Composition for preparing brain organ, brain organ and application of brain organ

Abstract

The invention relates to the technical field of biology, in particular to a composition for preparing a brain organ, the brain organ and application of the brain organ. The invention further discloses a construction method of the brain organ, and on the basis of the method, different stem cells such as ESCs and iPSCs can be utilized to stably construct the three-dimensional brain organ model capable of simulating the medulla oblongata trigeminal nerve. The invention further discloses an organoid assembly which has important application potential in the fields of research on development, functions and related diseases of brain nuclei, drug discovery and the like.

Description

Technical Field

[0001] The patent of this invention belongs to the field of biotechnology, and specifically relates to a composition for preparing brain organoids, brain organoids and their applications. Background Art

[0002] In recent years, brain organoid technology has developed rapidly and has been widely used. Although a variety of brain region-specific organoids can be established based on directed differentiation technology, the construction of organoids for specific sub-brain regions, including brain nuclei, still faces great challenges. Among the currently reported schemes, only brain organoid models for the hypothalamic or thalamic nuclei have been reported. However, due to the existence of many functional nuclei in the brain, the current brain organ differentiation schemes with specific nucleus characteristics are still limited, and there is no method to use nucleus-specific organoids to simulate brain nucleus-related neural circuit connections in vitro. Constructing three-dimensional brain organoids for brain nuclei will help researchers to more conveniently and accurately study the working principles, disease mechanisms, and repair mechanisms of the brain in vitro.

[0003] The spinal trigeminal nucleus (SpV) is one of the largest cranial nerve nuclei, spanning the entire brainstem, and is a crucial component of the trigeminal nucleus. The spinal trigeminal nucleus is further divided into three subnuclei: the oral subnucleus (Vo), the interpolar subnucleus (Vi), and the caudal subnucleus (Vc). Vo and Vi are associated with touch, while Vc, located in the hindbrain medulla oblongata, is a key nucleus that transmits pain and temperature sensations from the head to other brain structures, such as the thalamus, and is crucial for maintaining normal physiological function. Developmentally, Vc originates in the dorsal medulla oblongata. Despite its crucial role in sensory processing and regulation, neuropathology, and pathological responses triggered by pathogen infection, no model for the spinal trigeminal nucleus exists.

[0004] Therefore, there is an urgent need to establish brain organoids targeting the spinal trigeminal nerve. Summary of the Invention

[0005] In view of this, facing the deficiencies of the existing technology, the purpose of this application is to provide a composition for preparing brain organoids, brain organoids and their applications.

[0006] To achieve the above objectives, the present invention specifically adopts the following technical solutions.

[0007] The first aspect of the present invention provides a composition for preparing brain organoids, comprising any one or more of the following culture media:

[0008] Induction medium I: including DMEM / F12 medium, serum replacement, non-essential amino acids, glutamine or GlutaMax, β-mercaptoethanol, ROCK inhibitor, BMP signaling pathway inhibitor, TGF-β signaling pathway inhibitor, WNT signaling pathway activator;

[0009] Induction medium II: including DMEM / F12 basal medium, serum replacement, non-essential amino acids, glutamine or GlutaMax, β-mercaptoethanol, BMP signaling pathway inhibitor, TGF-β signaling pathway inhibitor, WNT signaling pathway activator, retinoic acid signaling agonist;

[0010] Differentiation medium I: includes Neurobasal basal medium, DMEM / F12 medium, insulin, glutamine or GlutaMax, non-essential amino acids, antibiotics, N2 supplement, B27 supplement, β-mercaptoethanol, WNT signaling pathway activator, epidermal growth factor, and nerve growth factor;

[0011] Differentiation medium II: includes Neurobasal medium, DMEM / F12 basal medium, insulin, glutamine or GlutaMax, non-essential amino acids, antibiotics, N2 supplement, B27 supplement, β-mercaptoethanol, WNT signaling pathway activator, epidermal growth factor, nerve growth factor, and Matrigel.

[0012] A second aspect of the present invention protects the use of the composition as described above in the preparation of brain organoids.

[0013] A third aspect of the present invention provides a method for preparing a brain organoid, comprising the following steps: subjecting pluripotent stem cells to induction culture and differentiation culture using the composition as described above to obtain the brain organoid.

[0014] A fourth aspect of the present invention protects the brain organoids obtained by the preparation method described above.

[0015] A fifth aspect of the present invention protects an organoid assembly comprising a first organoid and a second organoid, wherein the first organoid comprises the brain organoid as described above.

[0016] A sixth aspect of the present invention protects a method for preparing the organoid assembly as described above, wherein slices of the first organoid and slices of the second organoid are placed adjacent to each other and cultured using a gas-liquid interface culture method to obtain the organoid assembly.

[0017] A seventh aspect of the present invention protects the use of the brain organoid as described above or the organoid assembly as described above in at least one of the following:

[0018] 1) In vitro models for the preparation of brain organoids;

[0019] 2) Used to study the developmental mechanisms and / or functions of nerves;

[0020] 3) For the preparation of diagnostic or therapeutic drugs for neurological diseases;

[0021] 4) Used for screening, drug testing, evaluation or quality control of drugs for the prevention, diagnosis or treatment of neurological diseases.

[0022] The beneficial effects of this application are:

[0023] 1) The present invention provides a composition for preparing brain organoids, which can regulate the ratio and timing of the addition of factors related to the WNT signaling pathway, the BMP signaling pathway, the TGF-β signaling pathway, the retinoic acid signal, etc. in the composition, so that pluripotent stem cells are induced and differentiated by the composition of the present application to obtain brain organoids. The brain organoids are highly similar to the medulla oblongata, and further highly similar to the spinal trigeminal nucleus (SpV) in the medulla oblongata. The organoids can produce neurons, axons and dendrites, and generate electrophysiological signals, indicating that the brain organoids of the present application can be used as a hindbrain organoid model, especially an organoid model of the spinal trigeminal nucleus originating from the dorsal medulla oblongata. The brain organoids of the present application provide a convenient in vitro model for studying the development, function, and disease of the hindbrain region. There are currently no reports on medullary organoids, let alone brain organoids on the spinal trigeminal nucleus.

[0024] 2) The brain organoids (dorsal medulla organoids) constructed in the present invention can be induced to differentiate into dorsal medulla organoids using a variety of different stem cells, such as embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), and the induced differentiation effect is stable among different cell lines.

[0025] 3) The brain organoids (dorsal medulla organoids) constructed by the present invention are maintained and cultured using a gas-liquid interface culture method. During the culture process of more than 100 days, the organoid structure can be maintained healthy and intact.

[0026] 4) The present invention provides a brain organoid model for simulating the dorsal medulla oblongata and spinal trigeminal nucleus, which has important application potential in the study of brain nucleus development, function, related diseases, and drug discovery.

[0027] 5) The present invention also provides a method for constructing an organoid assembly, which is obtained by placing at least two organoid slices in close proximity and culturing them using an air-liquid interface culture method with simple steps.

[0028] 6) The organoid assembly of the present invention simulates the connections of brain nuclei-related neural circuits, which can help to conveniently and efficiently study the functions and pathological mechanisms of related neural circuits in vitro. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1A Shown are bright field images of dorsal medulla organoids (hdMOs) cultured from H9 embryonic stem cells on days D12, D16, D30, and D60 in Example 1 of the present invention.

[0030] Figure 1B Shown is a comparative diagram of PAX7 and PAX2 staining identification in dorsal medulla organoids (hdMO), thalamic organoids (hThO), and cortical organoids (hCO) in Example 1 of the present invention.

[0031] Figure 1C Shown is a comparative diagram of LHX1 / 2 and PAX2 staining identification in dorsal medulla organoids (hdMO), thalamic organoids (hThO), and cortical organoids (hCO) in Example 1 of the present invention.

[0032] Figure 1D Shown is a quantitative comparison of staining of cell types in dorsal medulla organoids (hdMO), thalamic organoids (hThO), and cortical organoids (hCO) in Example 1 of the present invention.

[0033] Figure 1E A diagram showing the cell types identified by single-cell analysis of dorsal medullary organoids (hdMOs) in Example 1 of the present invention.

[0034] Figure 1F Shown is a comparison chart of the similarity between the dorsal medulla organoid (hdMO) in Example 1 of the present invention and tissues from different regions of the human brain.

[0035] Figure 1G Shown is a comparison of the similarities between the dorsal medullary organoid (hdMO) in Example 1 of the present invention and different nuclei of the human medulla oblongata.

[0036] Figure 2A Shown are images of SOX2, SOX10, PHOX2B, NKX2-2, and OLIG3 staining of dorsal medulla organoids (hdMOs) differentiated from H1 hESCs in Example 2 of the present invention.

[0037] Figure 2B Shown are images of PAX7 and PAX2 staining identification of dorsal medullary organoids (hdMO) differentiated from H1 hESCs in Example 2 of the present invention.

[0038] Figure 2C Shown are SOX2, SOX10, PHOX2B, NKX2-2, and OLIG3 staining identification images of dorsal medulla organoids (hdMOs) differentiated from hiPSC RC01001A in Example 2 of the present invention.

[0039] Figure 2D Shown are images of PAX7 and PAX2 staining identification of dorsal medullary organoids (hdMOs) differentiated from hiPSC RC01001A in Example 2 of the present invention.

[0040] Figure 2E Shown are SOX2, SOX10, PHOX2B, NKX2-2, and OLIG3 staining identification images of dorsal medulla organoids (hdMOs) differentiated from hiPSC RC01001B in Example 2 of the present invention.

[0041] Figure 2F Shown is PAX7 and PAX2 staining identification of dorsal medullary organoids (hdMO) differentiated from hiPSC RC01001B in Example 2 of the present invention.

[0042] Figure 2G Shown is the staining identification of PAX7 and LMX1B in dorsal medullary organoids (hdMO) differentiated from H1 hESCs, hiPSC RC01001A, and hiPSC RC01001B in Example 2 of the present invention.

[0043] Figure 2H Shown are the results of HOX gene expression in dorsal medullary organoids (hdMOs) derived from different cell lines in Example 2 of the present invention.

[0044] Figure 3A Shown is the NF, LMX1B, and PAX2 staining identification of dorsal medullary organoids (hdMO) cultured at the air-liquid interface for a long term in Example 3 of the present invention.

[0045] Figure 3B The figure shows the NF and MAP2 staining identification of dorsal medullary organoids (hdMO) after long-term gas-liquid interaction culture in Example 3 of the present invention.

[0046] Figure 3C Shown is a schematic diagram of MEA functional analysis of dorsal medullary organoids (hdMO) in Example 3 of the present invention.

[0047] Figure 3D Shown are electrophysiological recordings of neuronal function in dorsal medullary organoids (hdMOs) from Example 3 of the present invention. The top panel shows a dot plot of electrophysiological recordings from electrodes in a well plate, while the bottom panel shows an electrophysiological waveform recorded from a single electrode. Scale bars: 200 μm (A), 50 μm (B).

[0048] Figure 4A Shown are a schematic diagram of the fused organoid (hMTO) simulating the connection between the spinal trigeminal nucleus and the thalamus in the medulla oblongata in Example 4 of the present invention (left), and a bright field image of the fused organoid (hMTO) (right).

