Microsatellite fluorescent multiplex PCR (polymerase chain reaction) method for paternity test of andrias davidianus in China

Abstract

The invention discloses a microsatellite fluorescent multiplex PCR (polymerase chain reaction) method for paternity test of Chinese giant salamanders, and belongs to the technical field of bioengineering. The method comprises the following steps: extracting genomic DNA of a Chinese giant salamander individual Screening polymorphic microsatellite primers of the giant salamanders in China; optimization and amplification of Chinese giant salamander microsatellite multiple PCR conditions are carried out; and paternity testing. According to the invention, 11 screened highly-polymorphic microsatellite loci are utilized to establish a duplex PCR and triple fluorescent PCR system, a sequencer is used for typing and data reading, and individual identification and parent-child relationship analysis are carried out on Chinese giant salamander families; according to the invention, two or three sites can be detected through one PCR reaction, the PCR reaction procedure is optimized, and compared with single-site detection, the efficiency is improved by more than two times, and the cost is reduced to more than one half of the original cost; the establishment of the method provides a new technical means for germplasm identification, family management and enhancement and release effect evaluation of the Chinese giant salamanders.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and more particularly to a microsatellite fluorescence multiplex PCR method for parentage identification of Chinese giant salamanders. Background Art

[0002] Molecular markers are a crucial technology in the research and application of germplasm identification, family selection, and release effectiveness assessment. Studies have applied markers such as mitochondrial DNA, randomly amplified polymorphic DNA, and microsatellite DNA to Chinese giant salamander germplasm research, but these have all been applied at the population level, and individual identification analysis is not yet feasible. However, in family selection, understanding the genetic diversity of the entire family, the relationship between offspring and parents, and the relationship between offspring and offspring is crucial for guiding parent selection and avoiding inbreeding and germplasm decline. Similarly, in stocking enhancement and release, understanding the relationship between recaptured and released individuals is crucial to assessing the effectiveness of release. Physical marking can be used for individual identification, but this approach has significant limitations for juveniles, either because they are too small to be marked or because marking significantly impacts their survival. Selecting effective molecular markers to achieve individual identification and parentage determination is a reliable and efficient method in the selection and breeding of Chinese giant salamanders and the evaluation of release effects. Therefore, how to develop a microsatellite fluorescence multiplex PCR method for paternity determination of Chinese giant salamanders is an urgent problem that technicians in this field need to solve. Summary of the Invention

[0003] In view of this, the present invention provides a method for microsatellite fluorescence multiplex PCR paternity testing of Chinese giant salamanders.

[0004] In order to achieve the above object, the present invention adopts the following technical solutions:

[0005] A method for paternity testing of Chinese giant salamanders by microsatellite fluorescence multiplex PCR comprises the following steps:

[0006] (1) Extraction of genomic DNA from Chinese giant salamander individuals;

[0007] (2) Screening of polymorphic microsatellite primers for Chinese giant salamander:

[0008] A total of 11 pairs of microsatellite primers for giant salamander were screened: CIBad02, CIBad03, CIBad05, CIBad06, CIBad08, CIBad09, CIBad11, CIBad12, CIBad14, CIBad16, and GS132;

[0009] The primer sequences are:

[0010] CIBad02:

[0011] F:GTGCTGCTACAATTCAACA,SEQ ID NO.1;

[0012] R:GCTGTGTGCAACATTAGATA,SEQ ID NO.2;

[0013] CIBad03:

[0014] F:CCTTCCTCTCATCTCTTCAAT,SEQ ID NO.3;

[0015] R:AACTAACTCTCGGTCTTACA,SEQ ID NO.4;

[0016] CIBad05:

[0017] F:GGCACTACAACAAGACCAAA,SEQ ID NO.5;

[0018] R:TTAGGAGCATAGACACTGAAG,SEQ ID NO.6;

[0019] CIBad06:

[0020] F:GGTGGAAGTTGCTGGAAT,SEQ ID NO.7;

