Transcription factor OfMYB187 for regulating synthesis of sweet osmanthus fragrance component beta-ionone, interaction protein OfCLpP of transcription factor OfMYB187, coding genes of transcription factor OfMYB187 and coding genes and application of transcription factor OfMYB187 and interaction protein

Abstract

The invention discloses a transcription factor OfMYB187 for regulating synthesis of beta-ionone of a sweet osmanthus fragrance component, an interaction protein OfCLpP of the transcription factor OfMYB187 as well as coding genes and application of the transcription factor OfMYB187 and the interaction protein OfCLpP, and belongs to the field of plant molecular biology. The amino acid sequence of the transcription factor OfMYB187 provided by the invention is as shown in SEQ ID NO. 2, and the amino acid sequence of the interaction protein OfCLpP of the transcription factor OfMYB187 is as shown in SEQ ID NO. 4. According to the application disclosed by the invention, a carrier constructed by promoters of OfMYB187, OfCLpP and OfCCD4 is jointly injected into a Ben's tobacco leaf, firefly and renilla determination is carried out, and a result shows that the OfMYB187 has an inhibition effect on a synthetase gene OfCCD4 of beta-ionone, but after interaction of the OfMYB187 and the OfCLpP, the OfMYB187 protein can be hydrolyzed, and the inhibition effect of the OfMYB187 protein on the OfCCD4 is relieved. The gene provided by the invention can directly or indirectly regulate and control the content of beta-ionone in osmanthus fragrans fragrance, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biology, and specifically relates to a transcription factor OfMYB187 that regulates the synthesis of β-ionone, a component of osmanthus fragrance, its interacting protein OfCLpP, and the encoding genes and applications of the two. Background Art

[0002] The MYB transcription factor family possesses a highly conserved DNA domain at its N-terminus. These domains typically consist of one to four distinct MYB repeat domains (Rs), each containing approximately 50 to 52 amino acids, with a conserved tryptophan (W) residue every 18-19 amino acids. MYB transcription factors regulate nearly the entire plant life cycle, participating in multiple biological processes, including responses to abiotic stresses, primary and secondary metabolism, growth and development, hormone synthesis, and signal transduction. They can regulate the expression of genes for key enzymes that influence floral fragrance synthesis, such as TPS and CCD4.

[0003] ClpP (Casein lytic proteinase P) is a serine protease widely present in eukaryotic cells and prokaryotes. It can form a variety of ClpP protease complexes with various types of AAA+ (ATPase associated with various cellular activity) superfamily ATPases. Its main function is to clear or degrade improperly synthesized, damaged, denatured, aggregated, or useless proteins in bacterial cells, and maintain the dynamic balance of intracellular proteins under normal metabolism and stress stimulation.

[0004] Osmanthus fragrans, a small evergreen tree in the genus Oleaceae, is one of China's ten famous flowers. Its rich, refreshing fragrance makes its flowers and essential oil highly sought after in the high-end perfume, fragrance, and cosmetics industries when in full bloom. Previous studies have comprehensively identified and classified the compounds that contribute to the fragrance of osmanthus fragrans. They discovered that β-ionone is a key component that strongly influences the fragrance of osmanthus fragrans, and that CCD4 is a key enzyme gene that regulates its formation. However, little research has been conducted on the regulatory network underlying the synthesis and release of β-ionone, a key osmanthus fragrance component. Therefore, exploring the regulatory network that regulates β-ionone is of great significance. Summary of the Invention

[0005] In response to the above-mentioned problems existing in the prior art, the first technical problem to be solved by the present invention is to provide a transcription factor OfMYB187 and its encoding gene for regulating the synthesis of β-ionone, a key aroma substance in osmanthus. The second technical problem to be solved by the present invention is to provide a protein OfCLpP that interacts with the transcription factor OfMYB187 and its encoding gene. The third technical problem to be solved by the present invention is to provide the interacting OfMYB187 and OfCLpP protein genes to directly or indirectly regulate the expression of the β-ionone synthase gene OfCCD4, thereby achieving the purpose of regulating the synthesis of β-ionone.

[0006] In view of the above problems existing in the prior art, the technical solutions adopted by the present invention are as follows:

[0007] A transcription factor OfMYB187 that regulates the synthesis of β-ionone, a component of osmanthus fragrance, has an amino acid sequence as shown in SEQ ID NO.2.

[0008] The nucleotide sequence of the gene encoding the transcription factor OfMYB187 is shown in SEQ ID NO.1.

[0009] An expression cassette, recombinant vector, recombinant bacteria or recombinant cell containing the gene encoding the transcription factor OfMYB187.

[0010] A protein OfCLpP that interacts with the transcription factor OfMYB187, whose amino acid sequence is shown in SEQ ID NO.4.

[0011] The nucleotide sequence of the gene encoding the protein OfCLpP is shown in SEQ ID NO.3.

[0012] An expression cassette, recombinant vector, recombinant bacteria or recombinant cell containing the gene encoding the protein OfCLpP.

