Yarrowia lipolytica genetically engineered bacterium for increasing yield of cocoa butter and construction method

Abstract

The invention discloses a yarrowia lipolytica genetically engineered bacterium capable of increasing the yield of cocoa butter and a construction method of the yarrowia lipolytica genetically engineered bacterium. The construction method comprises the following steps: transferring stearoyl-coenzyme A desaturase gene TcSAD1 from theobroma cacao into a chromosome of the yarrowia lipolytica genetically engineered bacterium po1g capable of producing grease; and the Yarrowia lipolytica genetically engineered bacterium of which the yield of cocoa butter is improved is obtained by knocking out an endogenous oleyl coA desaturase gene of the Yarrowia lipolytica. The method also includes reducing the synthesis of linoleic acid in order to appropriately adjust the proportion of oleic acid. The yield of cocoa butter of the Yarrowia lipolytica genetically engineered bacterium for producing cocoa butter is obviously improved compared with that of the original strain.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a genetically engineered Yarrowia lipolytica bacterium for increasing cocoa butter production and a construction method thereof. Background Art

[0002] Cocoa butter, a key ingredient in chocolate manufacturing, primarily derived from cocoa beans, possesses unique aroma and melting point properties, making it a key determinant of chocolate product quality. However, traditional cocoa butter extraction methods are limited by natural resources, resulting in high production costs. Furthermore, due to the influence of natural factors such as climate, pests and diseases, the supply is unstable and cannot meet the growing market demand. Therefore, the development of alternative cocoa butter production methods has important economic and social value.

[0003] The production of cocoa butter substitutes by microbial fermentation has become a research hotspot. Among them, Yarrowia lipolytica is widely used in the field of oil production due to its high oil accumulation capacity and safety. Studies have shown that Yarrowia lipolytica can produce large amounts of oil by utilizing carbon sources such as glucose, and its fatty acid composition can be regulated through genetic engineering. However, the oil production of existing Yarrowia lipolytica strains is limited, and the fatty acid composition is significantly different from that of natural cocoa butter, especially the ratio of stearic acid, oleic acid and linoleic acid is difficult to meet the standard requirements of cocoa butter.

[0004] Currently, research on the production of cocoa butter substitutes using microbial fermentation is increasing both domestically and internationally, but an ideal industrial production solution remains elusive. Existing genetic engineering strategies primarily focus on the fatty acid synthesis pathway, but the modification and regulation of key enzymes have yet to achieve optimal results. In particular, research on genetically engineering Yarrowia lipolytica with key plant-derived enzymes is relatively limited, lacking systematic research and industrial application cases. Therefore, developing new genetically engineered strains to improve cocoa butter yield and quality is crucial for meeting market demand and reducing production costs. Summary of the Invention

[0005] The present invention aims to provide an engineered strain of Yarrowia lipolytica for producing cocoa butter, so as to address the practical situation that microbial production of cocoa butter is generally low. The present invention is committed to providing a method for increasing the cocoa butter yield in Yarrowia lipolytica strains, so as to address the deficiencies in the prior art.

[0006] To achieve the above objectives, the first aspect of the present invention provides a method for constructing a genetically engineered Yarrowia lipolytica strain that increases cocoa butter production. The method comprises transferring the stearoyl-CoA desaturase gene TcSAD1 from the Theobroma cacao tree into the chromosome of the oil-producing genetically engineered Yarrowia lipolytica strain po1g, thereby obtaining a genetically engineered Yarrowia lipolytica strain with increased cocoa butter production.

[0007] The NCBI accession number of the stearoyl-CoA desaturase gene TcSAD1 sequence from Theobroma cacao is GB: EOY04657.1.

[0008] According to a preferred embodiment of the present invention, the method further comprises integrating TcSAD1 into the stearoyl-CoA desaturase Y1D9 site of Yarrowia lipolytica by homologous recombination, thereby simultaneously knocking out the endogenous stearoyl-CoA desaturase Y1D9 of Yarrowia lipolytica, wherein the NCBI accession number of the sequence of the endogenous stearoyl-CoA desaturase gene Y1D9 of Yarrowia lipolytica (oleyl coA desaturase gene endogenous to Yarrowia lipolytica, abbreviated as YID9 or OLE1) is GB: XP_501496.1.