[0021] R:GTACCTTCGGGTGTAATGG,SEQ ID NO.8;

[0022] CIBad08:

[0023] F:CTGACCTGGCTACCTGATCGG,SEQ ID NO.9;

[0024] R:ATGTGTGCTCTATGCTCTTTAG,SEQ ID NO.10;

[0025] CIBad09:

[0026] F:AGCATTACACAGGTCAAGA,SEQ ID NO.11;

[0027] R:CACTACCGTAATGCTGGTT,SEQ ID NO.12;

[0028] CIBad011:

[0029] F:CTAACACCACACGCTCTATCT,SEQ ID NO.13;

[0030] R: TGAACTCACTTCTGCTCTAAAG, SEQ ID NO.14;

[0031] CIBad12:

[0032] F: CAGTGAGGTTGGCATCTAAA, SEQ ID NO.15;

[0033] R: TGGTAAGTTGTATCAGGTGTC, SEQ ID NO.16;

[0034] CIBad14:

[0035] F: GGTGATAGCTGCATGGAAT, SEQ ID NO.17;

[0036] R:AAACGCTATGGGCATCTC, SEQ ID NO.18;

[0037] CIBad16:

[0038] F: CTCCAGCATTAGCAAACG, SEQ ID NO.19;

[0039] R: AAGGGTGGTTATTATTAGCG, SEQ ID NO.20;

[0040] GS132:

[0041] F: CATACATCTACAACTACATCCGA, SEQ ID NO.21;

[0042] R: TCTTCAAGCGAGCTTTTACT, SEQ ID NO.22;

[0043] (3) Optimization and amplification of multiplex PCR conditions for Chinese giant salamander microsatellites:

[0044] The 11 pairs of giant salamander microsatellite primers screened in step (2) were combined into 4 duplex PCRs and 1 triplex PCR, wherein:

[0045] Primers for duplex PCR combination 1 were CIBad02 and CIBad08;

[0046] The primers for duplex PCR combination 2 were CIBad03 and CIBad05;

[0047] The primers for duplex PCR combination 3 were CIBad06 and CIBad12;

[0048] The primers for duplex PCR combination 4 were CIBad14 and CIBad16;

[0049] The primers for triple PCR combination 5 were CIBad09, CIBad11, and GS132;

[0050] The 5′ end of the forward primer of each pair of primers is labeled with a fluorescent substance;

[0051] Perform PCR amplification using the genomic DNA obtained in step (1) as a template to obtain a fluorescent PCR product;

[0052] (4) Parentage testing: The fluorescent PCR products obtained in step (3) were typed on a sequencer, and the individual allele sizes in bp, i.e., base pairs, were read and arranged into a digital genotype matrix. The data were analyzed using the software Cervus v3.0. Based on the correlation between the genotypes of the individual to be tested and the parents, the parentage relationship between the offspring individual to be tested and the candidate parent was determined.

[0053] Furthermore, the specific operation of step (1) is: cutting the fin rays or other tissues of the Chinese giant salamander, extracting genomic DNA using a conventional phenol-chloroform method or a high salt method, and diluting the DNA to 100 ng / μL.

[0054] Furthermore, in step (3), the 5′ end of the forward primer of each pair of primers is labeled with a fluorescent substance, wherein the fluorescent substance of CIBad02, CIBad03, CIBad06, CIBad09, CIBad14 and GS132 is FAM; and the fluorescent substance of CIBad05, CIBad08, CIBad11, CIBad12 and CIBad16 is HEX.

[0055] Furthermore, in step (3), the PCR system of the duplex PCR combination 1 has a total volume of 25 μL, including 10 ng of genomic DNA, 3 μL of 10× PCR buffer, Mg 2+ 2.3 mM, Taq DNA polymerase 2 U, CIBad02, CIBad08 forward and reverse primers 0.5 μM each, and add sterile double-distilled water to 25 μL;

[0056] The PCR systems of duplex PCR combinations 2 to 4, except for the primers, were the same as those of duplex PCR combination 1;

[0057] The PCR system of triple PCR combination 5 has a total volume of 25 μL, including 10 ng of genomic DNA, 3 μL of 10× PCR buffer, Mg 2+ 2.3 mM, Taq DNA polymerase 2 U, CIBad09 forward and reverse primers 1.6 μM each, CIBad11 and GS132 forward and reverse primers 0.8 μM each, and add sterile double-distilled water to 25 μL.