[0013] The use of the gene encoding the transcription factor OfMYB187 in regulating the synthesis of β-ionone, a component of osmanthus fragrance, is any one of the following A1) or A2):

[0014] A1) constructing an overexpression vector encoding the gene for the osmanthus fragrans transcription factor OfMYB187, transforming the vector into osmanthus fragrans plants or tissues, and cultivating and screening transgenic plants or flower tissues with reduced β-ionone content in their floral fragrance;

[0015] A2) constructing a silencing vector encoding the gene for the osmanthus transcription factor OfMYB187, transforming the vector into plants or osmanthus flower tissues, and cultivating and screening transgenic plants or flower tissues with increased β-ionone content in the osmanthus flower aroma.

[0016] In the application, the overexpression vector in item A1) is 1300-OfMYB187.

[0017] A method for regulating the synthesis of β-ionone, a component of osmanthus fragrance, the method being specifically any one of the following B1) or B2):

[0018] B1) constructing an overexpression vector encoding the gene for the protein OfCLpP according to claim 4, and transforming the vector into osmanthus plants or osmanthus tissues to enhance the hydrolysis of the transcription factor OfMYB187 according to claim 1 in osmanthus, thereby increasing the content of β-ionone in the osmanthus aroma;

[0019] B2) constructing a silencing vector encoding the gene of the protein OfCLpP according to claim 4, and transforming it into osmanthus plants or osmanthus tissues, thereby reducing the hydrolysis of the transcription factor OfMYB187 according to claim 1 in osmanthus and lowering the content of β-ionone in the osmanthus fragrance.

[0020] In the application, the transformation described in B1) or B2) is mediated by Agrobacterium.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] 1) The present invention discloses the use of OfMYB187 in the synthesis of β-ionone, a key aromatic substance in osmanthus. The nucleotide sequence of OfMYB187 is shown in SEQ ID NO. 1. The present invention infected osmanthus petals with the OfMYB187 gene and performed GC-MS analysis. The results showed that OfMYB187 inhibited the synthesis of β-ionone.

[0023] 2) The present invention discloses a protein, OfCLpP, that interacts with OfMYB187. The nucleotide sequence of OfCLpP is shown in SEQ ID NO. 3. The present invention screened OfMYB187 using a yeast two-hybrid library to obtain OfCLpP, and validated the protein through yeast two-hybrid dot-to-dot, BiFc, LCA, and co-IP assays. The results demonstrated an interaction between OfMYB187 and OfCLpP.

[0024] 3) The present invention discloses the effect of the interaction between OfMYB187 and OfCLpP proteins on the β-ionone synthase gene OfCCD4. This study co-injected OfMYB187, OfCLpP, and OfCCD4 into Nicotiana benthamiana leaves and assayed luciferin and rennin. The results showed that OfMYB187 inhibited OfCCD4, but the interaction between OfMYB187 and OfCLpP alleviated the inhibitory effect of OfMYB187 on OfCCD4 due to OfCLpP's hydrolysis of the OfMYB187 protein.

[0025] In summary, OfMYB187 and OfCLpP provided by the present invention can effectively regulate the increase or decrease of the content of β-ionone in the fragrance of osmanthus, thereby obtaining new transgenic osmanthus varieties with different floral fragrance types and styles, and have good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The electrophoresis diagrams of OfMYB187 and OfCLpP gene amplification are shown, where A is the electrophoresis diagram of OfMYB187 gene; B is the electrophoresis diagram of OfCLpP gene;

[0027] Figure 2 These are the bacterial test images of OfMYB187 and OfCLpP ligation transformation, where A is the bacterial test image of OfMYB187 ligation transformation; B is the bacterial test image of OfCLpP ligation transformation;

[0028] Figure 3 Double enzyme digestion verification images, where A is the OfMYB187 digestion verification image; B is the OfCLpP digestion verification image;

[0029] Figure 4 This is the bacterial test result of plasmid 1300-OfMYB187;

[0030] Figure 5 Figures 1 and 2 show the validation of OfMYB187 transient transformation into osmanthus petals. Figure A shows a comparison of OfMYB187 expression levels after transient transformation of osmanthus petals with EV and 1300-OfMYB187; Figure B shows a comparison of the differential expression of OfMYB187 between the experimental and control groups after transient transformation of osmanthus petals with EV and the OfMYB187 overexpression vector; and Figure C shows a comparison of the β-ionone content in the osmanthus fragrance produced after transient transformation of osmanthus petals with EV and 1300-OfMYB187.

[0031] Figure 6 This is the bacterial test picture after AH109 was transformed with pGBKT7-OfMYB187 vector;

[0032] Figure 7The results of the OfMYB187 and OfCLpP protein interaction experiment are shown in Figure 1. A is the yeast two-hybrid assay result; B is the bimolecular fluorescence complementation assay result; C is the luciferin complementation assay result; D is the immunoprecipitation assay result.

