NLRP3 gene knockout cell line as well as construction method and application thereof
By constructing a macrophage cell line with NLRP3 gene knockout and using shRNA and lentiviral technology, the time-consuming and costly problems of existing technologies were solved, providing a stable cell model that significantly inhibited the secretion of IL-1β and IL-18, revealing the role of the NLRP3 gene in pathogen infection and suitable for drug screening.
Patent Information
- Application Number
- CN202510636375.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-16
- Publication Date
- 2025-09-16
AI Technical Summary
Existing technologies have problems in NLRP3 gene knockout research, such as long time consumption, high cost and complex operation. In particular, the research on NLRP3 gene knockout at the macrophage level has not been in-depth, and its role in the pathogen infection process has not been fully explored.
The NLRP3 gene was targeted by shRNA, and a lentivirus-mediated NLRP3 knockout macrophage cell line was constructed. Gene-edited NLRP3 knockout cells were obtained by puromycin screening, and their function was verified under LPS induction and pathogen infection.
A stable NLRP3 gene knockout cell model is provided, which can significantly inhibit the secretion of IL-1β and IL-18, proving the important role of the NLRP3 gene in pathogen infection. It also provides a cell model for studying NLRP3-dependent inflammasome assembly and cell pyroptosis, which is suitable for drug screening.
Smart Images

Figure CN120648753A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to a NLRP3 gene knockout cell line and a construction method and application thereof. Background Art
[0002] Pyroptosis is a form of programmed cell death mediated by inflammasomes. It is characterized by the cell's response to external stimuli, such as pathogen invasion, which in turn activates Caspase-1, inducing the maturation and release of IL-1β and IL-18, triggering pyroptosis and ultimately leading to cell membrane rupture and the release of inflammatory factors. Pyroptosis influences the pathogenesis of various animal diseases, such as pathogen infection, autoimmune diseases, neurodegenerative diseases, and cancer. Among them, NLRP3 inflammasome-dependent pyroptosis is the most extensively studied and has been shown to play a key role in immune responses and inflammation regulation. By specifically knocking out the NLRP3 gene, its mechanism of action in biological processes can be revealed.
[0003] Currently, research on NLRP3 gene knockout primarily relies on NLRP3 knockout mice, which are limited by the lengthy breeding time required to achieve the required number of replicates, high costs, and multiple steps involved, including embryo transfer and genotyping. However, NLRP3 gene editing in cell lines is simple and time-efficient, making it suitable for studying NLRP3 gene function at the cellular level. One study reported knocking down NLRP3 expression in human renal proximal tubule epithelial cells (RPTEC / TERT1) using RNAi (Li et al., 2021), while another reported knocking down NLRP3 expression in human monocytic THP-1 cells using RNAi (Chen et al., 2022). However, the methods used in these reports did not completely knock down NLRP3. A study reported using CRISPR / Cas9 technology to knock out the NLRP3 gene in mouse microglial BV2 cells, demonstrating that knockout of the NLRP3 gene inhibited Caspase-1 activation and subsequent pyroptosis, thereby alleviating the development of Alzheimer's disease (Tian et al, 2022). However, the role of NLRP3 knockout in macrophage defense against pathogen infection has not been reported. Summary of the Invention
[0004] To overcome the deficiencies of the prior art, the primary objective of the present invention is to provide a cell line with a knockout NLRP3 gene. Another objective of the present invention is to provide a method for constructing a cell line with a knockout NLRP3 gene. A further objective of the present invention is to provide applications of the cell line with a knockout NLRP3 gene.
[0005] The object of the present invention is achieved through the following technical solutions: A method for constructing a NLRP3 gene knockout cell line comprises the following steps: 1) Designing shRNA based on the NLRP3 gene, wherein the shRNA sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2; 2) Targeting shRNA for phosphorylation; 3) Enzyme digestion and gel recovery of the lentiviral expression vector to obtain a linearized lentiviral expression vector; 4) Ligating the phosphorylated shRNA into the linearized lentiviral expression vector; 5) The shRNA-linked lentiviral expression vector and the lentiviral vector are co-transfected into the recipient cells for lentiviral coating; 6) Infecting macrophages with the encapsulated NLRP3 shRNA lentivirus, and selecting with puromycin to obtain gene-edited macrophages with NLRP3 knockout; the macrophages are murine mononuclear macrophages J774A.1.
