Gene delivery system for cytoplasm specific expression of PPM1K as well as preparation method and application of gene delivery system

Abstract

The invention relates to a gene delivery system for cytoplasm specific expression of PPM1K as well as a preparation method and application of the gene delivery system, and belongs to the technical field of preparation of gene delivery systems. The gene delivery system is preferably an adeno-associated virus (AAV), and the preparation method of the gene delivery system specifically comprises the following steps: inserting a PPM1K gene or a functional variant thereof into a vector, and adding a detectable label at a C terminal to form a recombinant plasmid; transforming the recombinant plasmids into competent escherichia coli, amplifying, and screening and extracting plasmids to obtain recombinant AAV plasmids; co-transfecting the recombinant AAV plasmid, the helper plasmid and the capsid plasmid into packaging cells by using a transfection reagent, collecting the cells and culturing supernate after transfection, and adding a freeze thawing buffer solution for repeated freeze thawing to obtain a cell lysis solution; centrifuging the cell lysis solution, taking supernate, purifying and filtering. According to the invention, the specific expression of the cell compartment of the therapeutic gene is realized through the vector design, and the obvious therapeutic effect and the safety advantage are shown.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene delivery system preparation, and in particular relates to a gene delivery system for cytoplasm-specific expression of PPM1K, and a preparation method and application thereof. Background Art

[0002] Heart failure (HF) is the terminal stage of various cardiovascular diseases. Its core pathological features include decreased myocardial contractile function, myocardial remodeling, and energy metabolism disorders. Despite significant progress in current drug therapy, device-assisted and surgical techniques, the incidence, mortality and rehospitalization rates of heart failure remain high, making it a major global public health problem. Existing treatments still face severe challenges in disease modification, end-stage management, and personalized precision treatment. Breakthrough therapies are urgently needed to fill clinical gaps.

[0003] Existing drug treatments mainly include diuretics, angiotensin-converting enzyme inhibitors, beta-blockers and aldosterone antagonists, etc., and their mechanisms of action are limited to hemodynamic regulation, neuroendocrine inhibition and correction of metabolic disorders. However, such treatments can only relieve symptoms and delay disease progression, but cannot reverse myocardial cell damage and fibrosis remodeling. For example, although neuroendocrine antagonists can improve prognosis, they lack the ability to directly intervene in core pathological links such as abnormal phosphorylation of myocardial cytoskeletal proteins. In addition, long-term medication can easily cause side effects such as renal damage and electrolyte disorders, and individualized medication regimens are limited by the heterogeneity of patient pathological classifications, making it difficult to achieve precise treatment.

[0004] As an emerging direction, gene therapy has shown the potential to regulate cardiomyocyte function, but it still faces multiple obstacles: traditional gene delivery vectors, such as certain adenoviral vectors, have problems such as high immunogenicity and poor targeting; gene transfection efficiency is low and expression is short-lived, making it difficult to maintain long-term therapeutic effects; existing strategies lack the ability to precisely regulate key pathological mechanisms such as abnormal phosphorylation of cardiomyocyte skeletal proteins. Although existing AAV gene therapy has shown advantages in some aspects, it also has some limitations, such as differences in tissue targeting between different serotypes, potential immunogenicity, and insufficient precise control of expression in specific intracellular compartments. At present, there are no public reports on the precise regulation of Desmin phosphorylation levels by specifically regulating the cytoplasmic expression of PPM1K, and using this as a mature technical solution for the treatment of heart failure and related diseases. The present invention provides an innovative solution to this gap.

[0005] In response to the above technical bottlenecks, the present invention proposes a gene delivery system for cytoplasmic-specific expression of PPM1K, as well as its preparation method and application, to improve cardiac contractile function by precisely regulating the phosphorylation level of Desmin in myocardial cells. Summary of the Invention

[0006] The purpose of the present invention is to provide a gene delivery system for cytoplasmic-specific expression of PPM1K, a preparation method thereof, and its application in cardiovascular diseases or muscle-related diseases, especially heart failure drugs, to solve the problems existing in the prior art.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] A method for preparing a recombinant AAV that specifically expresses PPM1K in the cytoplasm comprises the following steps:

[0009] S1. Gene expression design and vector construction: Using molecular cloning techniques, the PPM1K gene or a functional mutant of the PPM1K gene is inserted into an AAV vector or other viral / non-viral vector, and a detectable tag is added to the C-terminus to form a recombinant plasmid. The recombinant plasmid is transformed into competent Escherichia coli and amplified. After plasmid extraction, the recombinant AAV or other viral / non-viral vector plasmid is obtained.