[0033] Figure 8 Figure 2 is a WB image of OfCLpP protein hydrolyzing OfMYB187 protein; A is a fluorescence detection image of transformed tobacco leaves; B is a WB experimental result image of OfCLpP protein hydrolyzing OfMYB187 protein;

[0034] Figure 9 Figure 3 is a diagram showing the interaction between OfMYB187, OfCLpP proteins and OfCCD4, where A is a schematic diagram of the partial structures of the SK, SK-OfMYB187, SK-OfCLpP and 0800-OfCCD4 recombinant vectors; B is a fluorescence detection diagram of tobacco leaves transformed by Agrobacterium; and C is a comparison of the LUC / REN detection results in tobacco leaves transformed by Agrobacterium in each group. DETAILED DESCRIPTION

[0035] To further clarify the objectives, technical solutions, and advantages of the present invention, the present invention is further described below with reference to specific examples. Unless otherwise specified in the following examples, the technical means used are conventional means well known to those skilled in the art. Molecular biology experimental methods not specifically described can be performed by referring to the methods listed in J. Sambrook's Molecular Cloning: A Laboratory Manual (3rd edition), conventional methods in the art, or according to the kits and product instructions.

[0036] The materials used in this application are flowers of Osmanthus fragrans in full bloom, and the Nicotiana benthamiana seedlings used are provided by Wang Lianggui's research group at Nanjing Forestry University.

[0037] Example 1: Acquisition and functional verification of the transcription factor OfMYB187 gene

[0038] 1. Total RNA extraction and cDNA acquisition

[0039] Total RNA was extracted from Osmanthus fragrans flowers using the EASYspin Plus Plant RNA kit. Using the extracted total RNA as a template, the extracted RNA was reverse transcribed into cDNA using the TransScript® IV One-Step gDNA Removal and cDNA Synthesis SuperMix Reverse Transcription Kit. The resulting cDNA was diluted 10-fold with water and stored at -20°C.

[0040] 2. Design primers

[0041] Based on the Osmanthus fragrans genome database obtained by the previous research team, a gene sequence was screened and named OfMYB187. The full-length nucleotide sequence of the precursor sequence OfMYB187 gene was analyzed for restriction sites using BioXM software, and SmaⅠ and KpnⅠ enzymes were selected as the two restriction endonucleases. Primers were designed using CE design software. Fill in the relevant information as required, including the sequence near the restriction site on the vector, the full length of the target gene, and fill in the two restriction sites (5' end and 3' end) in sequence to obtain the amplification primers. The designed sequence was sent to Qingke Biotechnology Co., Ltd. for synthesis. The primer sequences are as follows:

[0042] pSuper1300-OfMYB187-F:

[0043] 5'-aagcttctgcaggggcccgggATGGGAAGGTCTCCTTGCTGT-3',

[0044] pSuper1300-OfMYB187-R:

[0045] 5'-gcccttgctcaccatggtaccTTTCATTTCCAGGCTTCTGTATTCC-3';

[0046] 3. Double enzyme digestion of vector

[0047] Take the pSuper1300 vector out of the -80°C ultra-low temperature freezer in advance for activation and shake-incubation. Extract the pSuper1300 vector plasmid according to the kit, and then perform a double enzyme digestion experiment. The system is as follows:

[0048] The 50 μL enzyme digestion reaction system is: SmaⅠ 1.5 μL, KpnⅠ 1.5 μL, Buffer 5 μL, vector plasmid X μL, ddH2O added to 50 μL.

[0049] Where X (µL) = 3000 ng / vector plasmid concentration (ng / µL). Gently vortex the centrifuge tube to mix thoroughly, centrifuge for 6 seconds, and incubate in a 37°C water bath for 1 hour. Submit the double-enzyme-digested vector for agarose gel electrophoresis and then recover the fragment using a kit.

[0050] 4. Target gene amplification

[0051] PCR amplification of the target gene was performed using 10-fold diluted cDNA as a template.

[0052] The PCR reaction system is: 1 μL Forward Primer, 1 μL Forward Primer, 1 μL cDNA, 10 μL PrimeSTAR, and 7 μL ddH2O. Three 20 μL systems are prepared for each gene.

[0053] The PCR reaction conditions were as follows: denaturation at 98°C for 10 s; annealing at 58°C for 15 s, extension at 72°C for 1 min, 35 cycles; total extension at 72°C for 10 min; and termination at 16°C.

[0054] The obtained amplified product was subjected to agarose electrophoresis and then recovered by gel cutting using a kit, such as Figure 1 As shown in A.

[0055] 5. Connection conversion

[0056] Ligation: The amplified product of the OfMYB187 gene was recombined and ligated with the linearized vector fragment (pSuper1300).

[0057] The ligation reaction system is: 200 ng of target fragment recovery product, 100 ng of plasmid double enzyme digestion recovery product, 2 μL of ligase, 4 μL of buffer, and ddH2O added to 20 μL.

[0058] The centrifuge tube was shaken slightly to mix, centrifuged for 6 seconds, and incubated in a 37°C water bath for 30 minutes, and then placed on ice for 2 minutes.

[0059] Transformation: In a clean bench, pipette 5 μL of the ligation product into 50 μL of Trelief™ 5α competent cells, flick gently to mix, incubate on ice for 5 minutes, in a 42°C water bath for 60 seconds, and then incubate on ice for 2 minutes. Add 250 μL of liquid LB (without Kana), and incubate at 37°C, 200 rpm in a shaker for 30 minutes.