[0006] In step 3), the lentiviral expression vector is a pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro vector, the enzyme is a BbSI enzyme, and the gel recovery uses an agarose gel DNA recovery kit.
[0007] The ligase in step 4) is T4 DNA ligase.
[0008] In step 5), the lentiviral vectors are 0.25 μg pMD2.G and 1 μg psPAX2, and the recipient cells are 293T cells.
[0009] A mouse cell line with an NLRP3 gene knockout, wherein the NLRP3 gene in the cell line is completely knocked out; when induced only by LPS or infected only with Escherichia coli K88 without the addition of ATP, the inflammatory response and the release of the pro-inflammatory factor TNF-α in the cell line are no different from those of the wild-type cell line; however, when ATP is added during LPS induction or during Escherichia coli K88 infection, the secretion levels of IL-1β and IL-18 proteins in the cell line are statistically significantly lower than those of wild-type cells; that is, the knockout of the NLRP3 gene specifically blocks the activation of the pyroptosis response in the cell line but does not affect the inflammatory response.
[0010] The application of the cell line in preparing an in vitro model of pathogen infection provides a cell model for studying the physiological mechanism of NLRP3-dependent inflammasome assembly and cell pyroptosis activation.
[0011] The cell model is used for drug screening.
[0012] The beneficial effects of the present invention are: 1) The NLRP3 gene knockout cell line provided by the present invention was constructed by lentiviral infection using shRNA targeting the NLRP3 gene. Western blot verification confirmed that the NLRP3 gene in macrophages was knocked out. This provides a cell model for studying physiological mechanisms such as NLRP3-dependent inflammasome assembly, especially the NLRP3-dependent cell pyroptosis process caused by pathogen infection, LPS induction, etc.
[0013] 2) Application of the NLRP3 gene knockout cell line provided by the present invention, using wild-type macrophages without NLRP3 knockout as the control group and macrophages with NLRP3 gene knockout as the experimental group, revealed that knockout of the NLRP3 gene significantly alleviated the significant upregulation of IL-1β and IL-18 expression levels in cells caused by Escherichia coli K88 infection.
[0014] 3) The application of the NLRP3 gene knockout cell line provided by the present invention directly demonstrates the important role of the NLRP3 gene in the process of pathogen infection of macrophages.
[0015] 4) The method for constructing the NLRP3 gene knockout cell line provided by the present invention can provide experience for stably knocking out the NLRP3 gene in other macrophages. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 This is an agarose gel electrophoresis diagram of PCR identification of NLRP3 shRNA lentiviral expression vector.
[0017] Figure 2A Schematic diagram of the pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro lentiviral vector without an inserted shRNA sequence.
[0018] Figure 2B Schematic diagram of the pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro lentiviral vector inserted with the NLRP3 shRNA sequence.
[0019] Figure 3 This is the result graph of NLRP3 protein expression level in gene-edited macrophages.
[0020] Figure 4 is the TNF-α level in the supernatant of macrophages after different treatments.
[0021] Figure 5 A is the expression level of IL-18 protein in the supernatant of macrophages after different treatments.
[0022] Figure 5 B is the expression level of IL-1β protein in the supernatant of macrophages after different treatments. DETAILED DESCRIPTION
[0023] A method for constructing a NLRP3 gene knockout cell line comprises the following steps: 1) Design shRNA based on the NLRP3 gene (Mus musculus); 2) Phosphorylation of shRNA targeting the NLRP3 gene; 3) Enzyme digestion and gel recovery of the lentiviral expression vector to obtain a linearized lentiviral expression vector; 4) Ligating the phosphorylated NLRP3 shRNA into the linearized lentiviral expression vector; 5) The lentiviral expression vector linked to the NLRP3 shRNA was co-transfected with the lentiviral vector into the recipient cells for lentiviral coating; 6) The coated NLRP3 shRNA lentivirus was used to infect macrophages, and puromycin was used for selection to obtain macrophages with gene editing and knockout of NLRP3.
[0024] The shRNA sequences described in step 1) are shown as SEQ ID NO. 1 and SEQ ID NO. 2.
[0025] Step 3) The lentiviral expression vector is a pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro vector, the enzyme is BbSI enzyme, and the gel recovery is an agarose gel DNA recovery kit; The ligase in step 4) is T4 DNA ligase; Step 5) The lentiviral vector is, and the recipient cells are 293T cells; The macrophages described in step 6) are mouse mononuclear macrophages J774A.1.