[0009] In a second aspect, the present invention provides a genetically engineered Yarrowia lipolytica strain for increasing cocoa butter production, comprising the stearoyl-CoA desaturase gene TcSAD1 derived from the cocoa tree.

[0010] Preferably, any of the above items is that the genetically engineered Yarrowia lipolytica strain for increasing cocoa butter production lacks the endogenous stearoyl-CoA desaturase Y1D9 gene of Yarrowia lipolytica.

[0011] Preferably, any of the above items is that in the genetically engineered Yarrowia lipolytica strain for increasing cocoa butter production, the TcSAD1 gene is integrated into the knocked-out stearoyl-CoA desaturase Y1D9 site of Yarrowia lipolytica.

[0012] Preferably, in any of the above items, the NCBI accession number of the stearoyl-CoA desaturase gene TcSAD1 sequence derived from Theobroma cacao is GenBank: EOY04657.1.

[0013] Preferably, in any of the above items, the NCBI accession number of the sequence of the endogenous stearoyl-CoA desaturase gene Y1D9 of Yarrowia lipolytica is GenBank: XP_501496.1.

[0014] Preferably, any of the above items is that the codon-optimized nucleotide sequence of TcSAD1 is as shown in SEQ ID NO.1.

[0015] Preferably, any of the above items is that the Yarrowia lipolytica is the oil-producing genetically engineered Yarrowia lipolytica strain po1g.

[0016] The third aspect of the present invention provides the use of any of the above-mentioned genetically engineered Yarrowia lipolytica bacteria for increasing cocoa butter yield in producing cocoa butter.

[0017] The fourth aspect of the present invention provides a method for producing cocoa butter using any of the above methods, using the genetically engineered Yarrowia lipolytica bacteria that improves cocoa butter production.

[0018] Preferably, any of the above items is that the genetically engineered Yarrowia lipolytica bacteria for increasing cocoa butter yield as described in any of the above items is fermented and cultured in a fermentation medium.

[0019] Any of the above is preferably that the fermentation medium is a fermentation medium containing CSM medium, comprising the following components in the following proportions: 50 g / L glucose, 1.7 g / L YNB (excluding amino acids and ammonium sulfate), 1.1 g / L ammonium sulfate, and 1.29 g / L CSM medium.

[0020] In a preferred embodiment of the present invention,

[0021] First, the genetically engineered Yarrowia lipolytica bacteria that improves cocoa butter production are cultured in a seed culture medium preferably CSM medium, preferably at a culture temperature of 30° C., and preferably for 24 hours.

[0022] Fermentation is then performed. The seed liquid is inoculated into a fermentation medium in a proportion for fermentation. Preferably, the seed liquid is inoculated into the fermentation medium at an inoculum rate of 5% (v / v); preferably, the fermentation medium is a CSM medium, the fermentation temperature is preferably 30°C, and preferably, the culture is performed in a shaker at 180 rpm for 3 days.

[0023] The present invention has the following beneficial effects:

[0024] The cocoa butter yield of the Yarrowia lipolytica genetically engineered bacteria with increased cocoa butter yield constructed by the method of the present invention is significantly increased compared with the starting strain, and the total oil yield at the shake flask level can reach 1.34 g / L.

[0025] The growth rate of the genetically engineered Yarrowia lipolytica bacteria for improving cocoa butter production is improved compared to the wild-type strain, and the total oil concentration is increased to 1.34 g / L. At the same time, the stearic acid content is increased to 13.2%, and the linoleic acid content is reduced to 16.8%. The proportions of POP, POS and SOS in triglycerides in cells of the genetically engineered Yarrowia lipolytica bacteria for improving cocoa butter production are increased to 7.4%, 14% and 3.3%, respectively.