[0060] Spread the plate: Take 200 μL of the incubated bacterial solution and spread it evenly on LB solid medium (containing 50 mg / L Kana) using a sterilized glass rod and let it dry. Cover with sealing film and invert it in a 37°C constant temperature incubator for 12-14 hours.

[0061] 6. Positive single colony detection and sequencing

[0062] After bacteria grow on the culture medium, single colony detection is performed in a clean bench. For each gene, multiple plump single colonies are picked and backed up in sequence on LB solid culture medium containing Kana resistance. The corresponding single colonies are then picked up with a sterile toothpick and placed in the following system for bacterial testing:

[0063] The PCR reaction system was: pSuper1300-F 1 μL, Gene-R 1 μL, 2 × Taq Master 10 μL, and ddH2O 8 μL.

[0064] The PCR reaction conditions were as follows: 94°C pre-denaturation for 3 min; 35 cycles of 94°C denaturation for 30 s, 58°C annealing for 30 s, and 72°C extension for 1 min; 72°C total extension for 10 min; and termination at 16°C. The amplified product was subjected to agarose gel electrophoresis, and positive colonies with the correct band length were selected for testing. Figure 2 The nucleotide sequence of the OfMYB187 gene was finally determined as shown in SEQ ID NO. 1, with a total length of 756 bp, and the amino acid sequence of its expressed protein was shown in SEQ ID NO. 2.

[0065] 7. Double enzyme digestion verification

[0066] The plasmid with the correct sequence obtained by sequencing was verified by double enzyme digestion.

[0067] The double enzyme digestion system is: SmaⅠ 1μL, KpnⅠ 1μL, Buffer 2μL, vector plasmid XμL, ddH2O added to 20μL.

[0068] Where X (µL) = 1000ng / vector plasmid concentration (ng / µL). Slightly shake the centrifuge tube to mix, centrifuge for 6 seconds, and incubate in a 37°C water bath for 1 hour. Perform agarose gel electrophoresis on the double-enzyme digested vector to check the double-enzyme digestion status. Figure 3 As shown in A.

[0069] 8. Transformation of Agrobacterium GV3101

[0070] Remove the GV3101 competent cells from a -80°C freezer and thaw on ice. Add 1 µL of plasmid (1300-OfMYB187) to every 33 µL of competent cells, pipette to mix thoroughly, then place on ice for 5 minutes, flash-freeze with liquid ammonia for 5 minutes, then in a 37°C water bath for 5 minutes, and finally on ice for 5 minutes. Add 500 µL of resistance-free LB liquid medium and incubate on a shaker at 200 rpm at 28°C for 1 hour. After incubation, centrifuge the culture at 6000 rpm for 1 minute, discard the supernatant, and evenly spread 100 µL of the supernatant on LB solid medium (containing 50 mg / L Kana). Seal with parafilm and incubate inverted in a 28°C incubator for 40-48 hours.

[0071] Bacteria inspection and backup: The target bands in the bacteria inspection are correct and the brightness is consistent ( Figure 4), pick the corresponding colony from the backup plate and place it into LB liquid medium (containing 50 mg / L Kana), shake the bacteria, and then preserve the bacteria with 50% glycerol at a volume ratio of 6:4. Quickly freeze the bacteria in liquid nitrogen and store them in a -80℃ ultra-low temperature freezer.

[0072] 9. Infecting Osmanthus fragrans petals and performing GC-MS determination of aroma substances

[0073] (1) Shake the culture: Take out the bacterial solution containing the pSuper1300 empty vector, the P19 auxiliary expression vector and the 35S::OfMYB187 target gene fusion expression vector (1300-OfMYB187) that has been transformed into Agrobacterium at -80℃ and thaw it at room temperature until it is mixed with ice and water. Then, insert it into ice to thaw. Add 300μL of bacterial solution into 30mL LB liquid medium (containing 50mg / L Kana) and shake and culture at 28℃ and 200rpm in the dark until the bacterial solution OD reaches 0. 600 = between 0.6-0.8.

[0074] (2) Prepare the mixed bacterial solution: weigh 0.0098 g of acetosyringone (AS) powder, dissolve it with dimethyl sulfoxide (DMSO) (operate in a fume hood), and then add an appropriate amount of sterile water to 50 mL to obtain a mother solution. Take 30 mL of the mother solution and add 170 mL of sterile water to obtain 150 μmol / L AS. Weigh 0.407 g of MgCl2 and 0.427 g of MES and add them to the prepared 150 μmol / L AS solution. Centrifuge the bacterial solution (4°C, 5000 rpm, 10 min), discard the supernatant, collect the bacteria, resuspend them in the buffer prepared on the same day, and finally mix them according to the optimal ratio (control group: P19 auxiliary vector: pSuper1300 empty vector = 5:7; experimental group: P19 auxiliary vector: 1300-OfMYB187 = 5:7). After thorough shaking and activation for 3 h, the cells are used as the infection solution.