[0049] Figure 4B Shown is the live cell fluorescence imaging of the fused organoid (hMTO) in Example 4 of the present invention.

[0050] Figure 4C Shown is an image of the fused organoid (hMTO) in Example 4 of the present invention.

[0051] Figure 4D Shown is a staining identification image of region-specific markers in the dorsal medulla-thalamus fusion organoid in Example 4 of the present invention.

[0052] Figure 5A Shown is the analysis of the transcription level of dorsal signals in Example 1 of the present invention and Comparative Examples 1-3.

[0053] Figure 5B Shown is the similarity analysis of transcriptional features between Example 1 of the present invention and Comparative Examples 1-3 and each subregion of the dorsal medulla oblongata. DETAILED DESCRIPTION

[0054] The nervous system consists primarily of the central nervous system and the peripheral nervous system. Central nervous system development begins with the induction and differentiation of the ectodermal neuroepithelium, forming the neural plate. Subsequently, the neuroepithelium rapidly expands, and the neural plate folds and fuses to form the neural tube. During neural tube development, two fundamental developmental axes are established: the anterior-posterior (rostral)-posterior (caudal) axis and the dorsal-ventral axis. Following the anterior-posterior axis of the neural tube, the rostral end of the neural tube becomes the brain, and the caudal end becomes the spinal cord. The brain further develops into the telencephalon (e.g., cerebral cortex), diencephalon (e.g., thalamus), midbrain, and hindbrain (e.g., medulla oblongata). The medulla oblongata connects to the pons and midbrain superiorly and the spinal cord inferiorly. It regulates and controls vital functions such as heart rate, blood pressure, respiration, and digestion. Localized damage to the medulla oblongata is often life-threatening, and therefore it is considered the body's life center. The medulla oblongata is a vital pathway for many sensory and motor fibers of the central nervous system. Some of these ascending impulses influence the function of the cerebral cortex and play a vital role in maintaining wakefulness and inducing sleep. The downward impulse is involved in the regulation of muscle tone and body movement.

[0055] At the same time, the same neural tube segment can develop into different brain structures along the dorsal-ventral axis. The medulla oblongata is composed of ventral and dorsal regions. The dorsal region of the medulla oblongata can be further divided into subpopulations A and B. Subpopulation A consists of OLIG3-positive cells, while subpopulation B consists of PAX7-positive cells. Subpopulation B includes dB1, dB2, dB3, and dB4. dB1 develops into dBLa (PAX2 and LHX1 / 5 positive) and dBLB (LMX1B positive). The spinal trigeminal nucleus develops from dBLa and dBLB, with these two regions contributing inhibitory and excitatory neuronal components to the nucleus, respectively. By analyzing the expression of genes corresponding to dBL1 and dBLB, it is possible to determine whether brain organoids possess the identity characteristics of the spinal trigeminal nucleus.

[0056] Current research on brain organoids has primarily focused on the telencephalon, diencephalon, and the spinal cord, further caudal to the neural tube. Current technologies have made it difficult to enable organoids to acquire the identity of hindbrain and medulla oblongata segments or to induce transitional differentiation into the spinal cord.

[0057] By regulating the WNT signaling pathway, BMP signaling pathway, TGF-β signaling pathway, retinoic acid signaling, etc. in pluripotent stem cells, the inventors successfully obtained brain organoids (interchangeably referred to as dorsal medullary organoids or hdMOs) that are enriched only with PAX2, PAX7, LHX1 / 5, LMX1B and other positive cell types originating from the dorsal hindbrain, but not with positive cells of the ventral lineage and positive cells of the peripheral lineage; combined with single-cell transcriptome analysis, it was found that the brain organoids (hdMOs) of the present application have a high degree of similarity to the spinal trigeminal nucleus (SpV) in the medulla oblongata of the human brain; and after long-term culture, they can produce LMX1B-positive excitatory neurons and PAX2-positive inhibitory neurons as well as a large number of neuronal axons and dendrites, and can spontaneously generate electrophysiological signals, indicating that the brain organoids (hdMOs) of the present application can differentiate into neurons and have neuronal functions. Furthermore, the present application constructed an organoid assembly (fused organoid) by fusing it with thalamic organoids in vitro, and found that the brain organoids (hdMO) can transmit neurons into the thalamic organoids, and the fused cell-like cells can maintain good identity in the dorsal medulla and thalamus regions. This provides a basis for studying the circuit connection between the spinal trigeminal nucleus and the thalamus, and the pathogenesis and treatment of spinal trigeminal nucleus-related diseases. It also provides technical support for the construction of more advanced multi-organ systems in vitro. On this basis, the present invention was completed.

[0058] The first aspect of the present invention provides a composition for preparing brain organoids, comprising any one or more of the following culture media:

[0059] Induction medium I: including DMEM / F12 medium, serum replacement, non-essential amino acids, glutamine or GlutaMax, β-mercaptoethanol, ROCK inhibitor, BMP signaling pathway inhibitor, TGF-β signaling pathway inhibitor, WNT signaling pathway activator;

[0060] Induction medium II: including DMEM / F12 basal medium, serum replacement, non-essential amino acids, glutamine or GlutaMax, β-mercaptoethanol, BMP signaling pathway inhibitor, TGF-β signaling pathway inhibitor, WNT signaling pathway activator, retinoic acid signaling agonist;

[0061] Differentiation medium I: includes Neurobasal basal medium, DMEM / F12 medium, insulin, glutamine or GlutaMax, non-essential amino acids, antibiotics, N2 supplement, B27 supplement, β-mercaptoethanol, WNT signaling pathway activator, epidermal growth factor, and nerve growth factor;

[0062] Differentiation medium II: includes Neurobasal medium, DMEM / F12 basal medium, insulin, glutamine or GlutaMax, non-essential amino acids, antibiotics, N2 supplement, B27 supplement, β-mercaptoethanol, WNT signaling pathway activator, epidermal growth factor, nerve growth factor, and Matrigel.

[0063] The composition of the present application contains ingredients such as WNT signaling pathway activators, BMP signaling pathway inhibitors, TGF-β signaling pathway inhibitors, retinoic acid signaling agonists, epidermal growth factor, nerve growth factor, etc. that regulate pluripotent stem cells. Through the complex coordination between the ingredients, pluripotent stem cells can be induced and differentiated into brain organoids, which can produce neural precursor cells and further differentiate into neurons.

[0064] In certain embodiments, the ROCK inhibitor is Y27632.

[0065] In certain embodiments, the BMP signaling pathway inhibitor is LDN193189. LDN193189 can inhibit the activity of bone morphogenetic protein (BMP) type I receptor to study the pathogenesis of fibrodysplasia ossificans progressiva and congenital ossification disorders, and to investigate the role of bone formation in prostate tumor bone metastasis. LDN193189 can be purchased from MedChemExpress (MCE), for example, under the product number HY-12071A.

[0066] In certain embodiments, the TGF-β signaling pathway inhibitor is SB431542. SB431542 inhibits TGFβ signaling by inhibiting activin receptor-like kinases 4, 5, and 7. SB431542 can be purchased from abcam, for example, under the catalog number ab120163.

[0067] In certain embodiments, the WNT signaling pathway activator is CHIR99021. CHIR99021 activates the classical WNT signaling pathway by inhibiting GSK3. CHIR99021 can be purchased from, for example, Stem Cell Technologies, with the catalog number 72054. The WNT signaling pathway regulates the caudal and dorsalization of neural tissue, and is necessary for differentiating dorsal medullary organoids with the caudal and dorsal characteristics of the neural tube. The present application found that if CHIR99021 is not added to the induction culture medium II, differentiation culture I, and II, the resulting organoids will have no dorsal neural tube dorsal signals and no spinal trigeminal nucleus characteristics.

[0068] In certain embodiments, the retinoic acid signal agonist is retinoic acid (RA). RA is all-trans retinoic acid. RA activates RA signals by binding to nuclear hormone receptor retinoic acid receptor (RAR), which is necessary for the differentiation of medullary cells, and transition activation causes differentiation into the spinal cord. Retinoic acid can be purchased from, for example, Sigma-Aldrich, with article number R2625. The application finds that CHIR99021 and retinoic acid are not added in the induction culture fluid II, and CHIR99021 is not added in subsequent differentiation cultures I and II, which can cause the organoids produced to have no dorsal neural tube dorsal signals and do not have spinal trigeminal nucleus characteristics. The regulation combination of WNT signals and RA signals is necessary for differentiation to obtain dorsal medullary organoids with spinal trigeminal nucleus characteristics. If WNT signal activation and RA signal activation time are insufficient, the similarity between organoids and spinal trigeminal nucleus will be reduced, as the expression of PAX7, PAX2, and LMX1B genes is reduced.

[0069] In certain embodiments, the antibiotic is penicillin and / or streptomycin.

[0070] In certain embodiments, Matrigel can help fold neural tissue. If Matrigel is not added, cells will aggregate into sheets, which is not conducive to the formation of neurospheres.

[0071] In certain specific embodiments, the induction culture solution I comprises DMEM / F12 medium and the following components based on the volume of the DMEM / F12 medium:

[0072]

[0073]

[0074] In certain more specific embodiments, the concentration of the serum substitute may be 10-30 v / v%, 10-16 v / v%, 12-22 v / v%, or 20-30 v / v%. In a specific embodiment, it is 15 v / v%. In certain more specific embodiments, the concentration of the non-essential amino acids may be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.3 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of glutamine or GlutaMax may be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.3 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of the β-mercaptoethanol can be 50-150 μM, 50-80 μM, 70-120 μM, or 90-150 μM. In a specific embodiment, it is 100 μM. In certain more specific embodiments, the concentration of the ROCK inhibitor can be 10-100 μM, 10-45 μM, 30-65 μM, 50-72 μM, or 70-100 μM. In a specific embodiment, it is 50 μM. In certain more specific embodiments, the concentration of the BMP signaling pathway inhibitor can be 20-500 nM, 20-95 nM, 90-165 nM, 155-320 nM, or 300-500 nM. In a specific embodiment, it is 100 nM. In certain more specific embodiments, the TGF-β signaling pathway inhibitor can be 5-100 μM, 5-35 μM, 22-68 μM, 55-72 μM, or 70-100 μM. In a specific embodiment, it is 10 μM. In certain more specific embodiments, the WNT signaling pathway activator can be 1-10 μM, 1-5 μM, 3-7 μM, or 6-10 μM. In a specific embodiment, it is 3 μM.

