controls

[0053] 1. Objects and Methods

[0054] 1. Object

[0055] Eligible diffuse large B-cell lymphoma patients and healthy controls were screened and peripheral blood samples were collected

[0056] 2. Methods

[0057] (1) Serum extraction:

[0058] Standardized sample collection and processing procedures were used: 5 mL of peripheral blood was collected in a red-top vacutainer tube. Immediately, the blood was gently inverted 5-8 times to mix thoroughly, and then allowed to stand at room temperature for 30 minutes to promote coagulation. The sample was centrifuged at 1500 rpm for 10 minutes at 4°C to separate the serum. The serum was then transferred to an RNase-free EP tube and centrifuged at 8000 rpm for 10 minutes to remove residual cell debris. Finally, the serum was aliquoted into pre-chilled RNase-free tubes (1 mL / tube) and immediately stored in a -80°C freezer.

[0059] (2) Extraction of total serum RNA

[0060] Serum total RNA was extracted using the Trizol LS method: 250 μL of serum was placed in a 1.5 mL EP tube, and 750 μL of Trizol LS reagent (Invitrogen) was added. The mixture was vortexed to fully lyse and then placed on ice for 10 min. Subsequently, 200 μL of chloroform was added to the mixture and vigorously shaken to mix. After standing for 15 min, the mixture was centrifuged at 12,000 rpm at 4°C for 15 min. The upper aqueous phase was carefully pipetted into a new EP tube, and an equal volume of isopropanol and 1 μL of glycogen were added and mixed. The mixture was precipitated at -80°C overnight. The RNA precipitate was collected by centrifugation at 12,000 rpm at 4°C for 30 min, washed twice with pre-cooled 75% ethanol (4°C, 12,000 rpm for 10 min each time), and air-dried on a clean bench for 5 min. Finally, the mixture was dissolved in 10 μL of DEPC water and stored at -80°C until use.

[0061] (3) Serum tsRNA sequencing

[0062] Samples were sequenced using small RNA-seq. Total serum RNA was quantified using a NanoDrop or Agilent 2100 Bioanalyzer. 5 μg of RNA was separated by electrophoresis on a 15% urea-denaturing polyacrylamide gel. Small RNA fragments (15-45 nt) were excised and purified from the gel. 3' and 5' adapters were then ligated sequentially. The primer-ligated small RNA was transcribed into cDNA using Superscript II reverse transcriptase. The cDNA fragments were then amplified and enriched using a PCR primer cocktail. The amplified products were verified for size and distribution using an Agilent 2100 Bioanalyzer, and the library was quantified by real-time quantitative PCR. Finally, the PCR products were sequenced using the DNBSEQ-G50 platform for high-throughput sequencing.

[0063] (4) Processing, annotation and analysis of tsRNA sequencing data

[0064] A high-quality small non-coding RNA (sncRNA) profile was constructed using a rigorous, standardized bioinformatics analysis pipeline. Raw data were processed using SPORTS software. 5' and 3' adapter sequences were removed using Cutadapt software, and sequences between 15 and 45 nt in length were selected. Bowtie software then aligned the data to the human reference genome (GRCH38 / hg38), miRNA datasets (miRbase, v21), rRNA and YRNA datasets (NCBI nucleotide and gene database), genomic tRNA datasets (GtRNAdb, v71, hg19), mitochondrial tRNA datasets (mitotRNAdb, v72), piRNA datasets (piRBase, v29 and piRNABank, v30), and non-coding RNA datasets (Ensembl, release 89; Rfam, v12.3). The number of sncRNA transcripts was also calculated. Finally, the expression level of each small noncoding RNA was quantified (RPM / CPM: Reads / Counts of exon model per Million mapped reads), and differential analysis of tsRNAs was performed using the R package edgeR. Lowly expressed tsRNAs (CPM ≤ 1) were first removed, and statistical correction was performed using the Benjamini-Hochberg method. Finally, small noncoding RNAs were considered to have a significant expression difference when the p-value was ≤ 0.05 and the |log2| value was ≥ 1.