[0075] (3) Vacuum infiltration infection of osmanthus fragrans: Select osmanthus fragrans flowers in their peak flowering period, wash them with pure water, dry them, wrap them with sterile gauze, and immerse them in the conical flasks containing the infection solution of the control group and the experimental group, respectively. Then, place the conical flasks open and place them in a glass jar connected to a vacuum pump. Turn on the vacuum pump to maintain the air pressure in the glass jar at −0.08 MPa. After maintaining this pressure for 10 minutes, slowly open the air vents to gradually restore the air pressure in the glass jar to normal (0 MPa). Then, seal the air vents and perform vacuum infiltration twice more. After the infiltration is completed, remove the gauze-wrapped osmanthus fragrans flowers, dry the attached bacterial solution, and place the flowers in 5% agar medium as soon as possible. Incubate them in the dark at room temperature (24°C) for 48 hours before use in subsequent experiments.

[0076] (4) Determination of aroma substances in transiently transformed osmanthus petals: After 48 h of dark incubation, use tweezers to pick up osmanthus flowers that are in normal condition and not wilting, shrinking or browning, and place them in a centrifuge tube for quick freezing in liquid nitrogen. Take 0.8 g of the ground powder and place it in a sealed 20 mL extraction bottle. Add 3 mL of saturated sodium chloride and an internal standard solution (1 / 6000 ethyl decanoate: 1 microliter of ethyl decanoate standard added to 6 mL of methanol); seal it in a water bath at 45 ° C, insert a 65 μm DB / 5MS extraction head into the middle of the extraction bottle, extract for 30 minutes, and then insert the extraction head into the chromatographic column TRACETR-5 MS. C30m×0.25mm×0.25gym), the carrier gas was high-purity helium (He), the helium flow rate was 1 mL / min, non-split injection, the injection port temperature was 250°C, and the desorption time was 3 min; the temperature program was as follows: first, the temperature was 60°C, maintained for 2 min, the first temperature ramp was from 60°C to 100°C at a rate of 5°C / min, and the second temperature ramp was from 100°C to 250°C at a rate of 10°C / min, and then maintained for 5 min; the mass spectrometry conditions were an ion source temperature of 250°C, ionization mode EI, and electron energy of 70 eV.

[0077] (5) Analysis of aroma substances in instantaneously transformed osmanthus petals: After removing silicon oxide impurities from the data, the relative contents of various substances were calculated. The relative contents of the substances were imported into SIMCA5.0 to calculate the substances with VIP>1 and statistical analysis was performed on the substances with differences p<0.05.

[0078] Test results such as Figure 5 As shown, compared with the control group, the transiently transformed Osmanthus fragrans petals overexpressed OfMYB187 by nearly nine times ( Figure 5 A and B in Osmanthus fragrans), resulting in a nearly tenfold decrease in the content of β-ionone in Osmanthus fragrans ( Figure 5 (C) indicates that OfMYB187 plays an important regulatory role in the synthesis of β-ionone.

[0079] Example 2: Acquisition of the Rixianggui OfCLpP protein gene

[0080] The protein OfCLpP that interacts with OfMYB187 protein was obtained through yeast two-hybrid screening library. The main experimental steps include: constructing the bait vector pGBKT7-OfMYB187 of Rixianggui OfMYB187 gene and transforming it into yeast AH109. The bacterial test results are as follows: Figure 6 As shown; the pGBKT7-OfMYB187 recombinant yeast was used to screen the yeast library; the screened protein OfCLpP was verified by yeast two-hybrid dot-to-dot, BiFc, LCA and CO-IP experiments. The details are as follows:

[0081] 1. Yeast library screening

[0082] (1) Pick a single bacterial strain from the SD-T plate and inoculate it into 10 mL of liquid SD-T culture medium. Incubate at 30°C, 200 rpm, and shake for 16-18 hours until the culture is concentrated.

[0083] (2) Take 2-3 mL from 10 mL of bacterial solution and add it to 50 mL of YPDA medium to make the initial OD 600 =0.2, 30℃, 200 rpm, shake culture for 4-6 h, and shake to OD600=0.6.

[0084] (3) Centrifuge at 3000 rpm for 5 min at room temperature to collect the bacteria and discard the supernatant.

[0085] (4) Resuspend the cells in 10 mL of sterile water, centrifuge at 3000 rpm for 5 min at room temperature, and discard the supernatant.

[0086] (5) Resuspend the cells in 10 mL of 0.1 M LiAc, mix well, and collect the cells by centrifugation. Centrifuge at 3000 rpm for 5 min at room temperature and discard the supernatant.

[0087] (6) Resuspend the cells in 500 μL of 0.1 M LiAc, mix well, and dispense into ten 1.5 mL centrifuge tubes, 50 μL per tube.

[0088] (7) Add the following reagents to each 1.5 mL centrifuge tube in sequence and mix thoroughly by pipetting or vigorous shaking for 1 minute. 300 μL of a mixture of 50% PEG3350 and 1 M LiAc, 10 μL of carrier DNA, and 1 μg of library plasmid DNA. Before each use, boil the carrier DNA at 95-100°C for 5 minutes and immediately place on ice for 3 minutes. Repeat this process three times to denature the DNA before use.

[0089] (8) After adding, seal the tube with sealing film and incubate in a 30℃ water bath for 45 min, gently mixing by inverting the tube every once in a while.