[0075] In certain specific embodiments, the induction culture medium II comprises DMEM / F12 medium and the following components based on the volume of the DMEM / F12 medium:

[0076]

[0077]

[0078] In certain more specific embodiments, the concentration of the serum substitute may be 10-30 v / v%, 10-16 v / v%, 12-22 v / v%, or 20-30 v / v%. In a specific embodiment, it is 15 v / v%. In certain more specific embodiments, the concentration of the non-essential amino acids may be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.3 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of glutamine or GlutaMax may be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.3 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the β-mercaptoethanol concentration can be 50-150 μM, 50-80 μM, 70-120 μM, or 90-150 μM. In a specific embodiment, it is 100 μM. In certain more specific embodiments, the BMP signaling pathway inhibitor can be 20-500 nM, 20-95 nM, 90-165 nM, 155-320 nM, or 300-500 nM. In a specific embodiment, it is 100 nM. In certain more specific embodiments, the TGF-β signaling pathway inhibitor can be 5-100 μM, 5-35 μM, 22-68 μM, 55-72 μM, or 70-100 μM. In a specific embodiment, it is 10 μM. In certain more specific embodiments, the WNT signaling pathway activator can be 1-10 μM, 1-5 μM, 3-7 μM, or 6-10 μM. In a specific embodiment, it is 3 μM. In certain more specific embodiments, the retinoic acid can be 50-1000 nM, 50-350 nM, 300-550 nM, 500-750 nM, or 700-1000 nM. In a specific embodiment, it is 100 nM.

[0079] In certain specific embodiments, the differentiation culture medium I comprises a basal medium prepared by mixing Neurobasal medium and DMEM / F12 medium in an equal volume ratio of 1:1, and the following components based on the volume of the basal medium:

[0080]

[0081]

[0082] In certain more specific embodiments, the concentration of insulin can be 0.01-0.1 v / v%, 0.01-0.07 v / v%, 0.03-0.08 v / v%, or 0.04-0.1 v / v%. In a specific embodiment, it is 0.05 v / v%. In certain more specific embodiments, the concentration of glutamine or GlutaMax can be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.4 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of non-essential amino acids can be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.4 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 0.5 v / v%. In certain more specific embodiments, the concentration of the antibiotic may be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.4 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of the N2 additive may be 0.1-1.0 v / v%, 0.1-0.6 v / v%, 0.4-0.8 v / v%, or 0.6-1.0 v / v%. In a specific embodiment, it is 0.5 v / v%. In certain more specific embodiments, the concentration of the B27 additive may be 0.5-2 v / v%, 0.5-1.1 v / v%, 0.8-1.5 v / v%, or 1.4-2 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of β-mercaptoethanol can be 25-75 μM, 25-45 μM, 30-55 μM, or 45-75 μM. In a specific embodiment, it is 50 μM. In certain more specific embodiments, the concentration of the WNT signaling pathway activator can be 1-10 μM, 1-6 μM, 3-8 μM, or 6-10 μM. In a specific embodiment, it is 3 μM. In certain more specific embodiments, the concentration of epidermal growth factor can be 5-100 ng / mL, 5-35 ng / mL, 30-65 ng / mL, or 60-100 ng / mL. In a specific embodiment, it is 10 ng / mL. In certain more specific embodiments, the concentration of nerve growth factor can be 10-100 ng / mL, 10-35 ng / mL, 30-65 ng / mL, or 60-100 ng / mL. In a specific embodiment, it is 20 ng / mL.

[0083] In certain specific embodiments, the differentiation medium II comprises a basal medium prepared by mixing Neurobasal medium and DMEM / F12 medium in an equal volume ratio of 1:1, and the following components based on the volume of the basal medium:

[0084]

[0085]

[0086] In certain more specific embodiments, the concentration of insulin can be 0.01-0.1 v / v%, 0.01-0.07 v / v%, 0.03-0.08 v / v%, or 0.04-0.1 v / v%. In a specific embodiment, it is 0.05 v / v%. In certain more specific embodiments, the concentration of glutamine or GlutaMax can be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.4 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of non-essential amino acids can be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.4 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 0.5 v / v%. In certain more specific embodiments, the concentration of the antibiotic may be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.4 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of the N2 additive may be 0.1-1.0 v / v%, 0.1-0.6 v / v%, 0.4-0.8 v / v%, or 0.6-1.0 v / v%. In a specific embodiment, it is 0.5 v / v%. In certain more specific embodiments, the concentration of the B27 additive may be 0.5-2 v / v%, 0.5-1.1 v / v%, 0.8-1.5 v / v%, or 1.4-2 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of β-mercaptoethanol can be 25-75 μM, 25-45 μM, 30-55 μM, or 45-75 μM. In a specific embodiment, it is 50 μM. In certain more specific embodiments, the concentration of the WNT signaling pathway activator can be 1-10 μM, 1-3 μM, 2-4 μM, or 3-5 μM. In a specific embodiment, it is 3 μM. In certain more specific embodiments, the concentration of epidermal growth factor can be 5-100 ng / mL, 5-35 ng / mL, 30-65 ng / mL, or 60-100 ng / mL. In a specific embodiment, it is 10 ng / mL. In certain more specific embodiments, the concentration of nerve growth factor can be 10-100 ng / mL, 10-35 ng / mL, 30-65 ng / mL, or 60-100 ng / mL. In a specific embodiment, it is 20 ng / mL.In certain more specific embodiments, the concentration of the matrigel may be 0.5-5 v / v%, 0.5-2 v / v%, 1.5-3.5 v / v%, or 3.2-5 v / v%. In a specific embodiment, it is 1 v / v%.

[0087] When the brain organoids induced to differentiate using the composition of the present application are cultured for a long time for about 60 days, spontaneous electrophysiological signals can be generated; when cultured for about 87 days, a large number of LMX1B and PAX2-positive neurons can be observed; when cultured for about 163 days, a large number of neuronal axons and dendrites can be observed, indicating that the composition of the present application can promote the maturation of brain organoids and establish neuronal functions, that is, neurons receive external or internal stimuli through the cell body, convert the stimuli into electrical signals, transmit them between axons and dendrites, transmit neural information to other neurons and have neuronal functions.

[0088] A second aspect of the present invention protects the use of the composition as described above in the preparation of brain organoids.

[0089] A third aspect of the present invention provides a method for preparing a brain organoid, comprising inducing and differentiating pluripotent stem cells using the composition described above to obtain the brain organoid. In certain embodiments, the pluripotent stem cells are selected from at least one of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs).

[0090] In certain specific embodiments, the embryonic stem cells are selected from at least one of H9 embryonic stem cells and H1 embryonic stem cells.

[0091] In certain specific embodiments, the induced pluripotent stem cells are selected from at least one of RC01001A and RC01001B.

[0092] In certain embodiments, before the induction culture, the pluripotent stem cells are digested to obtain a single cell suspension, and then the single cell suspension is subjected to induction culture.

[0093] In certain specific embodiments, Accutase enzyme is used to digest the adherent pluripotent stem cells. Compared with trypsin, collagenase, neutral enzyme, etc., Accutase can quickly and gently digest and dissociate the cells and maintain higher cell viability.

[0094] In certain specific embodiments, after digestion, the digested pluripotent stem cells are resuspended in mTeSR plus medium to obtain a cell suspension. The volume of the mTeSR plus medium is preferably 1 mL. The cell suspension is then resuspended in induction medium I to obtain a cell suspension, which is then added to an ultra-low adsorption microplate (e.g., an ultra-low adsorption 96-well plate) and then placed in a cell culture incubator at 37°C and 5% CO2 for 2 days.

[0095] In certain embodiments, the induction culture conditions are 28-40°C and 3-6% CO2. After the induction stage, the cells form a three-dimensional, relatively transparent sphere from a monolayer of cells. Neuroepithelial cell-specific genes, such as SOX2, can be detected, while the expression of pluripotent stem cell genes, such as OCT4 and NANOG, is downregulated.

[0096] In certain embodiments, the differentiation culture conditions are 28-40°C and 3-6% CO2. After the differentiation stage, the three-dimensional spheroids become larger and less transparent. At the same time, enriched expression of molecular markers of the dorsal medulla oblongata and spinal trigeminal nucleus, such as PAX7, PAX2, LHX1 / 5, LBX1, and LMX1B, can be detected, but pluripotent stem cell genes, such as OCT4 and NANOG, are not expressed.

[0097] In certain embodiments, the induced culture is a suspension culture.

[0098] In certain embodiments, the induced culture is a static culture.

[0099] In certain embodiments, the differentiation culture is a suspension culture or an air-liquid interface culture. The present application enables long-term culture of organoids using air-liquid interface culture. When cultured for more than five months, the resulting brain organoids contain a large number of neuronal axons (NFs) and dendrites (MAP2s); and spontaneous electrophysiological signals can be detected through multi-electrode array (MEA) analysis.

[0100] In certain embodiments, the differentiation culture is performed under shaking conditions.

[0101] In certain embodiments, the method further comprises maintenance culture, wherein the maintenance culture is performed in differentiation medium III.

[0102] In certain specific embodiments, the differentiation culture medium III includes Neurobasal medium, DMEM / F12 basal medium, insulin, glutamine or GlutaMax, non-essential amino acids, antibiotics, N2 additive, B27 additive, β-mercaptoethanol, brain-derived neurotrophic factor, and ascorbic acid.

[0103] In certain specific embodiments, the differentiation medium III comprises a basal medium prepared by mixing Neurobasal medium and DMEM / F12 medium in an equal volume ratio of 1:1, and the following components based on the volume of the basal medium:

[0104]

[0105] In certain more specific embodiments, the concentration of insulin can be 0.01-0.1 v / v%, 0.01-0.07 v / v%, 0.03-0.08 v / v%, or 0.04-0.1 v / v%. In a specific embodiment, it is 0.05 v / v%. In certain more specific embodiments, the concentration of glutamine or GlutaMax can be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.4 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of non-essential amino acids can be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.4 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 0.5 v / v%. In certain more specific embodiments, the concentration of the antibiotic may be 0.5-1.5 v / v%, 0.5-1.1 v / v%, 0.8-1.4 v / v%, or 1.1-1.5 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the concentration of the N2 additive may be 0.1-1.0 v / v%, 0.1-0.6 v / v%, 0.4-0.8 v / v%, or 0.6-1.0 v / v%. In a specific embodiment, it is 0.5 v / v%. In certain more specific embodiments, the concentration of the B27 additive may be 0.5-2 v / v%, 0.5-1.1 v / v%, 0.8-1.5 v / v%, or 1.4-2 v / v%. In a specific embodiment, it is 1 v / v%. In certain more specific embodiments, the β-mercaptoethanol concentration may be 25-75 μM, 25-45 μM, 30-55 μM, or 45-75 μM. In a specific embodiment, it is 50 μM. In certain more specific embodiments, the brain-derived neurotrophic factor concentration may be 10-100 ng / mL, 10-35 ng / mL, 30-65 ng / mL, or 60-100 ng / mL. In a specific embodiment, it is 20 ng / mL. In certain more specific embodiments, the L-ascorbic acid concentration may be 100-1000 μM, 100-310 μM, 300-560 μM, 500-720 μM, or 700-1000 μM. In a specific embodiment, it is 200 μM.

[0106] In certain embodiments, the steps include:

[0107] 1) inducing and culturing the pluripotent stem cells in the induction medium I and the induction medium II in sequence to obtain embryoid bodies;

[0108] 2) Differentiating and culturing the embryoid bodies in the differentiation culture medium I and the differentiation culture medium II in sequence to obtain the brain organoids.

[0109] In certain specific embodiments, in 1), the pluripotent stem cell is a single cell.