[0010] S2. Virus packaging and amplification: The recombinant AAV plasmid, helper plasmid, and capsid plasmid are co-transfected into packaging cells using a transfection reagent. After transfection, the cells and culture supernatant are collected, and freeze-thaw buffer is added and repeatedly frozen and thawed to obtain a cell lysate; the cell lysate is centrifuged, the supernatant is obtained, and purification and filtration are performed to obtain purified virus;

[0011] S3. Preserve the purified virus to obtain a recombinant adeno-associated virus that specifically expresses PPM1K in the cytoplasm.

[0012] Furthermore, a method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K comprises the following steps:

[0013] S1. Gene expression design and vector construction:

[0014] Inserting the PPM1K gene or its functional variant into an AAV vector by, but not limited to, enzyme ligation or other suitable molecular cloning techniques, and adding a detectable tag at the C-terminus to form a recombinant plasmid; transforming the recombinant plasmid into competent Escherichia coli and amplifying it, and extracting the plasmid to obtain a recombinant AAV plasmid;

[0015] S2. Virus packaging and amplification:

[0016] Co-transfecting the recombinant AAV plasmid, helper plasmid, and capsid plasmid into HEK293T cells or other suitable packaging cells using a transfection reagent, collecting the cells and culture supernatant after transfection, adding freeze-thaw buffer and repeatedly freezing and thawing to obtain a cell lysate; centrifuging the cell lysate and obtaining the supernatant, purifying and filtering the supernatant using an equivalent purification technique including but not limited to ultrafiltration, chromatography, or a combination thereof to obtain a purified virus;

[0017] In the preparation process of step S2 above, the purification method described above can be selected or combined by those skilled in the art according to the actual production scale, cost control and purity requirements, using other known virus purification techniques, such as density gradient centrifugation (such as cesium chloride density gradient centrifugation, iodixanol density gradient centrifugation), various types of chromatography techniques (such as ion exchange chromatography, affinity chromatography, molecular sieve chromatography, hydrophobic interaction chromatography, etc.) to purify the virus.

[0018] S3. Store the purified virus at -80°C to obtain a recombinant AAV that specifically expresses PPM1K in the cytoplasm.

[0019] During the above preparation process, it should be noted that: the present invention preferably achieves cytoplasmic-specific expression by deleting the N-terminal 2-87 amino acids of PPM1K. However, those skilled in the art will appreciate that other modifications, such as introducing specific point mutations, partial sequence replacements, or fusing cytoplasmic retention signals to the PPM1K protein, can achieve the purpose of the present invention as long as they can prevent PPM1K from entering the mitochondria and localize it primarily in the cytoplasm while retaining its catalytic activity. These modifications are equivalent replacement schemes that can be anticipated by those skilled in the art based on the teachings of the present invention.

[0020] Furthermore, in step S1, the PPM1K gene functional mutant is a mitochondrial targeting sequence deletion mutant of a sequence modified to achieve cytoplasmic-specific expression and retain the catalytic activity of PPM1K, or a sequence having at least 80% sequence homology thereto and retaining the function.

[0021] Furthermore, in step S1, the AAV vector is a recombinant adeno-associated virus vector comprising a promoter operable in mammalian cells, a PPM1K target gene expression cassette, and a polyadenylation signal.

[0022] Preferably, in step S1, the AAV vector is a recombinant adeno-associated virus vector comprising a CMV promoter PPM1K target gene expression cassette and an SV40 PolyA polyadenylation signal.

[0023] It should be noted that the expression of the PPM1K gene described in this invention can be driven by a constitutive promoter (such as CMV). Alternatively, tissue-specific promoters (such as the cardiomyocyte-specific promoters cTnT and αMHC) or inducible promoters can be considered to further enhance the specificity and controllability of expression. Future optimization of other vector components is possible, such as codon optimization to improve expression efficiency or ITR sequence modification to enhance vector performance.