[0026] The use of the NLRP3 gene knockout cell line of the present invention in response to LPS-induced inflammatory response comprises the following steps: 1) NLRP3 knockout cell line culture; 2) LPS treatment; 3) Index measurement.
[0027] The LPS treatment in step 2) is characterized in that the LPS concentration is 0.5 μg / mL and the treatment is performed for 4.5 hours; In step 3), the indicators measured include the TNF-α level in the macrophage supernatant.
[0028] The use of the NLRP3 gene knockout cell line of the present invention in response to LPS and ATP-induced cell pyroptosis comprises the following steps: 1) NLRP3 knockout cell line culture; 2) LPS treatment; 3) ATP treatment; 4) Index measurement.
[0029] The LPS treatment in step 2) is characterized in that the LPS concentration is 0.5 μg / mL and the treatment takes 4.5 hours.
[0030] The ATP treatment in step 3) is characterized in that, after the cells are treated with LPS for 4 hours, ATP with a final concentration of 2 mM is added and treated for 0.5 hours.
[0031] In step 4), the indicators measured include the LDH release level in the macrophage supernatant and the protein expression levels of the inflammatory cytokines IL-1β and IL-18.
[0032] The use of the NLRP3 gene knockout cell line of the present invention in resisting Escherichia coli K88 infection comprises the following steps: 1) NLRP3 knockout cell line culture; 2) Activation and treatment of Escherichia coli K88; 3) Index measurement.
[0033] Step 2) The activation and treatment of E. coli K88 is characterized in that the E. coli K88 is cultured to the logarithmic phase and diluted to a concentration of OD 600 =0.4~0.6, containing 1~3×10 7 CFU / mL, cells were treated for 2.5 hours.
[0034] In step 3), the indicators measured include the TNF-α level in the macrophage supernatant.
[0035] The use of the NLRP3 gene knockout cell line of the present invention in resisting Escherichia coli K88 and ATP treatment-induced cell pyroptosis comprises the following steps: 1) NLRP3 knockout cell line culture; 2) Activation and treatment of Escherichia coli K88; 3) ATP treatment; 4) Index measurement.
[0036] Step 2) The activation and treatment of E. coli K88 is characterized in that the E. coli K88 is cultured to the logarithmic phase and diluted to a concentration of OD 600 =0.4~0.6, containing 1~3×107 CFU / mL, cells were treated for 2.5 hours.
[0037] The ATP treatment inducing cell pyroptosis in step 3) is characterized in that after the cells are treated with the activated Escherichia coli K88 bacterial solution for 2 hours, ATP with a final concentration of 2 mM is added and treated for 0.5 hours.
[0038] In step 4), the indicators measured include the LDH release level in the macrophage supernatant and the protein expression levels of the inflammatory cytokines IL-1β and IL-18.
[0039] The present invention is further described below with reference to the accompanying drawings and embodiments.
[0040] Example 1 Obtaining NLRP3 shRNA Lentiviral Expression Vector The NLRP3 shRNA in the present invention was obtained using an online shRNA design tool; the shRNA sequence is shown below: shRNA Forward: ACCGG CCAGGAGAGAACCTCTTATTT CTCGAGAAATAAGAGGTTCTCTCCTGG TTTTTTG (SEQ ID NO.1), shRNA Reverse: TGGCC GGTCC TCTCTTGGAGAATAAA GAGCTCTTTATTCTCCAAGAGAGGACC AAAAAACAAGC (SEQ ID NO.2).
[0041] After incubation at 37°C for 30 minutes, followed by incubation at 95°C for 2 minutes, the cells were cooled to room temperature to phosphorylate the NLRP3 shRNA. The shRNA lentiviral expression vector was then digested with BbSI and linearized using an agarose gel DNA recovery kit. Use T4 ligase and incubate at room temperature for 2 hours to connect it to the pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro lentiviral expression vector. Transform the Escherichia coli DH5α strain by heat shock method. Extract the plasmid and perform PCR identification. The primer sequences are shown below. Primer Forward: GAGGGCCTATTTCCCATGATTCC (SEQ ID NO. 3), Primer Reverse: ACAGTCCGAAACCCCAAACGCACGAA (SEQ ID NO. 4).