[0110] In certain specific embodiments, in 1), the induction culture time in the induction culture medium I is 1 to 4 days. Preferably, it is 2 days.

[0111] In certain specific embodiments, in 1), the induction culture period in the induction culture medium II is 5 to 8 days, with half the volume of the medium being replaced every 1 to 2 days. Preferably, it is 6 days. Except for the day when the induction culture medium I stage is switched to the induction culture medium II stage, a full volume replacement is performed on all other changes. The half-volume replacement is to directly remove half of the old culture medium and replenish an equal amount of fresh culture medium, such as removing 75 μL of the old culture medium and replenishing 75 μL of fresh culture medium.

[0112] In certain specific embodiments, in 2), the differentiation culture in differentiation medium I is carried out for 1 to 6 days, with full medium replacement every 1 to 2 days. Preferably, the differentiation culture is carried out for 4 days, with full medium replacement every other day. The full medium replacement is to directly aspirate all the old medium and replace with sufficient fresh medium.

[0113] In certain specific embodiments, in 2), the differentiation culture period in the differentiation culture medium II is 1 to 6 days, with the medium being fully replaced every 1 to 2 days. Preferably, the period is 4 days, with the medium being fully replaced every other day.

[0114] In certain specific embodiments, the maintenance culture period is 9 to 100 days.

[0115] In certain specific embodiments, after step 2), maintenance culture is performed, and the maintenance culture is performed using an air-liquid interface culture method, which comprises slicing the brain organoid obtained in 2), placing the obtained slice tissue in a cell embedding dish, placing the differentiation culture medium III under the cell embedding dish, so that the slice tissue is at the air-liquid interface, and maintaining the culture to achieve long-term culture of the organoid. The maintenance culture time is 9 to 100 days. From the 1st day to the 14th day of maintenance culture, the full volume of the medium is replaced every 2 days. After the 14th day, the full volume of the medium is replaced every 3 to 4 days.

[0116] The method of the present application can maintain a healthy and complete morphology of organoids from early differentiation induction to long-term culture.

[0117] A fourth aspect of the present invention protects the brain organoids obtained by the preparation method as described above.

[0118] The brain organoids of the present application contain at least two of PAX7, PAX2, LHX1 / 5, LBX1, and LMX1B positive cells, but do not express PHOX2B, NKX2-2, and SOX10.

[0119] The brain organoids of the present application have a high similarity with the medulla oblongata region, and further have the highest similarity with the spinal trigeminal nucleus (SpV) in the medulla oblongata; the brain organoids of the present application can highly express dorsal-specific genes and are highly similar to type B cells in the dorsal medulla oblongata region, that is, the brain organoids of the present application are organoid models for the spinal trigeminal nucleus originating from the dorsal medulla oblongata; in addition, the brain organoids can also differentiate into dorsal neurons, generate axons and dendrites, and spontaneously generate electrophysiological signals, establish neuronal functions, and do not further differentiate into the spinal cord.

[0120] A fifth aspect of the present invention protects an organoid assembly comprising a first organoid and a second organoid, wherein the first organoid comprises the brain organoid as described above.

[0121] "Organoid assembly" as used herein refers to the co-culturing of different types of brain organoids, or of brain organoids with different cellular components. In this application, human brain organoid assemblies can be generated by integrating the aforementioned brain organoids (hdMOs) with one or more other brain region-specific organoids or cells from other lineages to simulate more complex neural developmental processes and thus reflect abnormalities in neurological diseases.

[0122] In certain embodiments, the second organoid comprises at least one of thalamic organoids, cortical organoids, ventral telencephalic organoids, midbrain organoids, cerebellar organoids, and spinal cord organoids, and may also comprise other brain region-specific organoids commonly known to those skilled in the art.

[0123] The thalamus is the largest oval gray matter nucleus in the diencephalon. It is a higher sensory center and the most important sensory relay station. The pathways for all sensory sensations in the body (except for smell) pass through neurons in the thalamus and are then projected to the cerebral cortex.

[0124] In the present application, when brain organoids (hdMO) and thalamic organoids (hThO) are assembled to form an organoid assembly, neurons of the brain organoids (hdMO) can project into the thalamic organoids (hThO), and the brain organoids (hdMO) and thalamic organoids (hThO) are enriched with positive cells related to the spinal trigeminal nucleus and TCF7L2-positive cells unique to the thalamus, respectively.

[0125] A sixth aspect of the present invention protects a method for preparing the organoid assembly as described above, comprising the steps of placing slices of the first organoid and slices of the second organoid adjacent to each other, and culturing them using an air-liquid interface culture method to obtain the organoid assembly.

[0126] The method specifically comprises the following steps:

[0127] 1) culturing the first organoid described above; culturing the second organoid;

[0128] 2) preparing slices of the first organoid and slices of the second organoid respectively.

[0129] 3) Placing the slices of the first organoid and the slices of the second organoid adjacent to each other in a cell embedding dish, placing culture medium below the cell dish, so that the first organoid and the second organoid are at an air-liquid interface.

[0130] 4) After static culture for 1 day, the culture dish was placed on a horizontal shaker for culture.

[0131] In certain embodiments, the first organoid is cultured for 25 to 30 days.

[0132] In certain embodiments, the second organoid is cultured for 25 to 30 days.

[0133] In certain embodiments, in 4), static culture is performed to promote spontaneous contact and fusion of slices of the first organoid and the second organoid to form an organoid assembly.

[0134] A seventh aspect of the present invention protects the use of the brain organoid as described above or the organoid assembly as described above in at least one of the following:

[0135] 1) Used to prepare in vitro brain organoid models;

[0136] 2) Used to study the developmental mechanisms and / or functions of nerves;

[0137] 3) For the preparation of diagnostic or therapeutic drugs for neurological diseases;

[0138] 4) Used for screening, drug testing, evaluation or quality control of drugs for the prevention, diagnosis or treatment of neurological diseases.

[0139] The organoid assembly described in this application can simulate the connections between neural circuits within brain nuclei, enabling convenient and efficient in vitro research into the functions and pathological mechanisms of these circuits. Neural circuits are the various connections between neurons with different properties and functions within the brain; this application specifically focuses on the spinal trigeminal-thalamic neural circuit.

[0140] Before further describing the specific embodiments of the present invention, it should be understood that the scope of the present invention is not limited to the specific embodiments described below. It should also be understood that the terminology used in the examples is intended to describe specific embodiments and is not intended to limit the scope of the present invention. The experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions or according to the conditions recommended by the respective manufacturers.

[0141] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0142] The culture medium of the present invention is formulated as follows:

[0143] Induction Medium I: DMEM / F12 basal medium supplemented with KnockOut Serum Replacement, non-essential amino acids (NEAA), glutamine or GlutaMax, β-mercaptoethanol, a BMP signaling pathway inhibitor (e.g., LDN193189), a TGF-β signaling pathway inhibitor (e.g., SB431542), a WNT signaling pathway activator (e.g., CHIR99021), and a ROCK inhibitor (e.g., Y27632). The specific configuration is as follows: DMEM / F12 basal medium (11330057, Gibco) was supplemented with the components listed in Table 1.

[0144] Table 1

[0145] Element Final concentration <![CDATA[Serum Substitute: KnockOut TM Serum Replacement(10828028, Gibco)]]> 15% (v / v) Non-essential amino acids NEAA (11140050, Gibco) 1% (v / v) <![CDATA[GlutaMAX TM Supplement(35050-061,Gibco)]]> 1% (v / v) β-Mercaptoethanol (M3148, SIGMA) 100 μM Y27632(MedChemExpress,HY-10583) 50μM LDN193189(HY-12071A,MCE) 100nM SB431542 (ab120163, abcam) 10 μM CHIR99021(72054,Stemcell Technologies) 3μM

[0146] Induction Medium 2: DMEM / F12 basal medium supplemented with KnockOut Serum Replacement, non-essential amino acids (NEAA), glutamine or GlutaMax, β-mercaptoethanol, a BMP signaling pathway inhibitor (e.g., LDN193189), a TGF-β signaling pathway inhibitor (e.g., SB431542), a WNT signaling pathway activator (e.g., CHIR99021), and retinoic acid (RA). The specific formula is as follows: DMEM / F12 basal medium (11330057, Gibco) is supplemented with the ingredients listed in Table 2. RA is prepared freshly before use.

[0147] Table 2

[0148] Element Final concentration <![CDATA[Serum Substitute: KnockOut TM Serum Replacement(10828028, Gibco)]]> 15% (v / v) Non-essential amino acids NEAA (11140050, Gibco) 1% (v / v) <![CDATA[GlutaMAX TM Supplement(35050-061,Gibco)]]> 1% (v / v) β-Mercaptoethanol (M3148, SIGMA) 100 μM LDN193189(HY-12071A,MCE) 100nM SB431542 (ab120163, abcam) 10 μM CHIR99021(72054,Stemcell Technologies) 3μM Retinoic acid(RA)(R2625, Sigma-Aldrich) 100nM

[0149] Differentiation Medium I: Basal medium is a mixture of Neurobasal medium and DMEM / F12 medium supplemented with insulin, glutamine or GlutaMax, non-essential amino acids (NEAA), a penicillin-streptomycin mixture, N2 supplement, B27 supplement, β-mercaptoethanol, a WNT signaling pathway activator (e.g., CHIR99021), epidermal growth factor (EGF), and nerve growth factor (NGF). The specific formula is as follows: Basal medium is a mixture of Neurobasal medium (Gibco, 21103049) and DMEM / F12 medium (Gibco, C11330500BT) at a 1:1 ratio of equal volumes, followed by the addition of the components listed in Table 3.

[0150] Table 3

[0151] Element Final concentration Insulin (P3376, Beyotime) 0.05% (v / v) GlutaMax (35050061, Gibco) 1% (v / v) Non-essential amino acids NEAA (11140050, Gibco) 0.5% (v / v) Penicillin-Streptomycin (15140122, Gibco) 1% (v / v) N2(17502048,Gibco) 0.5% (v / v) B27(17504044,Gibco) 1% (v / v) β-Mercaptoethanol (M3148, Sigma-Aldrich) 50μM CHIR99021(72054,Stem Cell Technologies) 3μM EGF(C029B,novoprotein) 10ng / ml NGF (C060,novoprotein) 20ng / ml

[0152] Differentiation Medium II: Basal medium is a mixture of Neurobasal medium and DMEM / F12 medium supplemented with insulin, glutamine or GlutaMax, non-essential amino acids (NEAA), a penicillin-streptomycin mixture, N2 supplement, B27 supplement, β-mercaptoethanol, a WNT signaling pathway activator (such as CHIR99021), epidermal growth factor (EGF), nerve growth factor (NGF), and Matrigel. The specific formula is as follows: Basal medium is a mixture of Neurobasal medium (Gibco, 21103049) and DMEM / F12 medium (Gibco, C11330500BT) at a 1:1 ratio of equal volumes, followed by the addition of the ingredients listed in Table 4. Matrigel is added immediately upon use.