[0058] Furthermore, in step (3), the PCR reaction conditions are as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 1 min, for a total of 6 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for another 10 min, and finally storage at 16°C.

[0059] The beneficial effects of the present invention are as follows: 1. The present invention utilizes 11 highly polymorphic microsatellite loci screened to establish a duplex PCR and triple fluorescence PCR system, and uses a sequencer to perform typing and data reading to perform individual identification and parent-offspring relationship analysis on the Chinese giant salamander family. The analysis results show that the identification accuracy rate is 97.5%;

[0060] 2. The present invention can detect 2 or 3 sites in one PCR reaction, optimizes the PCR reaction procedure, and improves the efficiency by more than 2 times compared with single-site detection, while reducing the cost by more than half;

[0061] 3. The establishment of the present invention provides a new technical means for the identification of Chinese giant salamander germplasm, family management and evaluation of the effect of reproduction and release. DETAILED DESCRIPTION

[0062] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0063] Example 1

[0064] (1) Extraction of genomic DNA from Chinese giant salamander individuals:

[0065] A total of 10 Chinese giant salamanders were collected from five families. Offspring of 7, 10, 18, 15, and 30 giant salamanders were selected from the five families, respectively. The tail tips were cut and genomic DNA was extracted using the high salt method: a small amount of tail tips was placed in an EP tube, 500 μL of HOM Buffer (80 mmol / L EDTA, 100 mmol / L Tris, 0.5% SDS, pH 8.0) and 10 μL of 20 mg / mL proteinase K were added, and digested at 55°C for 3 to 12 hours until the solution was completely transparent; 4.5 mol / L NaCl was added. 500μL and 300μL chloroform, mix thoroughly for 15 minutes, and centrifuge at 10000r / min for 10 minutes; transfer the supernatant to another centrifuge tube; add 600μL of isopropanol, mix well, centrifuge at 13000r / min for 10 minutes, and discard the supernatant; add 0.5mL of 70% volume percent ethanol, wash for 5 minutes, centrifuge at 13000r / min for 10 minutes, and discard the supernatant; dry the precipitate and dissolve it with TE buffer (10mmol / L Tris-HCl, pH8.0; 10mmol / LEDTA, pH8.0) or sterile water; determine the DNA concentration and adjust the sample DNA concentration to 100ng / μL.

[0066] (2) Screening of polymorphic microsatellite primers for Chinese giant salamander:

[0067] According to the published microsatellite primer sequences of giant salamander, primers were synthesized and some primer sequences were redesigned. According to the annealing temperature and allele size of the primers, a total of 11 pairs of microsatellite primers for giant salamander were screened: CIBad02, CIBad03, CIBad05, CIBad06, CIBad08, CIBad09, CIBad11, CIBad12, CIBad14, CIBad16, and GS132.

[0068] The primer sequences are:

[0069] CIBad02:

[0070] F: GTGCTGCTACAATTCAACA, SEQ ID NO.1;

[0071] R: GCTGTGTGCAACATTAGATA, SEQ ID NO.2; CIBad03:

[0072] F: CCTTCCTCTCATCTCTTCAAT, SEQ ID NO.3;

[0073] R: AACTAACTCTCGGTCTTACA, SEQ ID NO.4; CIBad05:

[0074] F:GGCACTACAACAAGACCAAA,SEQ ID NO.5:R:TTAGGAGCATAGACACTGAAG,SEQ IDNO.6:CIBad0

[0075] F:GGTGGAAGTTGCTGGAAT,SEQ ID NO.