[0090] (9) Heat shock in a 42°C water bath for 20 min, gently mixing by inverting the tube every once in a while.

[0091] (10) After shaking, centrifuge at 4000 rpm for 5 min, discard the supernatant, resuspend the precipitate in 1 mL / tube of YPDA, and culture at 30°C with shaking for 90 min.

[0092] (11) Collect the bacteria by centrifugation at 4000 rpm for 5 min, discard the supernatant, resuspend in 400 μL of 0.9% NaCl solution, mix as gently as possible, and spread on SD-TLH.

[0093] (12) Inverted culture at 30°C for 3-7 days and observe the growth of colonies.

[0094] (13) After the bacteria have grown, pick out the single colony that has grown, add it to 50 μL ddH2O, and pipette to mix.

[0095] 1) Bacteria test: Seal the sterile water tube that has been inoculated with bacteria and place it in a -80°C freezer for lysis. The next day, take 5 μL of the tube as a template for bacteria test.

[0096] Primer: T7: CTATTCGATGATGAAGATACCCC;

[0097] ADR: GTGAACTTGCGGGGTTTTTCAG.

[0098] 2) Transfer to a plate: aspirate 4 μL of the culture medium onto SD / -THL, SD / -THLA, and SD / -THLA+x-α-gal culture media, respectively.

[0099] (14) Submission for testing: Select a single band with a length of more than 750 bp and 15 μL of the bacterial detection PCR stock solution grown on SD / -THLA plates for sequencing.

[0100] (15) Comparison of results: The sequenced fragments were blasted against the Osmanthus fragrans genome data. The nucleotide sequence of the OfCLpP gene was obtained as shown in SEQ ID NO. 3, with a total length of 819 bp. The amino acid sequence of its expressed protein was shown in SEQ ID NO. 4, consisting of 272 amino acids.

[0101] 2. Yeast two-hybrid dot-to-dot assay

[0102] Co-transform pGADT7-OfCLpP and pGBKT7-OfMYB187 into AH109 competent cells. Co-transform pGADT7 and pGBKT7-OfMYB187 served as the control group, co-transform pGADT7-T and pGBKT7-53 served as the positive control, and pGADT7-T and pGBKT7-lam served as the negative control. Plate the plates on SD-TL, SD-THL, SD-THLA, and SD-THLA+x-α-gal, respectively. Figure 7 A, It was found that only the positive control and experimental groups could grow on SD-THL, SD-THLA, and SD-THLA+x-α-gal plates, and turned blue on SD-THLA+x-α-gal plates.

[0103] 3. Bimolecular fluorescence complementation (BiFc)

[0104] YNE-OfCLpP and YCE-OfMYB187 were co-injected into Nicotiana benthamiana. The control groups were co-injected with YNE and YCE-OfMYB187, YNE-OfCLpP and YCE, and YNE and YCE. Figure 7 B, 48 hours after injection, tobacco leaves from the injection area were taken and GFP signals were observed using a laser confocal microscope. It was found that GFP signals could be observed in the cell nuclei only in the experimental group.

[0105] 4. Fluorescent complementation assay (LCA)

[0106] nluc-OfCLpP and cluc-OfMYB187 were co-injected into Nicotiana benthamiana, and the control groups were co-injected with nluc and cluc-OfMYB187, nluc-OfCLpP and cluc, and nluc and cluc. Figure 7 C, 48 hours after injection, the tobacco leaves in the injection area were sprayed with potassium salt substrate to observe the luciferase signal. It was found that the signal could be observed only in the experimental group.

[0107] 5. Co-IP

[0108] (1) Tobacco injection: Mix the bacterial solution of OfCLpP-FLAG:OfMYB187-HA:P19 in a ratio of 1:1:1 and inject. The control group was injected with a mixture of OfCLpP-FLAG:GFP-HA:P19 in a ratio of 1:1:1.

[0109] (2) Plant protein extraction: Approximately 0.5 g of infected leaves were taken, ground with liquid nitrogen, and then added to 500 µL LantCell lysis buffer (with protease inhibitors). Protein extraction was performed by rotating the homogenizer at 4°C for 1 h. After centrifugation, 50 µL of the supernatant was aspirated as input, and 5× protein loading buffer was added. The supernatant was denatured at 100°C for 10 min. The remaining supernatant was transferred to a new centrifuge tube and placed on ice for protein adsorption.

[0110] (3) Pretreatment of HA magnetic beads: Pipette 20 μL of magnetic beads and wash the beads three times with washing solution to activate them.

[0111] (4) Protein adsorption: Mix the plant protein extract and magnetic beads, and use a rotary mixer at 4 °C to adsorb the protein for 2 h.

[0112] (5) Magnetic bead washing: Use a magnetic stand to adsorb the magnetic beads. A portion of the protein extract after adsorption can be retained. Wash the magnetic beads with washing solution. Add washing solution to the centrifuge tube, invert the centrifuge tube to resuspend the magnetic beads, and place it on the magnetic stand. After the magnetic beads are precipitated, discard the supernatant. Repeat this operation 3 times.