[0024] Furthermore, the AAV vector is an AAV vector that can effectively express PPM1K and target cardiomyocytes.

[0025] Furthermore, the AAV vector is a vector skeleton corresponding to AAV serotypes such as AAV1, AAV2, AAV5, AAV6, AAV8, and AAVrh10.

[0026] Preferably, the AAV vector is specifically pAV-CTNT-P2A-GFP.

[0027] Furthermore, in step S1, the detectable tag is at least one of an HA tag, a FLAG tag, and a Myc tag.

[0028] Preferably, in step S1, the detectable tag is an HA tag. If an HA tag is used, the amino acid sequence of the peptide tag is preferably YPYDVPDYA or a derivative thereof, or an amino acid sequence of another epitope tag such as FLAG (DYKDDDDK) or Myc (EQKLISEEDL), or a nucleic acid sequence encoding such an amino acid sequence.

[0029] Furthermore, in step S1, the competent Escherichia coli Stbl3 strain is used.

[0030] Furthermore, in step S1, the enzyme digestion and ligation method is specifically double digestion with AsiSI and MluI restriction endonucleases.

[0031] Furthermore, in step S1, the specific operation of screening the plasmid is:

[0032] The transformed bacterial liquid was spread on LB solid medium containing ampicillin or other corresponding antibiotics and cultured overnight at 37°C. Monoclonal colonies were selected for PCR identification, and plasmids were extracted from positive clones. The extracted plasmids were used to verify whether the size of the inserted fragment met the expected band, and finally, sequencing primers were used for verification.

[0033] Furthermore, the sequence of the forward primer in the sequencing primer is GCAGAAGTTGGTCGTGAGGCA (SEQ ID NO: 1) or a functional equivalent thereof, or a sequence with at least 80% sequence homology, and the sequence of the reverse primer is TCGCCGGACACGCTGAACT (SEQ ID NO: 2) or a functional equivalent thereof, or a sequence with at least 80% sequence homology.

[0034] Furthermore, in step S2, the auxiliary plasmid is a plasmid containing AAV Rep and Cap genes.

[0035] Furthermore, in step S2, the auxiliary plasmid is an auxiliary plasmid that can provide trans-acting factors required for AAV replication and packaging, and can correspond to different AAV serotypes.

[0036] The AAV serotypes include but are not limited to AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, and AAVrh10.

[0037] In the above technical solution, it should be noted that the present invention preferably uses the AAV9 serotype because it has good natural affinity for cardiomyocytes. However, other AAV serotypes (such as AAV1, AAV2, AAV5, AAV6, AAV8, AAVrh10, etc.) or genetically engineered AAV serotypes with specific tissue or cell targeting may also be suitable for the present invention. In addition, other types of viral vectors (such as lentiviral vectors, adenoviral vectors, etc., whose safety and immunogenicity need to be considered) or non-viral delivery systems (such as liposomes, polymer nanoparticles, exosomes, mRNA direct delivery technology, etc.) can also be considered for delivering modified PPM1K genes or their functional variants to achieve cytoplasmic-specific expression in target cells.

[0038] Preferably, in step S2, the auxiliary plasmid is pAAV-RC and / or pAAV2 / 9-RC.

[0039] Furthermore, in step S2, the capsid plasmid is a plasmid containing adenovirus helper genes.

[0040] Preferably, in step S2, the capsid plasmid is Adv-Helper.

[0041] Furthermore, in step S2, the specific operation of the co-transfection is:

[0042] The recombinant AAV plasmid, helper plasmid, capsid plasmid and transfection reagent were added to Opti-MEM medium respectively, incubated at room temperature for 5 minutes and then mixed. After standing for 15 minutes, they were added dropwise to the cell culture dish. After 6 hours of transfection, the culture medium was replaced with complete medium containing 10% FBS and the transfection was continued for 72 hours.

[0043] Furthermore, the ratio of the recombinant AAV plasmid, helper plasmid and capsid plasmid is sufficient to effectively produce high-titer virus.

[0044] Preferably, the ratio of the recombinant AAV plasmid, helper plasmid and capsid plasmid is (1-2):(1-2):1.