[0026] POP (1,3-dipalmitoyl-2-oleoylglycerol) is a key component of cocoa butter, giving it unique physical properties such as a suitable melting point and a smooth texture. The presence of POP helps cocoa butter remain solid at room temperature while melting quickly at body temperature, resulting in a smooth, creamy mouthfeel.

[0027] POS (1-palmitoyl-2-oleoyl-3-stearylglycerol) is also a key component of cocoa butter. It works together with POP to influence the crystallization behavior and physical properties of cocoa butter. The presence of POS helps cocoa butter form a stable crystal structure, which in turn affects the texture and gloss of chocolate.

[0028] SOS (1,3-distearate-2-oleyl triglyceride) is also a component of cocoa butter. Its high melting point helps increase the firmness of cocoa butter, and its balance with other triglycerides improves the taste of cocoa butter.

[0029] It can be seen that the genetically engineered Yarrowia lipolytica bacteria for increasing cocoa butter yield obtained in the present invention can improve the yield and quality of cocoa butter and is suitable for cocoa butter production. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the plasmid pYLXP'-TcSAD1.

[0031] Figure 2 Schematic diagram of the plasmid pUrlp-OLE1::TcSAD1.

[0032] Figure 3 The growth curves of strains po1g-wt and OLE1::TcSAD1 are shown.

[0033] Figure 4 Figure 2 is a graph of total fatty acid concentrations in the fermentation broths of strains po1g-wt and OLE1::TcSAD1.

[0034] Figure 5 A comparison of the fatty acid composition of strains po1g-wt and OLE1::TcSAD1.

[0035] Figure 6Comparison of triglyceride composition between strains po1g-wt and OLE1::TcSAD1. DETAILED DESCRIPTION

[0036] The present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.

[0037] The following will clearly and completely describe the technical solutions of the present invention with specific embodiments in conjunction with examples. It should be understood that the described embodiments are only some embodiments of the present invention, rather than all embodiments. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of the present invention.

[0038] In this specific embodiment, the PCR amplification system is as follows: total volume 50 μL; DNA template, 1 μL; upstream primer (10 μM) and downstream primer (10 μM) 2 μL each; 2×Phanta Flash Master Mix, 25 μL; finally, double-distilled water is used to make up 50 μL.

[0039] In this specific embodiment, the PCR amplification procedure is as follows: amplification conditions are: pre-denaturation at 95°C for 3 min (1 cycle); denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, and extension at 72°C for 60 sec / kb (30 cycles); and extension at 72°C for 5 min (1 cycle).

[0040] The chassis cells used in this embodiment are the Yarrowia lipolytica po1g strain, which is from the Synthetic Biology and Intelligent Control Laboratory of Guangdong Technion-Israel Institute of Technology.

[0041] Expression vector construction plasmids: pYLXP' and pUrlp, were obtained from the Laboratory of Synthetic Biology and Intelligent Control, Guangdong Technion-Israel Institute of Technology.

[0042] in:

[0043] The Yarrowia lipolytica Po1g strain is commercially available to the public, such as the one provided by Zhejiang Benniaobang Biotechnology Co., Ltd. (product number: BIO-YL-Po1g). The Yarrowia lipolytica Po1g strain is documented in prior art literature and is also available to the public through shared resources.

[0044] The pYLXP' plasmid is a genetically engineered expression vector designed specifically for Yarrowia lipolytica. It is a commercial vector that is available to the public through purchase, such as the YaliBrick plasmid (pYLXP' vector series) from Zhejiang Benniaobang Biotechnology. The pYLXP' plasmid contains a leucine Leu2 tag for screening in Yarrowia lipolytica, as well as the strong promoter TEF and terminator XPR2 that function in Yarrowia lipolytica. Figure 1 The pYLXP'-TcSAD1 recombinant plasmid is shown. Those skilled in the art can determine the structure of the pYLXP' plasmid and obtain it through conventional plasmid construction methods. The pYLXP' plasmid is described in prior art literature and is also available to the public through shared resources.