[0065] 2. Results

[0066] Serum tsRNA expression profiles are significantly different in patients with diffuse large B-cell lymphoma; compared with healthy controls, serum tsRNA expression is significantly downregulated in patients with DLBCL. A random forest algorithm combined with principal component analysis was used to screen the features of 37 significantly differentially expressed tsRNA datasets, ultimately identifying six tsRNA marker combinations with diagnostic value (tsRNA-Leu-CAG, tsRNA-Pro-CGG, tsRNA-Gln-CTG, tsRNA-Cys-GCA, tsRNA-Leu-AAG, tsRNA-Lys-CTT). Figure 1 and Figure 2AB). The risk score model (RS) constructed based on the expression of 6 tsRNAs by Cox proportional hazard regression showed that the RS score was significantly correlated with the histological subtype (GCB vs non-GCB) and clinical stage (stage I-II vs stage III-IV) of DLBCL patients. After stratification by IPI score, the RS score of patients in the low-risk group was significantly lower than that in the intermediate-risk group and high-risk group, confirming that the RS score model constructed based on 6-tsRNA has important prognostic predictive value (such as Figure 3 AB).

[0067] Example 3: Real-time fluorescence quantitative PCR detection of tsRNA expression in peripheral blood serum of diffuse large B-cell lymphoma

[0068] 1. Objects and Methods

[0069] 1. Object

[0070] One hundred newly diagnosed DLBCL patients (63 males and 37 females, median age, 53 years) and 35 age- and sex-matched healthy controls were enrolled. Peripheral blood samples were obtained from all patients before R-CHOP treatment. Patients with diffuse large B-cell lymphoma received standard treatment, and serum total RNA was extracted according to step 2 above.

[0071] Paired samples before and after treatment of 77 DLBCL patients were included, and 5 mL of paired peripheral blood samples were collected from patients before treatment (baseline) and on the first day of the second cycle of chemotherapy.

[0072] 2. Methods

[0073] 1) Extraction of total RNA from peripheral blood serum: The method for serum separation and total RNA extraction from serum was followed as in Example 2.

[0074] 2) Reverse Transcription (RNA Tailing): First, 3'-end tailing was performed on 10 μL of total serum RNA using E. coli Poly(A) polymerase (Cat. No. 0276L, NEB). A 20 μL reaction mixture was prepared: 0.5 μL of E. coli Poly(A) polymerase, 1 μL of 10x Poly(A) Buffer, 1 μL of 10 mM ATP, and 10 μL of RNA sample. The reaction was performed in a PCR instrument with the following protocol: incubation at 37°C for 30 minutes. Universal adapter primers were then added, and the reaction was performed in a PCR instrument with the following protocol: 70°C for 5 minutes, followed by a 2-minute ice bath. Finally, reverse transcription was performed using M-MuLV Reverse Transcriptase (Cat. No. M0253L, NEB). A 20 µL reaction mixture was prepared: 2 µL of dNTPs, 3 µL of 0.05M DTT, 1 µL of M-MuLV Reverse Enzyme, 2 µL of 10x M-MuLV Buffer, 1 µL of RNase inhibitor, and 1 µL of HO. The PCR cycle was performed as follows: 42°C for 60 min, then 95°C for 5 min. tsRNA cDNA product was obtained.

[0075] 3) qRT-PCR was performed using the TaKaRa kit TB Green™ Premix Ex Taq™ II (Cat. No. RR820A). A 10-μL reaction system was prepared: 1 μL cDNA (700 ng), 0.25 μL 3' Universal Primer (10 μM), 0.25 μL tsRNA-specific primer (10 μM), 5 μL TB Green™ Premix Mix, and 3.5 μL H2O. PCR samples were reacted in a Bio-Rad CFX Connect real-time fluorescence quantitative PCR instrument using the following protocol: 1 cycle at 95°C for 5 min, followed by 40 cycles of amplification at 95°C for 30 s, 60°C for 20 s, and 95°C for 30 s. Melting curves were then collected. The expression levels of 6-tsRNAs (tsRNA-Leu-CAG, tsRNA-Pro-CGG, tsRNA-Gln-CTG, tsRNA-Cys-GCA, tsRNA-Leu-AAG, tsRNA-Lys-CTT) were calculated using U6 as the internal reference gene using the 2-△Ct method.