[0045] Furthermore, in step S2, the mass ratio of the total mass of the recombinant AAV plasmid, the helper plasmid and the capsid plasmid to the mass of the transfection reagent is a ratio sufficient to achieve efficient transfection.

[0046] Furthermore, in step S2, the mass ratio of the total mass of the recombinant AAV plasmid, the helper plasmid and the capsid plasmid to the transfection reagent is 1:(1-5).

[0047] Furthermore, the HEK293T cells have a passage number of ≤20 and a cell density of 70-80%.

[0048] Furthermore, the culture medium used for the HEK293T cells is based on DMEM culture medium, supplemented with a mixture of 10 wt% FBS and 1 wt% penicillin-streptomycin, and the culture conditions are 37° C. and 5% CO 2 .

[0049] Furthermore, the number of freeze-thaw cycles is 3-4 times.

[0050] Furthermore, the freeze-thaw temperature is minus 80°C / 37°C.

[0051] Furthermore, the freeze-thaw buffer comprises 10 mM Tris-HCl, 150 mM NaCl, and 1 mM MgCl2 at a pH of 8.0.

[0052] Furthermore, the centrifugal temperature is 0-4°C, the centrifugal speed is 10000-12000 rpm, and the centrifugal time is 8-10 minutes.

[0053] The gene delivery system prepared by the preparation method of the gene delivery system for cytoplasmic specific expression of PPM1K is used in diseases related to PPM1K dysfunction or abnormal Desmin phosphorylation.

[0054] The gene delivery system prepared by the above-mentioned method for preparing a gene delivery system for cytoplasmic specific expression of PPM1K is used in the preparation of a gene delivery system for treating or preventing cardiovascular diseases or skeletal muscle diseases and other diseases related to PPM1K dysfunction or abnormal Desmin phosphorylation.

[0055] It should be noted that in the above scheme, given the potential role of PPM1K and Desmin phosphorylation in other cardiovascular diseases (such as various types of cardiomyopathies, including dilated cardiomyopathy, hypertrophic cardiomyopathy, arrhythmogenic cardiomyopathy, etc.; myocardial fibrosis; ischemic heart disease, etc.) and certain skeletal muscle diseases (such as muscular dystrophy, myasthenia, etc., in which Desmin, as an important skeletal protein, may also undergo abnormal phosphorylation), the treatment strategy described in the present invention may also be applicable to the treatment or prevention of these related diseases.

[0056] Furthermore, the cardiovascular disease includes but is not limited to heart failure, cardiomyopathy and skeletal muscle disease.

[0057] Application of the gene delivery system prepared by the above-mentioned preparation method of the gene delivery system for cytoplasm-specific expression of PPM1K in adeno-associated virus particles.

[0058] Furthermore, the titer of the adeno-associated virus particles is preferably at least 1×10 12vg / mL.

[0059] The gene delivery system prepared by the preparation method of the gene delivery system for cytoplasmic specific expression of PPM1K is used in drugs related to PPM1K dysfunction or abnormal Desmin phosphorylation.

[0060] Furthermore, the specific method of using the drug comprises administering to a mammal a therapeutically effective amount of the gene delivery system prepared in the aforementioned technical solution, or a pharmaceutical composition comprising the gene delivery system.

[0061] Furthermore, the administration is performed alone.

[0062] Furthermore, the administration is specifically performed in combination with other heart failure therapeutic drugs or gene therapy agents.

[0063] Furthermore, the other heart failure therapeutic drugs or gene therapy agents include but are not limited to beta-blockers, angiotensin-converting enzyme inhibitors, angiotensin II receptor antagonists, diuretics, aldosterone receptor antagonists, enkephalinase inhibitors, and SGLT2 inhibitors.

[0064] Beneficial effects of the present invention:

[0065] The present invention utilizes a gene delivery system, preferably an adeno-associated virus (AAV), to specifically overexpress PPM1K in the cytoplasm. This system directly targets the core pathological component of heart failure (abnormal desmin phosphorylation), demonstrating significant advantages in restoring cardiac contractile function, inhibiting myocardial remodeling, and improving metabolism. Its precise targeting, long-term safety, and broad-spectrum applicability offer a revolutionary therapeutic strategy for heart failure and related diseases, with significant scientific value and potential for clinical translation.