[0045] The pUrlp plasmid contains a leucine Leu2 tag for selection in Yarrowia lipolytica, as well as a strong promoter TEF and terminator XPR2 that function in Yarrowia lipolytica. Figure 2 The pUrlp-OLE1::TcSAD1 plasmid is shown. Those skilled in the art can determine the structure of the pUrlp plasmid and obtain it through conventional plasmid construction methods. The pUrlp plasmid is described in prior art literature and is also publicly available through shared resources, such as the article "Yarrowia lipolytica engineered strain for producing cocoa butter-like yeast, construction methods, and applications" (https: / / www.patentguru.com / cn / CN119162009A).

[0046] The concept of the present invention is not limited to the source or acquisition method of the plate cells and plasmids. All plate strains and plasmids that can implement the technical solution of the present invention are applicable to the present invention.

[0047] Example 1: Construction of expression vector pYLXP'-TcSAD1

[0048] Step 1: Using gene synthesis technology to obtain TcSAD1 (such as the nucleotide sequence of SEQ ID NO. 1) after codon optimization for Yarrowia lipolytica;

[0049] Using the codon-optimized TcSAD1 as a template, primers TcSAD1-f and TcSAD1-r were used to amplify the fragment TcSAD1-hom required for homologous recombination;

[0050] The primer sequences used for amplification in step 1 are shown in Table 1 below:

[0051] Table 1: Primers used in this step

[0052] Primer name Sequence 5'-3' serial number TcSAD1-f accagcactttttgcagtactaaccgcagatggctttgaagctcaacccca SEQ ID NO.2 TcSAD1-r acaggccatggaactagtcgttagagcttcacctctcggtcgaag SEQ ID NO.3

[0053] Step 2: Obtain the pYLXP' vector. This circular plasmid contains a leucine (Leu2) tag for selection in Yarrowia lipolytica. It also contains the strong Yarrowia lipolytica promoter (TEF) and terminator (XPR2). Double-digest the pYLXP' vector with SnaBI and KpnI to obtain a linearized vector.

[0054] The double enzyme digestion reaction system is shown in Table 2. The reaction conditions are 37°C and the reaction time is 3 h.

[0055] Table 2: Plasmid double enzyme digestion reaction system

[0056] Reagents Usage amount (μL) pYLXP' vector 10 (about 3 μg) 10× buffer 5 SnaBI 3 KpN 3 Double distilled water 29

[0057] After the enzyme digestion reaction is completed, the linearized pYLXP' vector fragment is separated by agarose gel electrophoresis, and the target fragment is recovered from the linearized pYLXP' vector fragment using a DNA gel recovery kit to obtain the purified plasmid linearized vector fragment.

[0058] Step 3: The fragment TcSAD1-hom in step 1 was fused with the linearized pYLXP' vector fragment in step 2 by seamless cloning technology (Gibson assembly) to construct the pYLXP'-TcSAD1 recombinant plasmid (e.g. Figure 1 shown).

[0059] Example 2: Construction of integration vector pUrlp-OLE1::TcSAD1

[0060] Step 1): Using the Yarrowia lipolytica po1g genome as a template, primers up1000-hom-f and up1000-hom-r were used to amplify the upstream homology arm up1000-hom; using the Yarrowia lipolytica po1g genome as a template, primers dw1000-hom-f and dw1000-hom-r were used to amplify the downstream homology arm dw1000-hom; using pYLXP'-TcSAD1 as a template, primers TcSAD1-hom-f and TcSAD1-hom-r were used to amplify TcSAD1 (TEFin); the amplified fragments were separated by agarose gel electrophoresis, and the target fragment was recovered using a DNA gel recovery kit to obtain a purified fragment. The primers used in this step are shown in Table 3.

[0061] Table 3:

[0062]

[0063]

[0064] Step 2): Obtain the pUrlp vector. This circular plasmid contains a leucine (Leu2) tag for selection in Yarrowia lipolytica. It also contains the strong promoter TEF and terminator XPR2, both of which function in Yarrowia lipolytica. Double-digest the pUrlp vector with AvrII and SalI to obtain the loxp-leu2-loxp and pUrlp-AvrII / SalI linearized vectors, respectively.

[0065] The double enzyme digestion reaction system is shown in Table 4. The reaction conditions were 37°C and the reaction time was 3 h.