[0076] R:GTACCTTCGGGTGTAATGG,SEQ ID NO.8:CIBad08:

[0077] F:CTGACCTGGCTACCTGATCGG,SEQ ID NO.9:R:ATGTGTGCTCTATGCTCTTTAG,SEQ IDNO.10:CIBad09:

[0078] F:AGCATTACACAGGTCAAGA,SEQ ID NO.

[0079] R:CACTACCGTAATGCTGGTT,SEQ ID NO.12:CIBad011:

[0080] F:CTAACACCACGCTCTATCT,SEQ ID NO.13:R:TGAACTCACTTCTGCTCTAAAG,SEQ IDNO.14,CIBad12:

[0081] F:CAGTGAGGTTGGCATCTAAA,SEQ ID NO.15;

[0082] R:TGGTAAGTTGTATCAGGTGTC,SEQ ID NO.

[0083] CIBad14:

[0084] F:GGTGATAGCTGCATGGAAT,SEQ ID NO.

[0085] R:AAACGCTATGGGCATCTC,SEQ ID NO.

[0086] CIBad16:

[0087] F:CTCCAGCATTAGCAAACG,SEQ ID NO.

[0088] R: AAGGGTGGTTATTATTAGCG, SEQ ID NO.20;

[0089] GS132:

[0090] F: CATACATCTACAACTACATCCGA, SEQ ID NO.21;

[0091] R: TCTTCAAGCGAGCTTTTACT, SEQ ID NO.22;

[0092] (3) Optimization and amplification of multiplex PCR conditions for Chinese giant salamander microsatellites:

[0093] The 11 pairs of giant salamander microsatellite primers screened in step (2) were combined into 4 duplex PCRs and 1 triplex PCR, wherein:

[0094] Primers for duplex PCR combination 1 were CIBad02 and CIBad08;

[0095] The primers for duplex PCR combination 2 were CIBad03 and CIBad05;

[0096] The primers for duplex PCR combination 3 were CIBad06 and CIBad12;

[0097] The primers for duplex PCR combination 4 were CIBad14 and CIBad16;

[0098] The primers for triple PCR combination 5 were CIBad09, CIBad11, and GS132;

[0099] The 5′ end of the forward primer of each pair of primers is labeled with a fluorescent substance;

[0100] Table 1 Primer sequences and fluorescent substances of the Chinese giant salamander fluorescence PCR combination

[0101]

[0102]

[0103] Wherein F represents the forward primer, R represents the reverse primer, and all fluorescent substances are labeled at the 5' end of the forward primer.

[0104] Among them, the fluorescent substance of CIBad02, CIBad03, CIBad06, CIBad09, CIBad14 and GS132 is FAM; the fluorescent substance of CIBad05, CIBad08, CIBad11, CIBad12 and CIBad16 is HEX.

[0105] Perform PCR amplification using the genomic DNA obtained in step (1) as a template to obtain a fluorescent PCR product;

[0106] The PCR reaction system for parentage identification of Chinese giant salamander is shown in Table 2.

[0107] Table 2 PCR reaction system for parentage identification of Chinese giant salamander (μL)

[0108]

[0109] The PCR system of duplex PCR combination 1 has a total volume of 25 μL, including 10 ng of genomic DNA, 3 μL of 10× PCR buffer, Mg 2+ 2.3 mM, 2 units of Taq DNA polymerase, 0.5 μM each of CIBad02 and CIBad08 forward and reverse primers, and sterile double-distilled water were added to 25 μL. PCR reaction conditions were: 94°C initial denaturation for 3 minutes; 6 cycles of 94°C denaturation for 30 seconds, 62°C annealing for 30 seconds, and 72°C extension for 1 minute; 30 cycles of 94°C denaturation for 30 seconds, 56°C annealing for 30 seconds, and 72°C extension for 30 seconds; 72°C extension for an additional 10 minutes, and storage at 16°C.