[0066] Specifically, by deleting the mitochondrial targeting sequence of PPM1K (N-terminal 2-87aa): Ppm1k2-87aa Del-AAV9, or adopting other equivalent modifications to achieve cytoplasmic-specific expression of PPM1K, such as point mutations, partial sequence replacements, or the addition of cytoplasmic retention signals, the protein function is restricted to the cytoplasm while retaining the core catalytic activity, avoiding the metabolic interference that may be caused by traditional mitochondrial localization. At the same time, the core pathological link of Desmin phosphorylation is precisely regulated to enhance therapeutic specificity, achieve long-term stable expression of PPM1K in cardiomyocytes, and avoid systemic off-target effects. The prepared gene delivery vector, especially the characteristic of adeno-associated virus expressing PPM1K in the cytoplasm specifically, directly inhibits the abnormal phosphorylation of the cardiomyocyte cytoskeletal protein Desmin, restores the function of Desmin in maintaining cytoskeletal integrity and mechanical conduction, thereby enhancing myocardial contractility and significantly improving cardiac function indicators. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0068] Figure 1 and Figure 2 This is a graph showing the test results of the PPM1K expression level in the cytoplasm of mouse cardiomyocytes by the cytoplasm-specific PPM1K-expressing adeno-associated virus prepared in the present invention.

[0069] Figure 3 This is a diagram showing the results of verifying the effect of the cytoplasm-specific PPM1K-expressing adeno-associated virus prepared in the present invention in a heart failure model. DETAILED DESCRIPTION

[0070] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0071] It should be understood that the present invention is not limited to the specific structures, operating steps or materials shown, and those skilled in the art can make modifications and changes based on the teachings of the present invention. In addition, the terms "comprise", "include" or any other variants thereof are intended to cover non-exclusive inclusions, so that the process, method, article or equipment comprising a series of elements includes not only those elements, but also includes other elements that are not explicitly listed, or elements inherent to such process, method, article or equipment. In the absence of further restrictions, the elements defined by the statement "comprise a ..." do not exclude the presence of other identical elements in the process, method, article or equipment comprising the elements.

[0072] Example 1

[0073] A method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K comprises the following steps:

[0074] S1. Gene expression design and vector construction:

[0075] The PPM1K gene was inserted into the AAV vector by enzyme digestion and ligation, and an HA tag was added to the C-terminus to form a recombinant plasmid; the recombinant plasmid was transformed into competent Escherichia coli and amplified, and after plasmid screening, specifically: the transformed bacterial liquid was spread on LB solid medium containing ampicillin and cultured overnight at 37°C, single clones were selected for PCR identification, and plasmids were extracted from positive clones; the extracted plasmid was double-digested with AsiSI and MluI to verify whether the size of the insert fragment met the expected band, and the expected band was vector (~4.5kb) + insert fragment (~1.2kb), and finally sequencing primers were used for verification, the sequence of the forward primer in the sequencing primers was GCAGAAGTTGGTCGTGAGGCA (SEQ ID NO: 1), and the sequence of the reverse primer was TCGCCGGACACGCTGAACT (SEQ ID NO: 2), thereby obtaining a recombinant AAV plasmid;

[0076] In this embodiment, the enzyme ligation method is specifically double enzyme digestion with AsiSI and MluI restriction endonucleases; in this embodiment, the AAV vector is pAV-CTNT-P2A-GFP, which contains a CMV promoter and an SV40 PolyA signal.

[0077] In this example, the sequence of the PPM1K gene is shown in SEQ ID NO:3. The N-terminal amino acids 2-87 of the encoded protein are deleted to achieve cytoplasmic-specific expression. Those skilled in the art will understand that the PPM1K gene can refer to the coding sequence comprising the amino acid sequence set forth in SEQ ID NO:3, or variant sequences that share at least 80% sequence homology with it, retain PPM1K catalytic activity, and achieve cytoplasmic-specific expression. An HA tag was added to the C-terminus for detection purposes; its amino acid sequence is YPYDVPDYA.