[0153] Table 4

[0154] Element Final concentration Insulin (P3376, Beyotime) 0.05% (v / v) GlutaMax (35050061, Gibco) 1% (v / v) Non-essential amino acids NEAA (11140050, Gibco) 0.5% (v / v) Penicillin-Streptomycin (15140122, Gibco) 1% (v / v) N2(17502048,Gibco) 0.5% (v / v) B27(17504044,Gibco) 1% (v / v) β-Mercaptoethanol (M3148, Sigma-Aldrich) 50μM CHIR99021(72054,Stem Cell Technologies) 3μM EGF(C029B,novoprotein) 10ng / ml NGF (C060,novoprotein) 20ng / ml Matrigel(354230,BD) 1% (v / v)

[0155] Differentiation Medium III: Basal medium is a mixture of Neurobasal medium and DMEM / F12 medium supplemented with insulin, glutamine or GlutaMax, non-essential amino acids (NEAA), a penicillin-streptomycin mixture, N2 supplement, B27 supplement, β-mercaptoethanol, brain-derived neurotrophic factor (BDNF), and L-ascorbic acid. The specific formula is as follows: Basal medium is a mixture of Neurobasal medium (Gibco, 21103049) and DMEM / F12 medium (Gibco, C11330500BT) at a 1:1 ratio of equal volumes, followed by the addition of the ingredients listed in Table 5. Matrigel was added immediately upon use.

[0156] Table 5

[0157] Element Final concentration Insulin (P3376, Beyotime) 0.05% (v / v) GlutaMax (35050061, Gibco) 1% (v / v) Non-essential amino acids NEAA (11140050, Gibco) 0.5% (v / v) Penicillin-Streptomycin (15140122, Gibco) 1% (v / v) N2(17502048,Gibco) 0.5% (v / v) B27(17504044,Gibco) 1% (v / v) β-Mercaptoethanol (M3148, Sigma-Aldrich) 50μM BDNF (C076, novoprotein) 20 ng / mL L-Ascorbic acid (A92902, Sigma) 200 μM

[0158] Example 1: In vitro differentiation of H9 embryonic stem cells into dorsal medullary organoids

[0159] In Example 1, H9 embryonic stem cells were differentiated into dorsal medullary organoids in vitro and identified. The steps included:

[0160] 1.1. Induction and differentiation of H9 embryonic stem cells

[0161] 1) Culture H9 embryonic stem cells in a 6-well plate. When the cells reach 70-90% confluence, begin digesting the embryonic stem cells for induction and differentiation. The specific steps for digesting the embryonic stem cells are as follows:

[0162] 1-1) Under a microscope, remove differentiated stem cells, remove the culture medium, wash the embryonic stem cells once with 1 mL of 1× PBS, and add 1 mL of Accutase (Stemcell) to each well of a 6-well plate. Incubate at 37°C for 10 minutes to fully digest and dissociate the cells into single cells.

[0163] 1-2) Transfer the single cell to a centrifuge tube containing 1 mL of mTeSR plus medium and centrifuge at 1200 rpm for 3 minutes.

[0164] 1-3) Remove the supernatant and resuspend the pelleted cells in 1 mL of mTeSR plus medium to a single-cell suspension. Count the cells. Then dilute with Induction Medium I to a cell concentration of 10,000 cells / mL (i.e., 1,500 cells / 150 μL of medium).

[0165] 1-4) Add 150 μL of the diluted cell suspension from step 1-3) to each well of an ultra-low attachment 96-well plate, and incubate the plate at 37° C. under 5% CO 2 . This is day 0.

[0166] 2) On day 2, remove all culture medium from each well without disturbing the cell spheroids at the bottom. Add 150 μL of Induction Medium II to each well, adding RA immediately before use.

[0167] Subsequently, on the 4th and 6th days, 75 μL of culture medium was removed from each well, and 75 μL of induction medium II was added to each well for medium replacement.

[0168] From day 2 to day 8, except for changing the medium, the cells were cultured statically at 37°C and 5% CO2, and finally embryoid bodies were obtained.

[0169] 3) On Day 8, use a 5 mL pipette or other plastic pipette to transfer the EBs from the 96-well plate to a low-adhesion 6-well plate, taking care not to damage the EBs. Typically, 6-8 EBs can be cultured per well of a low-adhesion 6-well plate. Aspirate the medium from the low-adhesion 6-well plate and add 2.5 mL of Differentiation Medium I to each well.

[0170] On day 10, the culture medium in each well was removed by aspiration, and 2.5 mL of differentiation medium I was added to each well.

[0171] From day 8 to day 12, differentiation culture was carried out at 37°C, 5% CO2, on a horizontal shaker (80 rpm).

[0172] 4) On Day 12, aspirate the culture medium from each well and add 2.5 mL of Differentiation Medium II to each well to continue differentiation. Add Matrigel immediately after use. After changing the medium, shake the sample to distribute it evenly to prevent sticking caused by the Matrigel.

[0173] On day 14, the culture medium in each well was removed by aspiration, and 2.5 mL of differentiation medium II was added to each well.

[0174] From day 12 to day 16, the cells were cultured at 37°C, 5% CO2, and on a horizontal shaker (80 rpm) to obtain brain organoids (dorsal medulla organoids).

[0175] 5) On day 16, the culture medium was removed from each well, and 2.5 mL of differentiation medium III was added to each well. The culture was continued to achieve long-term culture.

[0176] From the 16th day to the 30th day, the medium was changed every two days.

[0177] After day 30, change the medium every 3-4 days. Organoids can be cultured long-term under these conditions.

[0178] During the differentiation culture period, the cells were cultured at 37°C, 5% CO2, and on a horizontal shaker (80 rpm).

[0179] During the differentiation culture process, on days 12, 16, 30, and 60, the bright field images of the organoids were observed by light microscopy. Figure 1A .

[0180] from Figure 1A It can be seen that dorsal medulla organoids (hdMO) maintain a healthy and complete morphology from early differentiation induction to long-term culture.

[0181] 1.2 Identification

[0182] 1.2.1 Immunofluorescence staining

[0183] 1) On day 16, aspirate the differentiation medium and wash the dorsal medullary organoids obtained in step 1.1 three times with PBS.

[0184] 2) Fix the dorsal medullary organoids with 4% PFA (fixative) at 4°C for 1-2 days. Remove the fixative, wash three times with PBS, and soak in 30% sucrose solution at 4°C for 2 days.

[0185] 3) Embed the dorsal medulla organoid samples in OCT reagent at -20°C.

[0186] 4) Subsequently, 30-50 μm sections were prepared using a freezing microtome.

[0187] 5) Incubate the sections with 0.3% Triton X-100 solution at room temperature for 15 minutes, block with 3% BSA / PBS solution at room temperature for 2 hours, and then incubate the samples with 3% BSA / PBS solution containing the primary antibody at 4°C overnight.

[0188] 6) After washing three times with PBS, incubate with a secondary antibody in 3% BSA / PBS at room temperature for 1 hour. After washing three times with PBS, incubate the sample with DAPI solution at room temperature for 10 minutes. After washing three times with PBS, the sample was blocked with ProLong Gold Antifade reagent and imaged under a confocal microscope.

[0189] Whole-tissue staining was performed using the RapiClear kit (Sunjin Lab). The method is briefly described as follows:

[0190] After fixation with 4% PFA, the organoids were incubated with 2% PBST (2% Triton X-100 / PBS) at 4 degrees for 1 day, washed 3 times with PBS at room temperature (15 minutes / time), and placed in a 1.5 mL centrifuge tube filled with blocking solution. The blocking solution refers to 3% goat serum added to 0.3% PBST solution (0.3% Triton X-100 / PBS). After incubation at 4 degrees for 1 day, the blocking solution in the 1.5 mL centrifuge tube was removed, and the blocking solution containing the primary antibody was added, and the tubes were incubated at 4 degrees on a horizontal shaker for 2 days. After washing 3 times with PBS at room temperature (1 hour / time), the tubes were placed in a 1.5 mL centrifuge tube containing PBS and incubated overnight at 4 degrees. Subsequently, the PBS was removed, and the blocking solution containing the secondary antibody was added, and the tubes were incubated at 4 degrees for 2 days. After washing 3 times with PBS at room temperature (1 hour / time), the organoids were incubated in PBS at 4 degrees overnight. After washing 3 times with PBS at room temperature (20 minutes / time), the organoids were incubated in DAPI solution at 4 degrees overnight. After washing with PBS three times at room temperature (1 hour / time), the organoids were transferred to the bottom of a glass dish, RapiClear solution was added, and incubated at room temperature for 2-3 hours before imaging under a confocal microscope.

[0191] The primary antibodies used included: Anti-PAX7 (Abcam, ab221549), Anti-PAX2 (Abcam, ab150391), and Anti-LHX1 / 5 (DSHB, 4F2).

[0192] At the same time, thalamic organoids (hThO) and cortical organoids (hCO) cultured to day 18 were used as controls.

[0193] Thalamic organoids (hThO) were prepared as reported in references 1 and 2. Reference 1: Xiang, Y., et al., hESC-Derived Thalamic Organoids Form Reciprocal Projections When Fused with Cortical Organoids. Cell Stem Cell, 2019. 24(3): p. 487-497e7; Reference 2: Xiang, Y., B. Cakir, and IHPark, Generation of Regionally Specified Human Brain Organoids Resembling Thalamus Development. STAR Protoc, 2020. 1(1).

[0194] Cortical organoids (hCOs) were prepared according to the reported literature 3: Xiang Y, et al., Fusion of Regionally Specified hPSC-Derived Organoids Models Human Brain Development and Interneuron Migration. Cell Stem Cell. 2017 Sep 7; 21(3): 383-398.

[0195] PAX7, PAX2, and LHX1 / 5 are neuronal markers, and immunofluorescence staining was used to identify neuronal differentiation in different types of organoids.

[0196] The results of immunofluorescence staining of PAX7 and PAX2 in dorsal medulla organoids (hdMO), thalamic organoids (hThO), and cortical organoids (hCO) are shown in Figure 1B The small white box in the left middle of the left image (hdMO) indicates the distribution of PAX7 and PAX2 in this area, and is magnified on the right.

[0197] from Figure 1B It can be seen that PAX7 and PAX2-positive cells specific to the dorsal hindbrain are enriched in the dorsal medulla organoids (hdMO) constructed from H9 embryonic stem cells, while these cells are less produced in thalamic organoids (hThO) and cortical organoids (hCO).

[0198] The results of immunofluorescence staining for LHX1 / 5 and PAX2 in dorsal medulla organoids (hdMO), thalamic organoids (hThO), and cortical organoids (hCO) are shown in Figure 1CThe area marked by the small white box in the figure is magnified on the right side of the hdMO staining result.

[0199] from Figure 1C It can be seen that dorsal medulla organoids (hdMO) constructed from H9 embryonic stem cells enriched with LHX1 / 5 and PAX2-positive cells specific to the dorsal hindbrain, while these cells were less abundant in thalamic organoids (hThO) and cortical organoids (hCO).

[0200] After 30 days of culture, the quantitative staining results of cell types in dorsal medulla organoids, thalamic organoids, and cortical organoids are shown in Figure 1D .