[0066] Table 4: Plasmid double enzyme digestion reaction system

[0067] Reagents Usage amount (μL) pUrlp vector 10, (about 3 μg) 10× buffer 5 AvrII 3 SalI 3 Double distilled water 29

[0068] Step 3): The fragments in step 1) and step 2) were fused by seamless cloning technology (Gibson assembly) to construct a pUrlp-OLE1::TcSAD1 recombinant plasmid (such as Figure 2 shown).

[0069] The seamless cloning reaction system is shown in Table 5. The reaction conditions were 50°C and the reaction time was 0.5 h.

[0070] Table 5: Seamless cloning reaction system

[0071] Reagents Usage amount (μL) pUrlp-AvrII / SalI 1 up1000-hom 1 loxP-Leu2-loxP 1 TcSAD1(TEFin) 1 dw1000-hom 1 Seamless cloning enzyme 5

[0072] Example 3: Construction of recombinant strain po1g-OLE1::TcSAD1

[0073] Step 1): Use primers up-6.4kf and dw-6.4kr to amplify the linearized fragment OLE1::TcSAD1 required for site-directed integration and replacement of OLE1. The primers used in this step are shown in Table 6.

[0074] Table 6:

[0075]

[0076]

[0077] Step 2): Transformation of Yarrowia lipolytica po1g. Pick a single 2-3 mm colony from the plate and culture overnight in a YPD liquid test tube for approximately 14-16 hours. Inoculate into 25 ml of YPD medium (250 mL shake flask) to an initial OD600 of 0.5 and culture with shaking for approximately 3 hours. Then, add 2.5 mL of hydroxyurea (final concentration 50 mM, stock solution 500 mM, aliquot and store long-term in a -80°C freezer) and continue culturing for 2 hours. Collect 3 mL of the bacterial solution in a 2 mL round-bottom EP tube, centrifuge (5000 rpm, 2.5 min), and wash twice with an equal volume of sterile water. Transform using the lithium acetate PEG4000 method, as shown in Table 7, resuspend in the transformation solution, and culture at 39°C for one hour, shaking for 15 seconds every 15 minutes. Finally, spread the solution onto CSM-Leu selective plates to screen for positive transformants.

[0078] Table 7: Yeast transformation system

[0079] Reagents Dosage 50% PEG4000 80 μL 2M lithium acetate 5μL 2M DTT 5μL ssDNA 5μL OLE1::TcSAD1 500ng

[0080] An engineered yeast strain for synthesizing cocoa butter containing the exogenous gene TcSAD1 was obtained.

[0081] Example 4: Fermentation to produce cocoa butter using the engineered Yarrowia lipolytica strain po1g-OLE1::TcSAD1 constructed in Example 3. The following steps were followed to produce cocoa butter:

[0082] 1) Seed liquid culture: The activated colonies were inoculated into CSM medium and cultured at 30°C for 24 hours.

[0083] 2) Fermentation culture: The seed liquid was inoculated into a fermentation medium (as shown in Table 8, C / N=100) at an inoculum rate of 5% (v / v), and cultured in a shaking incubator at 30° C. and 180 rpm for 3 days.

[0084] Table 8: Fermentation medium

[0085] Reagents Concentration (g / L) glucose 50 YNB, without amino acids and ammonium sulfate 1.7 ammonium sulfate 1.1 CSM medium 1.29

[0086] Among them, CSM was purchased from Beijing Coolaibo Technology Co., Ltd., item number PM2200-20g; YNB was purchased from Sangon Biotech (Shanghai) Co., Ltd., item number A600505-0100.

[0087] Comparative Example 5

[0088] Unlike Example 4, a wild-type Yarrowia lipolytica strain (Yarrowia lipolytica chassis strain po1g) was used to produce yeast cocoa butter.

[0089] Experiment 1: Quantitative analysis of fatty acids:

[0090] The 3-day fermentation broths of Example 4 and Comparative Example 5 were respectively taken and tested according to the following steps:

[0091] 4OD of cells (e.g. 200μL of culture medium at 20OD) will be transferred to a 1.5mL centrifuge tube and washed twice with double-distilled water.