[0078] S2. Virus packaging and amplification:

[0079] The recombinant AAV plasmid, helper plasmid and capsid plasmid were co-transfected into HEK293T cells using a transfection reagent. The specific co-transfection procedure was as follows:

[0080] The recombinant AAV plasmid, helper plasmid, capsid plasmid and transfection reagent were added to Opti-MEM medium respectively, incubated at room temperature for 5 minutes, mixed, and allowed to stand for 15 minutes before adding dropwise to the cell culture dish. After 6 hours of transfection, the culture medium was replaced with complete medium containing 10% FBS, and the transfection was continued for 72 hours; among them, the ratio of recombinant AAV plasmid, helper plasmid and capsid plasmid was 1:1:1, and the mass ratio of the total mass of the recombinant AAV plasmid, helper plasmid and capsid plasmid to the transfection reagent was 1:3.

[0081] After transfection, cells and culture supernatant were collected and repeatedly frozen and thawed three times in freeze-thaw buffer at -80°C / 37°C to obtain cell lysate. The freeze-thaw buffer consisted of 10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 1 mM MgCl2.

[0082] The cell lysate was centrifuged and the supernatant was collected. The centrifugation temperature was 4°C, the centrifugation rate was 12000 rpm, and the centrifugation time was 10 minutes. The supernatant was then purified by ultrafiltration through an ultrafiltration tube with a molecular weight cutoff of 100 kDa to obtain purified virus.

[0083] In this embodiment, the helper plasmid is pAAV-RC; the capsid plasmid is Adv-Helper; the HEK293T cells used have a passage number of ≤20 generations and a cell density of 70%. The culture medium is based on DMEM culture medium supplemented with a mixture of 10 wt% FBS and 1 wt% penicillin-streptomycin, and the culture conditions are 37°C and 5% CO2.

[0084] S3. The purified virus was stored at -80°C to obtain a cytoplasmic-specific adeno-associated virus expressing PPM1K. The titer of the virus was 3.64×10 13vg / mL, and its specific sequence is: GCGATCGCCACCATGCCCAAAATTAGCCTGGAGAACGTGGGCTGTGCCTCTCTCATTGGCAAACGGAAAGAAAACGAAGATCGATTTGGGTTTGCACAGCTGACAGAAGAGGTGCTATACTTCGCAGTCTATGATGGACATGGGGGCCCTGCAGCCGCTGACTTCTGTCACACACACATGGAGAAATGTGTTATGGATTTGCTTCCTCGGGAGAAAGACTTGGAAACTGTCCTGACCTTGGCCTTTCTAGAAATAGATAAAGCCTTCGCGAGTTATGCCCACCTGTCTGCAGATGCAAGCCTCCTGACCTCTGGGACTACTGCAACAGTAGCCCTGTTGAGAGATGGTGTTGAACTGGTGGTAGCCAGTGTTGGAGACAGCCGGGCTCTTTTGTGTAGAAAAGGAAAACCCATGAAGCTGACCACTGACCATACCCCAGAAAGAAAAGATGAGAAAGAAAGGATCAAGAAATTCGGTGGGTTTGTAGCTTGGAATAGTTTGGGACAGCCCCATGTAAATGGCAGACTTGCAATGACAAGGAGTATCGGAGATTTGGATCTTAAAGCCAGTGGGGTAATTGCAGAACCTGAGACAACAAGGATTAAGCTCTACCATGCTGACGACAGTTTCCTGGTCCTTACCACAGATGGGATTAACTTCATGGTGAATAGTCAAGAGATCTGCGACTTTGTCAACCAGTGCCACGATCCTAAAGAAGCAGCTCATTCGGTGACTGAGCAGGCAATACAGTACGGTACCGAAGACAACAGCACTGCAGTAGTGGTGCCCTTTGGTGCTTGGGGAAAATACAAGAACTCTGAAATTACCTTCTCATTCAGCAGAAGCTTTGCCTCCAGTGGGAGATGGGCCTACCCATACGATGTTCCAGATTACGCTACGCGT(SEQ ID NO:3).

[0085] Experimental Example 1

[0086] Normal mice without any gene editing or surgical intervention, the strain was C57BL / 6J mice, 8 weeks old, recorded as the WT group.

[0087] Experimental Example 2

[0088] The heart failure model mice were induced by aortic arch ligation. The strain was C57BL / 6J mice, 8 weeks old, and were designated as TAC group.