[0110] The PCR system of duplex PCR combination 2 was 25 μL in total volume, including 10 ng of genomic DNA, 3 μL of 10× PCR buffer, MgCl2 2+ 2.3 mM, 2 units of Taq DNA polymerase, 0.5 μM each of CIBad03 and CIBad05 forward and reverse primers, and sterile double-distilled water were added to 25 μL. PCR reaction conditions were: 94°C initial denaturation for 3 minutes; 6 cycles of 94°C denaturation for 30 seconds, 62°C annealing for 30 seconds, and 72°C extension for 1 minute; 30 cycles of 94°C denaturation for 30 seconds, 56°C annealing for 30 seconds, and 72°C extension for 30 seconds; 72°C extension for an additional 10 minutes, and storage at 16°C.

[0111] The PCR system of duplex PCR combination 3 had a total volume of 25 μL, including 10 ng of genomic DNA, 3 μL of 10× PCR buffer, Mg 2+ 2.3 mM, 2 units of Taq DNA polymerase, 0.5 μM each of CIBad06 and CIBad12 forward and reverse primers, and sterile double-distilled water were added to 25 μL. PCR reaction conditions were: 94°C initial denaturation for 3 minutes; 6 cycles of 94°C denaturation for 30 seconds, 62°C annealing for 30 seconds, and 72°C extension for 1 minute; 30 cycles of 94°C denaturation for 30 seconds, 56°C annealing for 30 seconds, and 72°C extension for 30 seconds; 72°C extension for an additional 10 minutes, and storage at 16°C.

[0112] The PCR system of duplex PCR combination 4 was 25 μL in total volume, including 10 ng of genomic DNA, 3 μL of 10× PCR buffer, MgCl2 2+ 2.3 mM, 2 units of Taq DNA polymerase, 0.5 μM each of CIBad14 and CIBad16 forward and reverse primers, and sterile double-distilled water were added to 25 μL. PCR reaction conditions were: 94°C initial denaturation for 3 minutes; 6 cycles of 94°C denaturation for 30 seconds, 62°C annealing for 30 seconds, and 72°C extension for 1 minute; 30 cycles of 94°C denaturation for 30 seconds, 56°C annealing for 30 seconds, and 72°C extension for 30 seconds; 72°C extension for an additional 10 minutes, and storage at 16°C.

[0113] The PCR system of triple PCR combination 5 has a total volume of 25 μL, including 10 ng of genomic DNA, 3 μL of 10× PCR buffer, Mg 2+ The PCR reaction was performed with 2.3 mM of 5-mercaptoethanol, 2 units of Taq DNA polymerase, 1.6 μM each of CIBad09 forward and reverse primers, and 0.8 μM each of CIBad11 and GS132 forward and reverse primers. Sterile double-distilled water was added to 25 μL. PCR reaction conditions were as follows: initial denaturation at 94°C for 3 min; 6 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 1 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s; an additional extension at 72°C for 10 min, and storage at 16°C.

[0114] (4) Paternity testing:

[0115] After the PCR is completed, 2 μL of the fluorescent PCR product obtained in step (3) is taken and tested on a 1% agarose gel electrophoresis. Samples showing the expected fragment size and high product concentration are typed on a sequencer. According to the typing results of the sequencer, see Tables 3-1 to 3-2, the size of individual alleles (bp, i.e., base pairs) is read using GeneMarker, combined with manual correction, and arranged into a digital genotype matrix.

[0116] Allele frequency, simulation, and parentage analyses were performed on the genetic data using Cervus v3.0 software. Likelihood ratio tests were used to determine the correlation between the genotypes of the individual and its parents to determine which parent the individual was related to. Table 4 shows the genetic information from the parentage analysis of 11 microsatellite loci in the Chinese giant salamander. The results showed that when both parents were unknown, the non-parental exclusion rates for the 11 loci ranged from 0.371 to 0.731, with a cumulative non-parental exclusion probability of 0.000737. When one parent was known, the non-parental exclusion rates ranged from 0.226 to 0.550, with a cumulative non-parental exclusion probability of 0.00000904. Parentage analysis revealed that 78 of the 80 progeny from the five families could be correctly identified, with an identification accuracy of 97.5%.