[0076] 3' adaptor sequence:

[0077] GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTTVN

[0078] 3' universal primer: 5'-GCGAGCACAGAATTAATACGACTC-3'

[0079] U6 upstream primer: 5'-CTCGCTTCGGCAGCACATATACT-3'

[0080] U6 downstream primer: 5'-ACGCTTCACGAATTTGCGTGTC-3'

[0081] tsRNA-Leu-CAG downstream primer: 5'-GTCAGGATGGCCGAGCGGTC-3'

[0082] tsRNA-Pro-CGG downstream primer: 5'-GATTCTCGCTTCGGGTGCGAG-3'

[0083] tsRNA-Gln-CTG downstream primer: 5'-GGACTCTGAATCCAGCGATC-3'

[0084] tsRNA-Cys-GCA downstream primer: 5'-GGGGGCATAGCTCAGTGGTAG-3'

[0085] tsRNA-Leu-AAG downstream primer: 5'-GGTAGCGTGGCCGAGCGGTC-3'

[0086] tsRNA-Lys-CTT downstream primer: 5'-GGGACTCTTAATCCCAGGGTC-3'

[0087] 2. Results

[0088] The expression levels of six specific tsRNAs (tsRNA-Leu-CAG, tsRNA-Pro-CGG, tsRNA-Gln-CTG, tsRNA-Cys-GCA, tsRNA-Leu-AAG, tsRNA-Lys-CTT) in the serum of DLBCL patients were significantly downregulated compared with those in the healthy control group, which was consistent with the sequencing results of Example 2 ( Figure 4 AF). The risk score model (RS) constructed based on 6 tsRNAs showed that the RS value of DLBCL patients was significantly higher than that of the healthy control group ( Figure 4 G). Receiver operating characteristic (ROC) curve analysis showed that the marker combination had excellent diagnostic performance, with the AUC of 6-tsRNA combined detection reaching 0.83 and a 95% confidence interval of 0.70-0.97 ( Figure 4H). Dynamic monitoring showed that after DLBCL patients completed two cycles of R-CHOP treatment, the expression level of 6-tsRNA significantly increased compared with the baseline, and the magnitude of expression change was positively correlated with the treatment response, confirming that it can be used as an important indicator for efficacy monitoring ( Figure 5 AF).

[0089] The above embodiments are intended only to illustrate the technical solutions of the present invention and are not intended to limit the scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art will appreciate that the technical solutions of the present invention may be modified or replaced with equivalents without departing from the spirit and scope of the technical solutions of the present invention, and such modifications or equivalents shall be encompassed by the claims of the present invention. Any techniques, shapes, and structures not described in detail herein are well known.

Claims

1. Use of a reagent for detecting the expression level of a tsRNA marker in the preparation of a kit for predicting, diagnosing or monitoring diffuse large B-cell lymphoma, characterized in that: The markers include one or more of the following six tsRNAs: tsRNA-Leu-CAG, the nucleotide sequence is shown in SEQ ID NO.1; tsRNA-Pro-CGG, the nucleotide sequence is shown in SEQ ID NO. 2; tsRNA-Gln-CTG, the nucleotide sequence is shown in SEQ ID NO. 3; tsRNA-Cys-GCA, the nucleotide sequence is shown in SEQ ID NO. 4; tsRNA-Leu-AAG, the nucleotide sequence is shown in SEQ ID NO.5; tsRNA-Lys-CTT, the nucleotide sequence is shown in SEQ ID NO.

6.

2. The use according to claim 1, characterized in that The detection reagent is a detection primer for tsRNA marker.

3. The use according to claim 2, characterized in that The detection primers include the following primers: Universal upstream primer for detecting 6 tsRNAs: the nucleotide sequence is shown in SEQ ID NO.7; Downstream primer for detecting tsRNA-Leu-CAG: nucleotide sequence is shown in SEQ ID NO.8; Downstream primer for detecting tsRNA-Pro-CGG: nucleotide sequence is shown in SEQ ID NO.9; Downstream primer for detecting tsRNA-Gln-CTG: the nucleotide sequence is shown in SEQ ID NO.10; Downstream primer for detecting tsRNA-Cys-GCA: nucleotide sequence is shown in SEQ ID NO.11; Downstream primer for detecting tsRNA-Leu-AAG: nucleotide sequence is shown in SEQ ID NO.12; Downstream primer for detecting tsRNA-Lys-CTT: the nucleotide sequence is shown in SEQ ID NO.

13.

4. A kit for predicting, diagnosing or monitoring diffuse large B-cell lymphoma, characterized in that: include: The detection primer for the tsRNA marker according to claim 3.

5. A kit for predicting, diagnosing or monitoring diffuse large B-cell lymphoma according to claim 4, characterized in that: The kit also includes reagents for fluorescent quantitative PCR detection method.

6. The kit according to claim 5, characterized in that The reagents used in the fluorescent quantitative PCR detection method also include an internal reference gene U6 amplification primer.

7. The kit according to claim 6, characterized in that The nucleotide sequences of the internal reference gene U6 amplification primers are shown in SEQ ID NO. 14-15.

Images