[0089] Experimental Example 3

[0090] The virus prepared in Example 1 was injected into the tail vein of mice (C57BL / 6J mice, 8 weeks old) with a dose of 1×10 12 vg / mouse, recorded as TAC-Del2-89 AAV9 group.

[0091] The expression level of PPM1K in the cytoplasm of cardiomyocytes of mice in the TAC group and TAC-Del2-89 AAV9 group was tested and compared with that of the sham control group (no aortic arch ligation).

[0092] Three days after TAC surgery, Ppm1k 2-87aa Del-AAV9 was injected into TAC mice via the tail vein at a dose of 1×10 12 vg / mouse. After the experiment, the hearts of the three groups of mice, Sham, TAC, and TAC&Ppm1k 2-87aa Del-AAV9, were taken and the cardiomyocytes of the three groups of mice were isolated using the Langendorff isolated heart perfusion method, and the cytoplasmic components of the cardiomyocytes were extracted. The expression levels of PPM1K in the cytoplasm of the cardiomyocytes of the three groups of mice were detected by Western blotting. The test results are as follows Figure 1 and 2 shown.

[0093] exist Figure 1 and Figure 2 The results showed that the level of PPM1K in the myocardial cytoplasm of mice in the TAC&Ppm1k 2-87aa Del-AAV9 group was significantly higher than that in the TAC group, but there was no significant difference compared with the sham group. These results suggest that Ppm1k 2-87aa Del-AAV9 specifically increases the level of PPM1K in the myocardial cytoplasm of TAC mice.

[0094] The effect of the virus prepared in Example 1 on the heart failure model was verified. The EF% (ejection fraction), FS% (fractional shortening) and stroke volume (Stroke Volume) were tested on mice in the WT group, TAC group and TAC-Del2-89 AAV9 group. The specific test results are shown in Figure 1. Figure 3 shown.

[0095] Depend on Figure 3 The results showed that the EF%, FS%, and stroke volume of the TAC-Del2-89 AAV9 group were significantly higher than those of the TAC group, but not significantly different from those of the WT group, indicating that the cardiac function of TAC mice was restored after adenovirus treatment.

[0096] Throughout the specification, references to terms such as "one embodiment," "example," or "specific example" indicate that the specific features, structures, materials, or characteristics described in conjunction with that embodiment or example are included in at least one embodiment or example of the present invention. In this specification, schematic representations of these terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

[0097] The above content is merely an example and explanation of the concept of the present invention. Those skilled in the art may make various modifications or additions to the described specific embodiments or replace them in a similar manner. As long as they do not deviate from the concept of the invention or exceed the scope defined by the claims, they should all fall within the scope of protection of the present invention.

Claims

1. A method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K, characterized in that: The specific steps include: S1. Gene expression design and vector construction: Insert the PPM1K gene or a functional mutant of the PPM1K gene into an AAV vector or other viral / non-viral vector using restriction endonuclease or molecular cloning techniques, and add a detectable tag at the C-terminus to form a recombinant plasmid. Transform the recombinant plasmid into competent Escherichia coli and amplify it. After plasmid extraction, recombinant AAV or other viral / non-viral vector plasmid is obtained. S2. Virus packaging and amplification: The recombinant AAV plasmid, helper plasmid, and capsid plasmid are co-transfected into packaging cells using a transfection reagent. After transfection, the cells and culture supernatant are collected, and freeze-thaw buffer is added and repeatedly frozen and thawed to obtain a cell lysate; the cell lysate is centrifuged, the supernatant is obtained, and purification and filtration are performed to obtain purified virus; S3. Preserve the purified virus to obtain a recombinant adeno-associated virus that specifically expresses PPM1K in the cytoplasm.

2. The method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 1, characterized in that: In step S1, the enzyme digestion and ligation method is specifically double digestion with AsiSI and MluI restriction endonucleases.

3. The method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 1, characterized in that: In step S1, the specific operation of screening and extracting plasmids is as follows: The transformed bacterial liquid was spread on LB solid medium containing ampicillin and cultured overnight at 37°C. Monoclonal colonies were selected for PCR identification, and plasmids were extracted from positive clones. The extracted plasmids were used to verify whether the size of the inserted fragment met the expected band, and finally, sequencing primers were used for verification.