[0117] Table 3-1 Sequencer typing results

[0118]

[0119]

[0120]

[0121] Table 3-2 Sequencer typing results

[0122]

[0123]

[0124]

[0125]

[0126] Table 4 Genetic information of parentage relationship analysis of 11 microsatellite loci in Chinese giant salamander

[0127] Locus k HObs HExp PIC NE-1P NE-2P NE-PP HW CIBad06 11 0.813 0.873 0.854 0.422 0.266 0.106 ND CIBad12 10 0.747 0.750 0.723 0.624 0.438 0.232 NS CIBad14 9 0.933 0.867 0.847 0.439 0.278 0.117 ND CIBad16 11 0.923 0.893 0.878 0.371 0.226 0.080 ND CIBad08 9 0.890 0.863 0.841 0.451 0.288 0.124 ND CIBad02 7 0.835 0.781 0.742 0.611 0.433 0.250 NS CIBad03 10 0.945 0.793 0.761 0.577 0.399 0.211 *** CIBad05 12 0.931 0.805 0.773 0.562 0.386 0.202 NS CIBad09 11 0.846 0.769 0.739 0.604 0.423 0.224 NS CIBad11 11 0.956 0.864 0.845 0.434 0.275 0.109 NS GS132 6 0.945 0.674 0.635 0.731 0.550 0.353 ***

[0128] Note: The sample size is 90; k, number of alleles; HObs, observed heterozygosity; HExp, expected heterozygosity; PIC polymorphism information content; NE-1P, exclusion rate when both parents are unknown; NE-2P, exclusion rate when one of the parents is known; HW, departure from Hardy-Weinberg equilibrium test, ***, extremely significant, NS, not significant, ND, uncertain.

[0129] The above results show that the microsatellite fluorescence PCR method of the present invention can efficiently and quickly realize the parentage analysis of the Chinese giant salamander family with an accuracy rate of more than 95%, meeting the requirements of Chinese giant salamander germplasm identification, family management and proliferation and release effect evaluation.

[0130] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for parentage identification of Chinese giant salamander using microsatellite fluorescence multiplex PCR, characterized in that: The steps include: (1) Extraction of genomic DNA from Chinese giant salamander individuals; (2) Screening of polymorphic microsatellite primers for Chinese giant salamander: A total of 11 pairs of microsatellite primers for giant salamander were screened: CIBad02, CIBad03, CIBad05, CIBad06, CIBad08, CIBad09, CIBad11, CIBad12, CIBad14, CIBad16, and GS132; The primer sequences are: CIBad02: F: GTGCTGCTACAATTCAACA, SEQ ID NO.1; R: GCTGTGTGCAACATTAGATA, SEQ ID NO.2; CIBad03: F: CCTTCCTCTCATCTCTTCAAT, SEQ ID NO.3; R: AACTAACTCTCGGTCTTACA, SEQ ID NO.4; CIBad05: F: GGCACTACAACAAGACCAAA, SEQ ID NO.5; R:TTAGGAGCATAGACACTGAAG, SEQ ID NO.6; CIBad06: F: GGTGGAAGTTGCTGGAAT, SEQ ID NO.7; R: GTACCTTCGGGTGTAATGG, SEQ ID NO.8; CIBad08: F: CTGACCTGGCTACCTGATCGG, SEQ ID NO.9; R: ATGTGTGCTCTATGCTCTTTAG, SEQ ID NO.10; CIBad09: F: AGCATTACACAGGTCAAGA, SEQ ID NO.11; R: CACTACCGTAATGCTGGTT, SEQ ID NO.12; CIBad011: F: CTAACACCACACGCTCTATCT, SEQ ID NO.13; R: TGAACTCACTTCTGCTCTAAAG, SEQ ID NO.14; CIBad12: F: CAGTGAGGTTGGCATCTAAA, SEQ ID NO.15; R: TGGTAAGTTGTATCAGGTGTC, SEQ ID NO.16; CIBad14: F: GGTGATAGCTGCATGGAAT, SEQ ID NO.17; R:AAACGCTATGGGCATCTC, SEQ ID NO.18; CIBad16: F: CTCCAGCATTAGCAAACG, SEQ ID NO.19; R: AAGGGTGGTTATTATTAGCG, SEQ ID NO.20; GS132: F: CATACATCTACAACTACATCCGA, SEQ ID NO.21; R: TCTTCAAGCGAGCTTTTACT, SEQ ID NO.22; (3) Optimization and amplification of multiplex PCR conditions for Chinese giant salamander microsatellites: The 11 pairs of giant salamander microsatellite primers screened in step (2) were combined into 4 duplex PCRs and 1 triplex PCR, wherein: Primers for duplex PCR combination 1 were CIBad02 and CIBad08; The primers for duplex PCR combination 2 were CIBad03 and CIBad05; The primers for duplex PCR combination 3 were CIBad06 and CIBad12; The primers for duplex PCR combination 4 were CIBad14 and CIBad16; The primers for triple PCR combination 5 were CIBad09, CIBad11, and GS132; The 5′ end of the forward primer of each pair of primers is labeled with a fluorescent substance; Perform PCR amplification using the genomic DNA obtained in step (1) as a template to obtain a fluorescent PCR product; (4) Parentage testing: The fluorescent PCR products obtained in step (3) were typed on a sequencer, and the individual allele sizes in bp, i.e., base pairs, were read and arranged into a digital genotype matrix. The data were analyzed using the software Cervus v3.