[0201] from Figure 1D It can be seen that compared with thalamic organoids (hThO) and cortical organoids (hCO), dorsal medulla organoids (hdMO) are enriched with a large number of PAX2 and LMX1B positive cells, proving their differentiated brain region characteristics.

[0202] 1.2.2 Single-cell transcriptional analysis

[0203] 1) Collect hdMO samples at day 30 and day 62 and prepare single cells: Pool 6-8 hdMO samples from the same stage, centrifuge, and remove the culture medium. Add 1 mL of Dispase and cut the organoid sample into fragments with scissors. Incubate the suspension at 37°C in a metal bath for 30 minutes. Centrifuge the suspension at 500g for 5 minutes, remove the supernatant, add 1 mL of trypsin, and continue digestion at 37°C for 15-30 minutes. After complete digestion, pass the cells through a 40μm sieve and wash them 2-3 times with DPBS containing 10% BSA. As a quality control for single-cell sequencing, cell viability should be above 80%.

[0204] 2) Single-cell sequencing was performed using the 10X Genomics platform. Single-cell suspensions were loaded onto the 10X Chromium single-cell platform at a concentration of 1000 cells per microliter according to the 10X Genomics instructions. The kit used was the Single Cell 3' Library V3.

[0205] 3) After forming a gel bead suspension (GEM), the GEM was collected and reverse transcribed. Subsequently, the GEM was degreased, and the cDNA was purified using magnetic beads and quality-checked. After library construction, the cDNA was sequenced on an Illumina Novaseq 6000 sequencer using a 150-base-pair end-read sequencing strategy.

[0206] Single cells were sequenced at 30 and 62 days and clustered based on transcriptional differences.

[0207] Single-cell transcriptome analysis, the results are shown in Figure 1E The upper right side shows the cluster analysis results of 30 days and 62 days respectively.

[0208] from Figure 1E It was found that excitatory neurons and inhibitory neurons were generated in dorsal medullary organoids (hdMOs).

[0209] Furthermore, the cell clustering results (NPC, IP, IM, InN and ExN) obtained from single-cell transcription of dorsal medulla organoids (hdMO) were compared with the transcriptome data of human brain tissues (medulla oblongata, midbrain, diencephalon, telencephalon, cerebrum, head, forebrain, cerebellum, pons and hindbrain) and displayed in the form of a heat map. The comparison results are shown in Figure 1F . Figure 1F In the figure, NPCs are neural progenitor cells, InNs are inhibitory neurons, IMs are immature neurons, IPs are intermediate progenitors, and ExNs are excitatory neurons.

[0210] from Figure 1F It can be seen that the dorsal medulla organoids (hdMO) have the highest similarity with the medulla oblongata region compared with different regions of the human brain.

[0211] Furthermore, the cell types (NPC, IP, IM, InN and ExN) derived from single-cell transcription of dorsal medullary organoids (hdMO) were compared with the transcriptome data of each medullary nucleus and displayed in the form of a heat map. The comparison results are shown in Figure 1G . Figure 1G In the figure, Spv is the spinal trigeminal nucleus, 8Ve is the vestibular nuclei, 10 is the dorsal motor nucleus of the vagus, 12 is the hypoglossal nucleus, 10 is the inferior olivary complex, RaM is the raphe nuclei of medulla, MeRF is the medullary reticular formation, Gr is the gracile nucleus, Cu is the cuneate nucleus, Arc is the arcuate nucleus of medulla, 8Co is the cochlear nuclei, and CGS is the central glial substance.

[0212] from Figure 1G It can be seen that the dorsal medullary organoids (hdMO) have the highest similarity with the spinal trigeminal nucleus (SpV) in the medulla oblongata.

[0213] In summary, the dorsal medullary organoid construction method of the present application is stable.

[0214] Example 2 Differentiation of other stem cells into dorsal medullary organoids

[0215] In Example 2, H1 embryonic stem cells and iPSC cell lines RC01001A and RC01001B were differentiated into dorsal medullary organoids in vitro and characterized. The steps included:

[0216] 2.1. Differentiation of H1 embryonic stem cells (H1 hESC) and iPSC cell lines RC01001A and RC01001B

[0217] 1) Culture H1 embryonic stem cells and iPSC cell lines RC01001A and RC01001B in 6-well plates. When cells reach 70-90% confluence, begin digestion for induction and differentiation. The specific steps for digestion of embryonic stem cells are as follows:

[0218] 1-1) Day 0: Differentiated stem cells were removed under a microscope, the culture medium was removed, and each cell was washed once with 1 mL of 1× PBS. 1 mL of Accutase (Stemcell) was added to each well of a 6-well plate and incubated at 37°C for 10 minutes to fully digest and dissociate into single cells.

[0219] 1-2) Transfer the single cell to a centrifuge tube containing 1 mL of mTeSR plus medium and centrifuge at 1200 rpm for 3 minutes.

[0220] 1-3) Remove the supernatant and resuspend the pelleted cells in 1 mL of mTeSR plus medium to a single-cell suspension. Count the cells. Then, dilute the cells with Induction Medium I to a concentration of 10,000 cells / mL (i.e., 1,500 cells / 150 μL of medium).

[0221] 1-4) Add 150 μL of the diluted cell suspension from step 1-3) to each well of an ultra-low attachment 96-well plate, and incubate the plate at 37° C. under 5% CO 2 . This is day 0.

[0222] 2) On Day 2, if there are few spheroids in the interference wells, aspirate all the culture medium from each well. Add 150 μL of Induction Medium II to each well, using freshly prepared RA. Continue incubation at 37°C, 5% CO2.

[0223] Subsequently, on the 4th and 6th days, 75 μL of culture medium was removed from each well, and 75 μL of induction medium II was added to each well to replace the medium.

[0224] From day 2 to day 8, except for changing the medium, the cells were cultured statically at 37°C and 5% CO2 to obtain embryoid bodies.

[0225] 3) On Day 8, use a 5 mL pipette or other plastic pipette to transfer the EBs from the 96-well plate to a low-adhesion 6-well plate, taking care not to damage the EBs. Typically, 6-8 EBs can be cultured per well of a low-adhesion 6-well plate. Aspirate the medium from the low-adhesion 6-well plate and add 2.5 mL of Differentiation Medium I to each well.

[0226] On day 10, the culture medium in each well was removed by aspiration, and 2.5 mL of differentiation medium I was added to each well.

[0227] From day 8 to day 12, differentiation culture was carried out at 37°C, 5% CO2, on a horizontal shaker (80 rpm).

[0228] 4) On Day 12, aspirate the culture medium from each well and add 2.5 mL of Differentiation Medium II to each well to continue differentiation. Add Matrigel immediately after use. After changing the medium, shake the sample to distribute it evenly to prevent sticking caused by the Matrigel.

[0229] On day 14, the culture medium in each well was removed by aspiration, and 2.5 mL of differentiation medium II was added to each well.

[0230] From day 12 to day 16, the cells were cultured at 37°C, 5% CO2, and on a horizontal shaker (80 rpm).

[0231] 5) On day 16, aspirate the culture medium from each well and add 2.5 mL of differentiation medium III to each well to continue maintenance culture to achieve long-term culture.

[0232] From the 16th day to the 30th day, the medium was completely changed every two days.

[0233] After day 30, the medium is fully replaced every 3-4 days. Organoids can be cultured long-term under these conditions.

[0234] During the differentiation culture period, the cells were cultured at 37°C, 5% CO2, and on a horizontal shaker (80 rpm).

[0235] 2.2 Identification

[0236] 2.2.1 Immunofluorescence staining

[0237] The steps of immunofluorescence staining identification are the same as step 1.2.1 in Example 1, except that:

[0238] The primary antibodies used for H1 hESC, hiPSC RC01001A and hiPSC RC01001B were Anti-SOX2 (CellSignaling, 3579), Anti-SOX10 (R&D, MAB2864), Anti-PHOX2B (Santa Cruz, sc-376997), Anti-NKX2-2 (Abcam, ab191077), Anti-OLIG3 (R&D, MAB2456), Anti-PAX7 (Abcam, ab221549), and Anti-PAX2 (Abcam, ab150391).

[0239] The SOX2 transcription factor is involved in the regulatory network of embryonic stem cell pluripotency, so its expression level is high in embryonic stem cells; at the same time, SOX2 is also a marker molecule for neural stem cells / progenitor cells.

[0240] The results of immunofluorescence staining for SOX2, SOX10, PHOX2B, NKX2-2, and OLIG3 in dorsal medullary organoids differentiated from H1 hESCs are shown in Figure 2A .

[0241] The results of immunofluorescence staining for PAX7 and PAX2 in H1 hESC-differentiated dorsal medulla organoids are shown in Figure 2B .

[0242] from Figure 2A and 2B It was found that dorsal medulla organoids derived from H1 embryonic stem cells (H1 hESCs) did not produce SOX10-positive peripheral lineage cells, PHOX2B- and NKX2-2-positive ventral lineage cells, or OLIG3-positive dorsal A-type neuronal subpopulation cells. However, like dorsal medulla organoids derived from H9 embryonic stem cells, they enriched for PAX7- and PAX2-positive B-type neuronal subpopulation cells originating from the dorsal hindbrain.

[0243] The dorsal medulla oblongata region can be further divided into subpopulations A and B. Subpopulation A consists of OLIG3-positive cells, while subpopulation B consists of PAX7-positive cells. Subpopulation B further includes regions dB1, dB2, dB3, and dB4. dB1 develops into dBLa (PAX2 and LHX1 / 5-positive) and dBLB (LMX1B-positive). The spinal trigeminal nucleus develops from dBLa and dBLB, which give rise to the inhibitory and excitatory components of the spinal trigeminal nucleus, respectively.

[0244] The results of immunofluorescence staining for SOX2, SOX10, PHOX2B, NKX2-2, and OLIG3 in dorsal medullary organoids differentiated from hiPSC RC01001A are shown in Figure 2C .

[0245] The results of immunofluorescence staining of PAX7 and PAX2 in dorsal medullary organoids differentiated from hiPSC RC01001A are shown in Figure 2D .

[0246] from Figure 2C and 2D Dorsal medulla organoids constructed from hiPSC RC01001A showed no SOX10-positive peripheral lineage cells, PHOX2B- and NKX2-2-positive ventral lineage cells, or OLIG3-positive cells of the dorsal A neural subpopulation. However, like dorsal medulla organoids constructed from H9 embryonic stem cells, they enriched for PAX7- and PAX2-positive cells of dorsal hindbrain origin.

[0247] The results of immunofluorescence staining for SOX2, SOX10, PHOX2B, NKX2-2, and OLIG3 in dorsal medullary organoids differentiated from hiPSC RC01001B are shown in Figure 2E .

[0248] The results of immunofluorescence staining of PAX7 and PAX2 in dorsal medullary organoids differentiated from hiPSC RC01001B are shown in Figure 2F .

[0249] from Figure 2E and 2F Dorsal medulla organoids constructed from hiPSC RC01001B showed no SOX10-positive peripheral lineage cells, PHOX2B- and NKX2-2-positive ventral lineage cells, or OLIG3-positive cells of the dorsal A neural subpopulation. However, like dorsal medulla organoids constructed from H9 embryonic stem cells, they enriched for PAX7- and PAX2-positive cells of dorsal hindbrain origin.