[0042] The reaction conditions were as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 15 s, annealing at 56°C for 30 s, and extension at 72°C for 2 min, for 25 cycles, and positive clones were obtained. Figure 1 As shown in Figure 2, the PCR products of the selected clones were larger than those of the negative control group, indicating that the NLRP3 shRNA was indeed inserted into the Figure 2A 、 Figure 2B The pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro lentiviral expression vector was shown.
[0043] Example 2 NLRP3 shRNA Lentivirus Encapsulation 2 μg of the NLRP3 shRNA lentiviral expression plasmid obtained by the method in Example 1 was transferred into the lentiviral elements 0.25 μg pMD2.G and 1 μg psPAX2 using liposome Lipo3000; after 24 hours, the culture medium was replaced with 1.5 mL complete culture medium; after 48 hours, the virus was collected to obtain the NLRP3 shRNA lentivirus.
[0044] Example 3 Obtaining NLRP3 gene knockout macrophage cell line 500 μL of the NLRP3 shRNA lentivirus obtained by the method of Example 2 was added to macrophage J774A.1. After 24 hours, the culture medium was replaced with complete culture medium. After 48 hours, 2 μg / mL puromycin was added for selection. Western blot was used to verify that macrophages with gene editing and knockout of the NLRP3 gene were obtained. Figure 3 As shown in the figure, compared with the empty vector group, the NLRP3 protein level in macrophages in the NLRP3shRNA lentivirus-infected group was significantly decreased.
[0045] Example 4 Application of NLRP3 gene knockout cell lines in response to LPS-induced inflammation 1) Cell treatment: NLRP3 knockout J774A.1 cells (experimental group) and NLRP3 non-knockout wild-type J774A.1 cells (negative control group) were treated with 0.5 μg / mL LPS. Pure DMEM basic medium served as a blank control.
[0046] 2) Sample collection and indicator determination: After 4.5 hours of LPS treatment, the culture supernatant was collected and the inflammatory cytokine TNF-α content was determined using an ELISA kit.
[0047] 5) Analysis of results: Compared with the blank control group, LPS treatment increased the TNF-α content in the supernatant of both NLRP3 gene knockout cell lines and wild-type cell lines (see Figure 4 ), and there is no difference between the two.
[0048] Example 5 Application of NLRP3 gene knockout cell lines in response to inflammation induced by Escherichia coli K88 infection 1) Culture medium preparation: LB plate medium: 10 g sodium chloride, 10 g tryptone, 5 g yeast extract, 25 g agar, 1 L deionized water, autoclave at 121°C for 21 min; LB liquid medium: 10 g sodium chloride, 10 g tryptone, 5 g yeast extract, 1 L deionized water, autoclave at 121°C for 21 min.
[0049] 2) Activation of the bacterial strain: Take a loopful of E. coli K88 stored at -80°C and streak it onto an LB plate. After incubation at 37°C for 12 hours, pick a single colony and inoculate it into LB liquid medium. Incubate at 37°C, 250 rpm for 12 hours as a seed solution.
[0050] 3) Bacterial solution dilution and cell treatment: Dilute the activated bacterial solution with PBS to an OD of 600 = 0.4-0.6, centrifuged at 600 rpm for 5 minutes, discarded the supernatant, and resuspended in an equal volume of DMEM basic medium. The cells were then treated with NLRP3 knockout J774A.1 cells (experimental group) and wild-type J774A.1 cells without NLRP3 knockout (negative control group). Pure DMEM basic medium without Escherichia coli K88 culture medium served as a blank control.
[0051] 4) Sample Collection and Index Determination: After 2.5 hours of bacterial liquid treatment, the culture supernatant was collected and the cytokine TNF-α content was determined using an ELISA kit.
[0052] 5) Analysis of results: Compared with the blank control group, infection with E. coli K88 increased the TNF-α content in the supernatant of both NLRP3 knockout cell lines and wild-type cell lines (see Figure 4 ), and there is no difference between the two.
[0053] Example 6 Application of NLRP3 gene knockout cell lines in response to pyroptosis induced by LPS and ATP 1) Cell Treatment: NLRP3 knockout J774A.1 cells (experimental group) and NLRP3 intact wild-type J774A.1 cells (negative control group) were treated with 0.5 μg / mL LPS. After 4 hours of treatment, ATP (final concentration 2 mM) was added for 0.5 hours. Pure DMEM basic medium served as a blank control.