0. Based on the correlation between the genotypes of the individual to be tested and the parents, the parentage relationship between the offspring individual to be tested and the candidate parent was determined.

2. The method for paternity testing of Chinese giant salamander using microsatellite fluorescence multiplex PCR according to claim 1, characterized in that: The specific operation of step (1) is: cutting the fin ray or other tissue of the Chinese giant salamander, extracting genomic DNA using the conventional phenol-chloroform method or the high salt method, and diluting the DNA to 100 ng / μL.

3. The method for paternity testing of Chinese giant salamander using microsatellite fluorescence multiplex PCR according to claim 1, characterized in that: In step (3), the 5′ end of the forward primer of each pair of primers is labeled with a fluorescent substance, wherein the fluorescent substance of CIBad02, CIBad03, CIBad06, CIBad09, CIBad14 and GS132 is FAM; the fluorescent substance of CIBad05, CIBad08, CIBad11, CIBad12 and CIBad16 is HEX.

4. The method for paternity testing of Chinese giant salamander using microsatellite fluorescence multiplex PCR according to claim 1, characterized in that: In step (3), the PCR system of the duplex PCR combination 1 has a total volume of 25 μL, including 10 ng of genomic DNA, 3 μL of 10× PCR buffer, Mg 2+ 2.3 mM, Taq DNA polymerase 2 U, CIBad02, CIBad08 forward and reverse primers 0.5 μM each, and add sterile double-distilled water to 25 μL; The PCR systems of duplex PCR combinations 2 to 4, except for the primers, were the same as those of duplex PCR combination 1; The PCR system of triple PCR combination 5 has a total volume of 25 μL, including 10 ng of genomic DNA, 3 μL of 10× PCR buffer, Mg 2+ 2.3 mM, Taq DNA polymerase 2 U, CIBad09 forward and reverse primers 1.6 μM each, CIBad11 and GS132 forward and reverse primers 0.8 μM each, and add sterile double-distilled water to 25 μL.

5. The method for parentage identification of Chinese giant salamander by microsatellite fluorescence multiplex PCR according to claim 1, characterized in that: In step (3), the PCR reaction conditions are as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 1 min, for a total of 6 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for another 10 min, and finally storage at 16°C.

Images