[0092] Fatty acid transesterification and determination process: Add 500 μL of 0.5N methanol-sodium hydroxide solution and 100 μL of 2g / L tridecanoic acid dissolved in n-hexane as an internal standard to the bacteria, and shake at 1200 rpm for 2 hours. Then 40 μL of 98% concentrated sulfuric acid and 400 μL of n-hexane are added to the sample in sequence and shaken at 1200 rpm for 15 minutes. Finally, centrifuge the sample and take the upper n-hexane layer to GC-FID using HP-INNOWAX (30m×0.25mm) capillary column for quantification. The specific results are as follows Figure 3 、 Figure 4 and Figure 5 As shown, po1g-WT is comparative example 5, and OLE1::TcSAD1 is example 4.

[0093] Depend on Figure 3 、 Figure 4 and Figure 5 It can be seen that compared with Comparative Example 5, the growth rate of the OLE1::TcSAD1 strain was improved, the total oil concentration increased from 0.88g / L to 1.34g / L, and stearic acid ( Figure 5 C18:0) content also increased from 11.4% to 13.2%, and linoleic acid ( Figure 5 C18:2) content decreased from 20.3% to 16.8%.

[0094] Depend on Figure 6 It can be seen that the proportions of POP, POS and SOS in Yarrowia lipolytica cells (po1g-wt) were 4.8%, 8.7% and 1.9%, respectively; after site-specific integration of D9 desaturase (TcSAD1) from theobroma cacao tree into po1g, the proportions of POP, POS and SOS in triglycerides of po1g-TcSAD1 cells increased to 7.4%, 14% and 3.3%, respectively.

[0095] The above embodiments are provided for illustrative purposes only and are not intended to limit the scope of implementation. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to provide an exhaustive list of all implementations. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A genetically engineered strain of Yarrowia lipolytica for increasing cocoa butter production, characterized in that: Contains the stearoyl-CoA desaturase gene TcSAD1 from the cocoa tree.

2. The Yarrowia lipolytica genetically engineered bacterium for increasing cocoa butter production according to claim 1, wherein The genetically engineered Yarrowia lipolytica strain lacks the endogenous stearoyl-CoA desaturase YlD9 gene of Yarrowia lipolytica.

3. The Yarrowia lipolytica genetically engineered bacterium for increasing cocoa butter production according to claim 2, wherein: In the genetically engineered Yarrowia lipolytica, the TcSAD1 gene was integrated into the knocked-out stearoyl-CoA desaturase Y1D9 site of Yarrowia lipolytica.

4. The Yarrowia lipolytica genetically engineered bacterium for increasing cocoa butter production according to claim 2 or 3, wherein: The NCBI accession number of the stearoyl-CoA desaturase gene TcSAD1 sequence derived from the cocoa tree is GenBank: EOY04657.

1.

5. The genetically engineered Yarrowia lipolytica for increasing cocoa butter production according to claim 2 or 3, wherein: The NCBI accession number of the sequence of the endogenous stearoyl-CoA desaturase gene Y1D9 of Yarrowia lipolytica is GenBank: XP_501496.

1.

6. The genetically engineered Yarrowia lipolytica for increasing cocoa butter production according to claim 2 or 3, wherein: The codon-optimized nucleotide sequence of TcSAD1 is shown in SEQ ID NO.

1.

7. The method for constructing a genetically engineered Yarrowia lipolytica strain for increasing cocoa butter production according to any one of claims 1 to 6, characterized in that: The stearoyl-CoA desaturase gene TcSAD1 from the cocoa tree was transferred into the chromosome of the genetically engineered yeast Yarrowia lipolytica.

8. The construction method according to claim 7, wherein: The genetically engineered Yarrowia lipolytica bacterium is a Y1D9-deficient oil-producing genetically engineered Yarrowia lipolytica bacterium po1g.

9. Use of the genetically engineered Yarrowia lipolytica for increasing cocoa butter yield according to any one of claims 1 to 6 in producing cocoa butter.

Images