[0054] 2) Sample Collection and Index Measurement: After 4 hours of LPS treatment, ATP (final concentration of 2 mM) was added for 0.5 hours. The culture supernatant was collected and the levels of cytokines IL-1β and IL-18 were measured using ELISA kits.
[0055] 5) Analysis of results: Compared with the blank control group, LPS and ATP treatment significantly increased the levels of IL-1β and IL-18 in the supernatant of the wild-type cell line, but the levels of IL-1β and IL-18 in the supernatant of the NLRP3 gene knockout cell line were not significantly different from those in the blank control group, indicating that NLRP3 gene knockout blocked LPS and ATP-induced cell pyroptosis (see Figure 5 ).
[0056] Example 7 Application of NLRP3 gene knockout cell line in response to Escherichia coli K88 infection and ATP-induced pyroptosis 1) Same as step 1) and step 2) of Example 5); 2) Bacterial solution dilution and cell treatment: Dilute the activated bacterial solution with PBS to an OD of 600 = 0.4-0.6, centrifuged at 600 rpm for 5 minutes, discarded the supernatant, and resuspended in an equal volume of DMEM basic medium. The cells were then treated with NLRP3 knockout J774A.1 cells (experimental group) and wild-type J774A.1 cells without NLRP3 knockout (negative control group). Pure DMEM basic medium without Escherichia coli K88 culture medium served as a blank control.
[0057] 4) Sample Collection and Index Assay: After 2 hours of bacterial treatment, ATP (final concentration 2 mM) was added for 0.5 hours. The culture supernatant was collected and the cytokine IL-1β and IL-18 levels were measured using ELISA kits.
[0058] 5) Analysis of results: Compared with the blank control group, E. coli K88 infection and ATP treatment significantly increased the levels of IL-1β and IL-18 in the supernatant of the wild-type cell line, but the levels of IL-1β and IL-18 in the supernatant of the NLRP3 gene knockout cell line were not significantly different from those in the blank control group (see Figure 5 ), that is, knockout of the NLRP3 gene blocked cell pyroptosis induced by Escherichia coli K88 infection and ATP.
[0059] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples, and many variations and equivalents are possible. All variations and equivalents that can be directly derived or imagined by a person skilled in the art from the disclosure of the present invention are within the scope of protection of the present invention.
Claims
1. A method for constructing a NLRP3 gene knockout cell line, characterized in that: The following steps are involved: 1) Designing shRNA based on the NLRP3 gene, wherein the shRNA sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2; 2) Targeting shRNA for phosphorylation; 3) Enzyme digestion and gel recovery of the lentiviral expression vector to obtain a linearized lentiviral expression vector; 4) Ligating the phosphorylated shRNA into the linearized lentiviral expression vector; 5) The shRNA-linked lentiviral expression vector and the lentiviral vector are co-transfected into the recipient cells for lentiviral coating; 6) Infect macrophages with the encapsulated NLRP3 shRNA lentivirus and select them with puromycin to obtain macrophages with gene-edited NLRP3 knockout; The macrophages are mouse mononuclear macrophages J774A.
1.
2. The method according to claim 1, wherein In step 3), the lentiviral expression vector is a pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro vector, the enzyme is a BbSI enzyme, and the gel recovery uses an agarose gel DNA recovery kit.
3. The method according to claim 1, wherein The ligase in step 4) is T4 DNA ligase.
4. The method according to claim 1, wherein In step 5), the lentiviral vectors are 0.25 μg pMD2.G and 1 μg psPAX2, and the recipient cells are 293T cells.
5. A NLRP3 gene knockout mouse cell line, characterized in that: Constructed using the method according to claim 1; The NLRP3 gene of the cell line was completely knocked out. When induced by LPS alone or infected with E. coli K88 alone without the addition of ATP, the inflammatory response and the release of the pro-inflammatory factor TNF-α in the cell line were no different from those of the wild-type cell line. However, when ATP was added during LPS induction or infection with E. coli K88, the secretion levels of IL-1β and IL-18 proteins in the cell line were statistically significantly lower than those in wild-type cells. That is, the knockout of the NLRP3 gene specifically blocked the activation of the pyroptosis response in the cell line but did not affect the inflammatory response.
6. Use of the cell line according to claim 5 in preparing an in vitro model of pathogen infection, characterized in that: Provide a cell model for studying the physiological mechanism of NLRP3-dependent inflammasome assembly and cell pyroptosis activation.
7. The use according to claim 6, characterized in that The cell model is used for drug screening.