[0250] The results of immunofluorescence staining for PAX7 and LMX1B in dorsal medulla organoids differentiated from H1 hESCs, hiPSC RC01001A, and hiPSC RC01001B are shown in Figure 2G .

[0251] from Figure 2GIt can be seen that PAX7 and LMX1B-positive cells are enriched in the dorsal medulla organoids constructed from H1 embryonic stem cells, hiPSC RC01001A induced pluripotent stem cells, and hiPSC RC01001B, which is similar to the differentiation effect of H9 embryonic stem cells.

[0252] 2.2.2 Identification of HOX gene expression

[0253] After neural tube closure, the hindbrain gradually divides into eight segments along the anterior-posterior axis, forming the rhombomeres (r1-r8), with r8 lacking a clear boundary with the spinal cord (sc). To further understand the pattern of brain organization, the HOX gene family (HOXB2, HOXB3, HOXB4, HOXB5, and HOXB6) was analyzed. The expression patterns of the HOX gene family can be used to determine the distribution of neural tissue along the anterior-posterior axis of the neural tube. HOX genes are a highly evolutionarily conserved class of genes. As master regulators of growth, development, and cell differentiation in vertebrates, they play important roles in the development of the central nervous system, axial skeleton, gastrointestinal tract, urogenital duct, external genitalia, and limbs. These genes are clustered on different chromosomes and serve as regulatory genes that control embryonic development and cell differentiation.

[0254] 1) Organoid samples were collected on day 30 and RNA was prepared using the FastPure Cell / Tissue Total RNA Extraction Kit (Vazyme) according to the instructions. 300 ng of total RNA was used to prepare cDNA using the HiScript III All-in-One RT Supper Mix Perfect Kit (Vazyme).

[0255] 2) PCR was performed using Taq Pro Universal SYBR qPCR Master Mix (Vazyme) in a QuantStudio™ real-time PCR instrument. Reaction conditions were: 95°C for 2 min, and 40 cycles of a two-step reaction (95°C for 15 sec, 60°C for 30 sec).

[0256] 3) PCR primer information is as follows:

[0257] HOXB2 forward:CGCCAGGATTCACCTTTCCTT(SEQ ID No.1)

[0258] HOXB2 reverse:CCCTGTAGGCTAGGGGAGAG(SEQ ID No.2)

[0259] HOXB3 forward:CCAGTGCCACTAGCAACAG(SEQ ID No.3)

[0260] HOXB3 reverse:CGTTTGCCTCGACTCTTTCATC(SEQ ID No.4)

[0261] HOXB4 forward:CGTGAGCACGGTAAACCCC(SEQ ID No.5)

[0262] HOXB4 reverse:CGAGCGGATCTTGGTGTTG(SEQ ID No.6)

[0263] HOXB5 forward:AACTCCTTCTCGGGGCGTTAT(SEQ ID No.7)

[0264] HOXB5 reverse:CATCCATTGTAATTGTAGCCGT(SEQ ID No.8)

[0265] HOXB6 forward:GTGCTCCACTCCGGTCTAC(SEQ ID No.9)

[0266] HOXB6 reverse:GTAACGTGTGTATGTCTGGCG(SEQ ID No.10)

[0267] The results of HOX gene expression (HOXB2, HOXB3, HOXB4, HOXB5, HOXB6) in dorsal medullary organoids hdMOs-H9 hESCs, hdMOs-H1 hESCs, hdMOs-hiPSC RC01001A, and hdMOs-hiPSCRC01001B constructed from H9 embryonic stem cells, H1 embryonic stem cells, hiPSC RC01001A, and hiPSC RC01001B, respectively, are shown in Figure 2H . Figure 2H In the figure, r4-, r5-, r7-, and r8- represent rhombomere; sc represents the spinal cord.

[0268] At the same time, embryonic stem cells (hESCs), thalamic organoids (hThOs), and cortical organoids (hCOs) were used as control groups.

[0269] from Figure 2H The dorsal medulla organoids constructed from the four pluripotent stem cell lines all exhibited similar HOX gene expression patterns. With the reversal of distribution from r4 to r8 rhombomeres, HOX gene expression levels gradually decreased, indicating similar anterior-posterior localization of the neural tube. These genes were not expressed in cortical organoids, thalamic organoids, or embryonic stem cells.

[0270] The lack of HOXB6 expression indicates that the organoids constructed in this application are in the posterior stage of the hindbrain but have not entered the spinal cord stage.

[0271] In summary, the dorsal medullary organoid construction method of the present application is stable.

[0272] Example 3 Air-Liquid Interface Culture of Dorsal Medullary Organoids

[0273] 3.1 Air-liquid interface culture

[0274] When the organoids from step 1.1 of Example 1 are maintained in culture for 25 days, in addition to continuing suspension culture on a horizontal shaker, air-liquid interface culture can also be performed. The specific steps for air-liquid interface culture are as follows:

[0275] Without disturbing the organoid structure, collect 3-6 organoids using a plastic pipette and transfer them to a plastic embedding cassette.

[0276] Prepare 3% low-melting-point agarose in a 50 mL centrifuge tube: add 0.24 g of low-melting-point agarose to 8 mL of DMEM / F12 or 1X PBS and heat in a microwave to dissolve.

[0277] Aspirate the culture medium from the embedding cassette and use a 1 mL pipette tip to pipette low-melting-point agarose into the cassette, completely covering the organoids. Adjust the organoid to the center of the cassette. Wait approximately 3 minutes for the agarose to completely solidify.

[0278] Organoid slices were prepared using a Leica VT1200S, and 300 μm slices were prepared.

[0279] Add 2 mL of Differentiation Medium III to each well of a 6-well plate. Transfer the organoid slices to the 6-well plate. After transfer, aspirate the medium in the wells and replace with fresh Differentiation Medium III.

[0280] Transfer the organoid slices to 3.0 μm pore size cell embedding dishes, placing 6-8 organoid slices per dish. Use a pipette tip to separate the organoids at a certain distance. After the operation, aspirate the excess culture medium in the embedding dish.

[0281] Add 1.5 mL of differentiation medium III to the bottom of the insert dish and incubate the dish at 37°C in 5% CO2 for 1 day.

[0282] From the next day, the culture dish was placed on a horizontal shaker at 37°C and 5% CO2 and culture was continued (80 rpm). Thereafter, the culture medium was replaced every 2 days.

[0283] 3.2 Identification

[0284] 3.2.1. Neuron, Axon, and Dendrite Analysis

[0285] Neurons are the fundamental structural and functional units of the nervous system. They possess a complex, specialized morphology, typically consisting of dendrites and axons. Neurons are highly polarized, collecting information from upstream neurons or the environment through their dendritic branches. Axons then transmit this integrated information via synapses to downstream neurons or non-neuronal cells (such as muscle cells) as electrical or chemical signals. This is a crucial information transmission process within organisms.

[0286] LMX1B is a marker for excitatory neurons in the trigeminal nucleus of the dorsal medulla; PAX2 is a marker for inhibitory neurons in the trigeminal nucleus of the dorsal medulla; MAP2 (microtubule-associated protein 2) is often used as a dendritic marker because it is present in the cell bodies and dendrites of neurons but not in axons; NF is often used as an axonal marker because it is present in the axons of neurons.

[0287] Immunofluorescence staining was performed on organoid samples cultured in air-liquid interaction as described in step 1.2.1 using the method of Example 1. The differences were that the primary antibodies used also included Anti-NF (Abcam, ab7795), Anti-NF (Millipore, AB1989), Anti-MAP2 (Millipore, MAB3418), and Anti-MAP2 (Abcam, ab183830).

[0288] Figure 3A This image shows a dorsal medulla organoid containing numerous LMX1B- and PAX2-positive neurons after long-term culture at the air-liquid interface, i.e., day 87. (a) represents the central region of the organoid and its corresponding magnified image; (b) represents the peripheral region of the organoid and its corresponding magnified image.

[0289] Figure 3B It was shown that when the organoids were cultured at the air-liquid interface for a long time until 5 months (163), a large number of neuronal axons (NF) and dendrites (MAP2) were observed.

[0290] 3.2.2 MEA analysis

[0291] Organoid slices cultured for 60 days were detached from the cell embedding dish and placed back in the embedding dish for 4-6 hours. Subsequently, the organoid slices were transferred to a multi-electrode array (MEA) in a 6-well plate, and a small amount of differentiation medium III was added to cover the organoid slices. Electrophysiological signals were recorded using the Maestro Pro MEA system (Axion Biosystems). Electrode signals were analyzed using the Neural Metric Tool (Axion Software), and neuronal discharge waveforms were analyzed using Plexion Offline Sorter software.

[0292] Figure 3C Schematic diagram of the functional analysis of dorsal medullary organoids using MEA.

[0293] Figure 3D The upper middle image shows that the MEA electrode array can detect spontaneous electrophysiological signals in organoids, and the lower image shows the electrophysiological signals detected by a single electrode.

[0294] In summary, dorsal medulla organoids can form neurons, axons and dendrites, and generate electrophysiological signals, indicating that they can differentiate and mature healthily and over the long term and can establish neuronal functions.

[0295] Example 4 Preparation of organoid assemblies (dorsal medulla oblongata-thalamus fusion organoids)

[0296] In this Example 4, a dorsal medulla and thalamus fusion organoid was used to construct an organoid assembly (dorsal medulla-thalamus fusion organoid), including the following:

[0297] 4.1 Preparation of Dorsal Medulla-Thalamus Fusion Organoids

[0298] 1) Following the procedures of Example 3, 25-day dorsal medullary organoids were collected and 300 μm dorsal medullary organoid (hdMO) slices were prepared. Simultaneously, thalamic organoids were prepared according to the previously reported references 1 and 2, and 300 μm thalamic organoid (hThO) slices were prepared according to the procedures of Example 3 of the present invention.

[0299] Document 1: Xiang, Y., et al., hESC-Derived Thalamic Organoids Form ReciprocalProjections When Fused with Cortical Organoids. Cell Stem Cell, 2019.24(3):p.487-497e7.

[0300] Document 2: Xiang, Y., B. Cakir, and IH Park, Generation of RegionallySpecified Human Brain Organoids Resembling Thalamus Development. STAR Protoc, 2020.1(1).

[0301] 2) Transfer one dorsal medulla organoid slice and one thalamus organoid slice to a 3.0 μm pore size cell embedding dish. Use a 200 μL pipette tip to aspirate the culture medium surrounding the organoids. Move the organoid slices so that the dorsal medulla organoid slice and the thalamus organoid slice are placed next to each other.

[0302] 3) Add 1.5 mL of Differentiation Medium III to each well along the bottom of the embedding dish.

[0303] 4) Place the culture dish at 37°C and 5% CO2 for 1 day.

[0304] 5) After 2 days, place the culture dish on a horizontal shaker at 37°C and 5% CO2 and continue culturing (80 rpm). The culture medium was changed every 2 days.

[0305] After 3 days of culture, organoid assemblies, namely dorsal medulla oblongata-thalamus fusion organoids (hMTOs), were obtained.