[0113] (6) Elution of target protein: denature and elute the target protein by adding 1× protein loading buffer and denaturing at 100°C for 10 min. The sample is then subjected to SDS-PAGE detection.

[0114] like Figure 7 D, In the input sample, the fusion proteins OfCLpP-FLAG, OfMYB187-HA, and GFP-HA were detected, indicating that all three proteins were successfully expressed in tobacco. In the IP sample, the HA antibody detected a band of the OfMYB187-HA fusion protein, indicating that OfMYB187 interacts with OfCLpP in plant cells.

[0115] Example 3: WB experiment to investigate the hydrolysis effect of OfCLpP protein on OfMYB187 protein

[0116] 1. Injection into tobacco: Mix the bacterial solution with FLAG-OfCLpP:1300-OfMYB187:P19 in a ratio of 1:1:1 and inject. Use a control group with a mixture of FLAG-GUS:1300-OfMYB187:P19 in a ratio of 1:1:1.

[0117] 2. Take 3-6 leaves 48 hours after injection and observe the GFP signal using a Tanon 4600 series automatic chemiluminescence imaging instrument, such as Figure 8 As shown in A, the left side is the control group and the right side is the experimental group. The signal on the right side is significantly weaker than that on the left side.

[0118] 3. Extract total protein from the remaining leaves and perform WB experiment:

[0119] (1) Plant protein extraction: Approximately 0.1 g of infected leaves (three biological replicates) were taken, ground with liquid nitrogen, and added to 500 µL Lant Cell Lysis Buffer (with protease inhibitors). Protein extraction was performed by rotating the homogenizer at 4°C for 1 h. After centrifugation, 50 µL of the supernatant was aspirated and added to 5× protein loading buffer. The supernatant was denatured at 100°C for 10 min.

[0120] (2) Electrophoresis: After centrifugation, take 10µL of supernatant for vertical electrophoresis.

[0121] (3) Transfer: Cut the PVDF membrane into 4.5x8.5 cm and soak it in methanol for 3-5 min before use; transfer the gel and PVDF membrane to the electrophoresis tank, add transfer solution and ice pack, and incubate at 80 V for 90 min.

[0122] (4) Blocking: Place the membrane after transfer in 5% skim milk and block it at 37°C with a shaker at 60 rpm / min for 2 hours.

[0123] (5) Primary antibody: Pour away the skim milk, add the prepared antibody, and block overnight at 4°C with a shaker at 60 rpm / min.

[0124] (6) Wash the membrane: Wash the membrane with 1xTBST at 60 rpm / min, changing TBST every 10 minutes, and wash three times in total.

[0125] (7) Secondary antibody: Pour out the skim milk, add the prepared antibody, and shake at 37°C and 60 rpm / min for 1 hour.

[0126] (8) Wash the membrane: Wash the membrane with 1xTBST at 60 rpm / min, changing TBST every 15 minutes, for a total of 4 washes.

[0127] (9) Development: Add developer according to the instructions of the kit for development.

[0128] like Figure 8 As shown in Figure B, when detected with a GFP antibody, the intensity of the bands in the control and experimental groups was consistent, while when detected with a FLAG antibody, the bands in the control group were stronger than those in the experimental group. This indicates that OfCLpP protein hydrolyzes OfMYB187.

[0129] Example 4: Dual luciferase assay to investigate the effect of the interaction between OfMYB187 and OfCLpP proteins on the β-ionone synthase gene OfCCD4

[0130] 1. Infection of Nicotiana benthamiana

[0131] (1) Tobacco preparation: Prepare healthy and strong Nicotiana benthamiana seedlings that are about 6 weeks old and control watering in advance;

[0132] (2) Shaking the bacteria: construct the CDs of OfMYB187 and OfCLpP genes into the pGreenII 62-SK vector, and construct the promoter of OfCCD4 gene (OfCCD4 pro) into the pGreenII 0800-LUC vector; then transform the pGreenII 62-SK vector and the constructed vectors into GV3101 (psoup) Agrobacterium competent cells to obtain recombinant Agrobacterium pGreenII 62-SK, SK-OfMYB187, SK-OfCLpP and 0800-OfCCD4, as shown in the following figure: Figure 9 As shown in A;

[0133] Agrobacterium strains pGreenII 62-SK, SK-OfMYB187, SK-OfCLpP, and 0800-OfCCD4 were cultured in 50 mL of LB liquid medium containing 100 mg / L Kana at 28°C and 200 rpm in the dark overnight.

[0134] (3) Prepare infection buffer: prepare a final concentration of 150 μmol·L -1 Acetosyringone (AS), 10mmol·L -1 MgCl2, 10mmol·L -1 Morpholineethanesulfonic acid (MES) infection buffer (prepared immediately for use);

[0135] (4) Centrifugation and resuspension: When the bacterial solution OD 600 =0.8, centrifuge (4°C, 6000 rpm, 10 min), discard the supernatant, collect the bacteria, and resuspend them in the infection buffer prepared on the same day, and add ①pGreenII 62-SK, ②SK-OfMYB187, and ③SK-OfCLpP, 0800-OfCCD4, follow ①:②: =4.5:4.5:1 (denoted as SK-MYB187), ①:③: =4.5:4.5:1 (denoted as SK-CLPP), ②:③: =4.5:4.5:1 (denoted as SK-MYB187+SK-CLPP) and ①: =9:1 (denoted as SK) volume ratio, shake thoroughly and activate in the dark for 3 hours before injection;

[0136] (5) Infection: Use a 1 mL syringe without a needle to draw up the prepared bacterial mixture and inject it from the back of the Nicotiana benthamiana leaf;

[0137] (6) Cultivation: After the injection is completed, water it thoroughly, place it in a growth chamber for dark cultivation for 12 hours, and then cultivate it normally for 48 days.