4. The method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 3, characterized in that: The sequence of the forward primer in the sequencing primers is SEQ ID NO: 1 or its functional equivalent, or a sequence with at least 80% sequence homology, and the sequence of the reverse primer is SEQ ID NO: 2 or its functional equivalent, or a sequence with at least 80% sequence homology.

5. The method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 1, characterized in that: In step S2, the auxiliary plasmid is a plasmid containing AAV Rep and Cap genes.

6. The method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 1, characterized in that: In step S2, the capsid plasmid is a plasmid containing adenovirus helper genes.

7. The method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 1, characterized in that: The ratio of the recombinant AAV plasmid, the helper plasmid and the capsid plasmid is 1-2:1-2:

1.

8. The method for preparing a gene delivery system for cytoplasm-specific expression of PPM1K according to claim 1, characterized in that: The mass ratio of the total mass of the recombinant AAV plasmid, helper plasmid and capsid plasmid to the mass of the transfection reagent is 1:1-5. 9 . A gene delivery system for cytoplasm-specific expression of PPM1K, prepared by the method for preparing a gene delivery system for cytoplasm-specific expression of PPM1K according to any one of claims 1 to 8 .

10. A gene delivery system for cytoplasm-specific expression of PPM1K according to claim 9, characterized in that: The gene delivery system is a recombinant AAV vector comprising the following components: The PPM1K gene or a functional variant thereof, a promoter operable in mammalian cells and a polyadenylation signal.

11. A gene delivery system for cytoplasm-specific expression of PPM1K according to claim 9, characterized in that: The promoter operable in mammalian cells is the CMV promoter.

12. A gene delivery system for cytoplasm-specific expression of PPM1K according to claim 9, characterized in that: The polyadenylation signal is the SV40 PolyA signal.

13. The gene delivery system for cytoplasm-specific expression of PPM1K according to claim 9, characterized in that: The gene delivery system also includes a detectable label.

14. A gene delivery system for cytoplasm-specific expression of PPM1K according to claim 13, characterized in that: The detectable tag is at least one of an HA tag, a FLAG tag or a Myc tag. 15 . Use of the gene delivery system prepared by the method for preparing a gene delivery system for cytoplasm-specific expression of PPM1K according to any one of claims 1 to 8 in diseases associated with PPM1K dysfunction or abnormal Desmin phosphorylation.

16. Use of a gene delivery system for cytoplasm-specific expression of PPM1K according to claim 15, characterized in that: The diseases associated with PPM1K dysfunction or abnormal Desmin phosphorylation include heart failure, cardiomyopathy and skeletal muscle disease. 17 . Use of a gene delivery system prepared by the method for preparing a gene delivery system for cytoplasm-specific expression of PPM1K according to any one of claims 1 to 8 in adeno-associated virus particles.

18. Use of a gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 17, wherein the titer of the adeno-associated virus particles is at least 1×10 12 vg / mL.

19. Use of the gene delivery system prepared by the method for preparing a gene delivery system for cytoplasm-specific expression of PPM1K according to any one of claims 1 to 8 in drugs related to PPM1K dysfunction or abnormal Desmin phosphorylation.

20. Use of a gene delivery system for cytoplasm-specific expression of PPM1K according to claim 19, characterized in that: The specific method of using the drug comprises administering to a mammal a therapeutically effective amount of the gene delivery system prepared in the aforementioned technical solution, or administering to a mammal a therapeutically effective amount of a pharmaceutical composition comprising the gene delivery system.

21. Use of a gene delivery system for cytoplasm-specific expression of PPM1K according to claim 20, characterized in that: The administration is performed alone or in combination with other heart failure therapeutic drugs or gene therapy agents.

22. Use of a gene delivery system for cytoplasm-specific expression of PPM1K according to claim 21, characterized in that: The other heart failure therapeutic drugs or gene therapy agents are at least one of beta-blockers, angiotensin-converting enzyme inhibitors, angiotensin II receptor antagonists, diuretics, aldosterone receptor antagonists, enkephalinase inhibitors, and SGLT2 inhibitors.

Images