[0306] Figure 4A The connection between the spinal trigeminal nucleus and the thalamus in the medulla oblongata of the human brain (left) and the bright field image of the fusion of dorsal medulla organoids enriched in the spinal trigeminal nucleus and thalamic organoids (right).

[0307] from Figure 4A It can be seen that the organoid assembly shows a good co-developmental state.

[0308] 4.2 Identification

[0309] Figure 4B Fluorescence imaging of dorsal medulla-thalamus fusion organoids or tissue samples, including dorsal medulla organoids (hdMOs) expressing mCherry fluorescence. These hdMOs were differentiated from H9 hESCs expressing mCherry fluorescence and then cultured adjacent to non-fluorescent hThO to generate dorsal medulla-thalamus fusion organoids.

[0310] from Figure 4B It can be seen that there are a large number of neuronal projections derived from dorsal medullary organoids (hdMO) on the thalamic organoid side (hThO).

[0311] Figure 4CThe figure shows fluorescence images of thalamic organoids labeled with GFP (hThO-GFP) and dorsal medulla oblongata organoids labeled with mCherry (hdMO-mCherry), which were then assembled. Arrows in the figure represent neuronal axonal projections.

[0312] from Figure 4C It can be seen that there are neuronal projections in the thalamic organoids labeled with GFP (hThO-GFP); the dorsal medulla organoids labeled with mCherry (hdMO-mCherry); and the organoid assembly after double fluorescent labeling (hThO-GFP hdMO-mCherry), which mainly project from the dorsal medulla to the thalamus; while conversely, there are fewer projections from the thalamus to the dorsal medulla.

[0313] Immunofluorescence staining was performed on organoid assemblies (hMTO) using the method described in step 1.2.1 of Example 1. The primary antibodies used were Anti-PAX2 (Abcam, ab150391), Anti-LMX1B (Sigma-Aldrich, HPA073716), and Anti-TCF7L2 (Cell Signaling, 2569T).

[0314] Figure 4D Shown are the staining results for region-specific markers in organoid assemblies (hMTOs).

[0315] from Figure 4D It can be seen that the dorsal medulla oblongata region (hdMO) is enriched with PAX2 and LMX1B-positive cells related to the spinal trigeminal nucleus (the same as the results of immunofluorescence staining in Example 2); the thalamus region (hThO) is enriched with human transcription factor 7-like protein 2 (TCF7L2)-positive cells, indicating that the organoid assembly maintains good dorsal medulla oblongata and thalamus region identity.

[0316] In summary, the organoid assembly of the present application simulates the neural projection connection between the spinal trigeminal nucleus and the thalamus in vitro by fusing the dorsal medulla organoid with the thalamic organoid.

[0317] Comparative Examples 1-3

[0318] The difference between Comparative Example 1 and Example 1 is that when changing the medium on the 6th day, induction culture medium II without adding CHIR99021 and retinoic acid was used, and differentiation culture medium I and II without adding CHIR99021 were used in subsequent cultures; the rest were the same as Example 1.

[0319] The difference between Comparative Example 2 and Example 1 is that when changing the medium on the 6th day, induction culture medium II without adding CHIR99021 was used, and differentiation culture medium I and II without adding CHIR99021 were used in subsequent cultures; the rest were the same as Example 1.

[0320] The difference between Comparative Example 3 and Example 1 is that when the medium was changed on the 6th day, induction culture medium II without adding CHIR99021 was used, and retinoic acid was added only to the induction culture medium II used for the medium change on the 6th day, and differentiation culture medium I and II without adding CHIR99021 were used in subsequent cultures; the rest were the same as in Example 1.

[0321] The cells from Comparative Examples 1-3 and Examples were cultured for 30 days, and RNA was prepared using the FastPure Cell / Tissue Total RNA Extraction Kit (Vazyme) according to the instructions. Libraries were prepared using the TruSeq Stranded mRNA LT Kit and sequenced on an Illumina HiSeq platform.

[0322] The transcriptome sequencing results of Comparative Examples 1-3 and Example 1 were analyzed by comparing the expression levels of dorsal-specific genes in the samples (ie, dorsal signals) using heat map analysis. The results are shown in Figure 5A .

[0323] The dorsal-specific genes mainly include PAX3, ATOH1, MSX1, PAX7, ASCL1, PAX6, GSX2, LHX2, LHX9, LHX5, TLX3, LBX1, LMX1B, PAX2, LHX1, etc.

[0324] Figure 5A These are the analysis results of the dorsal transcriptional characteristics of the organoids of Comparative Examples 1-3 and Example 1.

[0325] from Figure 5A It can be seen that compared with Comparative Examples 1 and 2, Example 1 and Comparative Example 3 have dorsal neural tube signals, indicating that the emergence of dorsal neural tube signals depends on a suitable combination of retinoic acid signals and WNT signals.

[0326] Furthermore, based on the transcriptome sequencing analysis results, the gene expression of organoids and dorsal subpopulations in Comparative Examples 1-3 and Example 1 was analyzed using a heat map. The results are shown in Figure 5B .

[0327] from Figure 5B It can be seen that compared with Comparative Examples 1-3, the organoid of Example 1 is highly similar to dB1 of the Class B subpopulation, and further highly similar to dBLa and dBLB in dB1.

[0328] In summary, the composition of the present application can induce differentiated brain organoids to have a dorsal neural tube identity.

[0329] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and substitutions can be made without departing from the technical principles of the present invention. These improvements and substitutions should also be regarded as the scope of protection of the present invention.

Claims

1. A composition for preparing brain organoids, characterized in that Includes any one or more of the following culture media: Induction medium I: including DMEM / F12 medium, serum replacement, non-essential amino acids, glutamine or GlutaMax, β-mercaptoethanol, ROCK inhibitor, BMP signaling pathway inhibitor, TGF-β signaling pathway inhibitor, WNT signaling pathway activator; Induction medium II: including DMEM / F12 basal medium, serum replacement, non-essential amino acids, glutamine or GlutaMax, β-mercaptoethanol, BMP signaling pathway inhibitor, TGF-β signaling pathway inhibitor, WNT signaling pathway activator, retinoic acid signaling agonist; Differentiation medium I: includes Neurobasal basal medium, DMEM / F12 medium, insulin, glutamine or GlutaMax, non-essential amino acids, antibiotics, N2 supplement, B27 supplement, β-mercaptoethanol, WNT signaling pathway activator, epidermal growth factor, and nerve growth factor; Differentiation medium II: includes Neurobasal medium, DMEM / F12 basal medium, insulin, glutamine or GlutaMax, non-essential amino acids, antibiotics, N2 supplement, B27 supplement, β-mercaptoethanol, WNT signaling pathway activator, epidermal growth factor, nerve growth factor, and Matrigel.

2. The composition according to claim 1, wherein The ROCK inhibitor is Y27632; and / or, the BMP signaling pathway inhibitor is LDN193189; and / or, the TGF-β signaling pathway inhibitor is SB431542; and / or, the WNT signaling pathway activator is CHIR99021; and / or, the retinoic acid signaling agonist is retinoic acid; And / or, the antibiotic is penicillin and / or streptomycin.

3. The composition according to claim 2, wherein The composition comprises at least one of A1) to A4): A1) The induction culture medium I comprises DMEM / F12 medium and the following components based on the volume of the DMEM / F12 medium: A2) The induction culture medium II comprises DMEM / F12 medium and the following components based on the volume of the DMEM / F12 medium: A3) The differentiation culture medium I comprises a basal medium prepared by mixing Neurobasal medium and DMEM / F12 medium in an equal volume ratio of 1:1, and the following components based on the volume of the basal medium: A3) The differentiation medium II comprises a basal medium prepared by mixing Neurobasal medium and DMEM / F12 medium in an equal volume ratio of 1:1, and the following components based on the volume of the basal medium:

4. Use of the composition according to any one of claims 1 to 3 in the preparation of brain organoids.

5. A method for preparing brain organoids, characterized in that: The method comprises the following steps: pluripotent stem cells are induced and differentiated using the composition according to any one of claims 1 to 3 to obtain the brain organoids.

6. The preparation method according to claim 5, wherein The pluripotent stem cells are selected from at least one of embryonic stem cells and induced pluripotent stem cells; And / or, the induction culture conditions are 28-40° C. and 3-6% CO 2 ; and / or, the differentiation culture conditions are 28-40° C. and 3-6% CO 2 ; And / or, the induced culture is suspension culture; And / or, the induced culture is static culture; And / or, the differentiation culture is a suspension culture or an air-liquid interface culture; and / or, the differentiation culture is performed under shaking conditions; and / or, further comprising maintenance culture, wherein the maintenance culture is performed in differentiation culture medium III; And / or, the method comprises the following steps: 1) inducing and culturing the pluripotent stem cells in the induction culture medium I and the induction culture medium II in sequence to obtain embryoid bodies; 2) Differentiating and culturing the embryoid bodies in the differentiation culture medium I and the differentiation culture medium II in sequence to obtain the brain organoids.

7. The preparation method according to claim 6, wherein The embryonic stem cells are selected from at least one of H9 embryonic stem cells and H1 embryonic stem cells; And / or, the induced pluripotent stem cells are selected from at least one of RC01001A and RC01001B; and / or, the differentiation culture medium III comprises Neurobasal medium, DMEM / F12 basal medium, insulin, glutamine or GlutaMax, non-essential amino acids, antibiotics, N2 additive, B27 additive, β-mercaptoethanol, brain-derived neurotrophic factor, and ascorbic acid; And / or, the maintenance culture is suspension culture or air-liquid interface culture.

8. The preparation method according to claim 6, wherein Include at least one of the following: 1), the pluripotent stem cell is a single cell; 1), the induction culture time in the induction culture medium I is 1 to 4 days; preferably, 2 days; 1), the induction culture time in the induction culture medium II is 5 to 8 days; preferably, 6 days; 2), the differentiation culture time in the differentiation culture medium I is 1 to 6 days; preferably, 4 days; 2), the differentiation culture time in the differentiation culture medium II is 1 to 6 days; preferably, 4 days; The maintenance culture time is 9 to 100 days.

9. Brain organoids obtained by the preparation method according to any one of claims 5 to 8.

10. An organoid assembly, characterized in that: The method comprises a first organoid and a second organoid, wherein the first organoid comprises the brain organoid according to claim 9; preferably, the second organoid comprises at least one of a thalamic organoid, a cortical organoid, a ventral telencephalic organoid, a midbrain organoid, a cerebellar organoid and a spinal cord organoid.

11. The method for preparing an organoid assembly according to claim 10, wherein: The slices of the first organoid and the slices of the second organoid are placed adjacent to each other and cultured using an air-liquid interface culture method to obtain the organoid assembly.

12. Use of the brain organoid according to claim 9 or the organoid assembly according to claim 10 in at least one of the following: 1) In vitro models for preparing brain organoids; 2) Used to study the developmental mechanisms and / or functions of nerves; 3) For the preparation of diagnostic or therapeutic drugs for neurological diseases; 4) Used for screening, drug testing, evaluation or quality control of drugs for the prevention, diagnosis or treatment of neurological diseases.

Images