[0138] 2. Determination of fluorescein and rennin

[0139] (1) Take 3-4 leaf discs with a diameter of 6-8 mm, place them in a 2 mL grinding tube (put 2-3 steel balls in advance), freeze them in liquid nitrogen, and grind them using a grinder (45 Hz, 60 s). After complete grinding, add 200 μL of lysis buffer to the grinding tube;

[0140] (2) Incubate on ice for about 5 minutes to fully lyse the leaves;

[0141] (3) Centrifuge at 12000 rpm for 2 min and take the supernatant for later use;

[0142] (4) Take 50 μL of the supernatant from the previous step and add it to the culture plate. Set up 3-5 replicate wells according to experimental needs;

[0143] (5) Prepare the firefly luciferase reaction solution and the Renilla luciferase reaction solution. Dilute the firefly luciferase substrate (50x) and the Renilla luciferase substrate (50x) to 1x working solution with the corresponding buffer. Incubate the mixture to room temperature.

[0144] (6) Add 100 μL of firefly luciferase reaction solution, shake the plate to mix, and detect the activity of firefly luciferase;

[0145] (7) Add 100 μL of Renilla luciferase reaction solution, shake the plate to mix, and detect the activity of Renilla luciferase;

[0146] (8) Analytical data: LUC / REN = Firefly luciferase activity / Renilla luciferase activity.

[0147] The results are as follows Figure 9 As shown in Figures B and C, the LUC / REN ratio decreased 1.5-fold when SK-OfMYB187 was injected compared to the control group. However, the LUC / REN ratio remained unchanged when SK-OfCLPP was injected or when both SK-OfMYB187 and SK-OfCLPP were co-injected. This suggests that OfMYB187 inhibits OfCCD4, whereas OfCLpP has no effect on OfCCD4 itself. However, because OfCLpP can hydrolyze OfMYB187, the inhibitory effect of OfMYB187 on OfCCD4 is alleviated.

Claims

1. A transcription factor OfMYB187 that regulates the synthesis of β-ionone, a component of osmanthus fragrance, whose amino acid sequence is shown in SEQ ID NO.

2.

2. A gene encoding the transcription factor OfMYB187 according to claim 1, the nucleotide sequence of which is shown in SEQ ID NO.

1.

3. An expression cassette, recombinant vector, recombinant bacteria or recombinant cell containing the gene encoding the transcription factor OfMYB187 according to claim 2.

4. A protein OfCLpP that interacts with the transcription factor OfMYB187 according to claim 1, wherein the amino acid sequence thereof is shown in SEQ ID NO.

4.

5. A gene encoding the protein OfCLpP according to claim 4, the nucleotide sequence of which is shown in SEQ ID NO.

3.

6. An expression cassette, recombinant vector, recombinant bacteria or recombinant cell containing the gene encoding the protein OfCLpP according to claim 5.

7. Use of the gene encoding the transcription factor OfMYB187 according to claim 1 in regulating the synthesis of β-ionone, a component of osmanthus fragrance, characterized in that: The application is any one of the following A1) or A2): A1) constructing an overexpression vector encoding the gene for the osmanthus fragrans transcription factor OfMYB187, transforming the vector into osmanthus fragrans plants or tissues, and cultivating and screening transgenic plants or flower tissues with reduced β-ionone content in their floral fragrance; A2) constructing a silencing vector encoding the gene for the osmanthus transcription factor OfMYB187, transforming the vector into plants or osmanthus flower tissues, and cultivating and screening transgenic plants or flower tissues with increased β-ionone content in the osmanthus flower aroma.

8. The use according to claim 7, characterized in that The overexpression vector in item A1) is 1300-OfMYB187.

9. A method for regulating the synthesis of β-ionone, a component of sweet osmanthus fragrance, characterized in that: The method is specifically any one of the following B1) or B2): B1) constructing an overexpression vector encoding the gene for the protein OfCLpP according to claim 4, and transforming the vector into osmanthus plants or osmanthus tissues to enhance the hydrolysis of the transcription factor OfMYB187 according to claim 1 in osmanthus, thereby increasing the content of β-ionone in the osmanthus aroma; B2) constructing a silencing vector encoding the gene of the protein OfCLpP according to claim 4, and transforming it into osmanthus plants or osmanthus tissues, thereby reducing the hydrolysis of the transcription factor OfMYB187 according to claim 1 in osmanthus and lowering the content of β-ionone in the osmanthus fragrance.

10. The use according to claim 9, characterized in that The transformation described in B1) or B2) is mediated by Agrobacterium.

Images