A recombinant microorganism with high yield of l-tryptophan, and a construction method and application thereof
By overexpressing the ppsA and trpEfbrD genes in Klebsiella strains, the byproduct synthesis pathway was inactivated, the L-tryptophan synthesis flux was enhanced, and an efficient L-tryptophan production strain was constructed. This solved the problem of insufficient L-tryptophan yield and efficiency in existing technologies, and enabled efficient and low-cost L-tryptophan fermentation production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI RECOM BIOTECHNOLOGY CO LTD
- Filing Date
- 2025-04-29
- Publication Date
- 2026-07-07
AI Technical Summary
Existing microbial fermentation methods still have room for improvement in terms of L-tryptophan yield and efficiency. Traditional chemical synthesis methods suffer from high production costs and environmental pollution. Current genetic engineering methods have not yet been able to fully improve the production efficiency of L-tryptophan.
By selecting Klebsiella strains, overexpressing the phosphoenolpyruvate synthase gene ppsA and the tryptophan operon partial gene cluster trpEfbrD, inactivating enzyme genes in the byproduct synthesis pathway, enhancing genes related to L-tryptophan synthesis flux, and redirecting intracellular pyruvate synthesis metabolism to L-tryptophan production, a highly efficient L-tryptophan-producing strain was constructed.
Under optimized fermentation conditions, the recombinant strain can efficiently produce L-tryptophan with a yield of 60 g/L and a recovery rate of 0.23 g/g. The culture medium is simple, the fermentation cost is low, and the product has a single composition and is easy to separate.
Smart Images

Figure CN120683027B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of metabolic engineering technology, specifically relating to a recombinant microorganism that produces high levels of L-tryptophan, its construction method, and its application. Background Technology
[0002] Tryptophan (L-Trp), also known as D,L-α-amino-β-indolepropionic acid, is an aromatic amino acid with the molecular formula C2. 11 H 12 O2N2 has a relative molecular mass of 204.21. Tryptophan has three isomers: L-form, D-form, and racemic DL-form. The levorotatory optical isomer, L-Trp, is biologically active and is one of the essential amino acids for the human body. L-Trp is a white crystal or crystalline powder at room temperature, odorless, with a melting point of 289℃. Its solubility in water at room temperature is 11.4 g / L, slightly soluble in ethanol, insoluble in chloroform, and relatively stable in alkaline solutions.
[0003] Tryptophan is an important precursor in the biosynthesis of auxin in plants. Its structure is similar to IAA (indole-3-acetic acid), and it is widely found in higher plants. As one of the eight essential amino acids, L-tryptophan cannot be synthesized in mammals and must be obtained from external sources. Therefore, L-tryptophan is widely used in various fields of the food, pharmaceutical, and feed industries. In the food industry, L-tryptophan is used as a nutritional supplement, food fortifier, and preservative. Furthermore, L-tryptophan can serve as a precursor in the fermentation production of the food coloring indigo. In the pharmaceutical industry, L-tryptophan is commonly used in health products, biopharmaceuticals, and pharmaceutical raw materials. Additionally, as a precursor to the neurotransmitters serotonin and melatonin, L-tryptophan is used to synthesize antidepressants and sedatives. In the feed industry, L-tryptophan is used as a feed additive, playing a positive role in many aspects of growth, production, nutritional metabolism, and immunity in poultry and livestock. Currently, the market demand for L-tryptophan exceeds 28,000 tons per year, and the market size continues to expand. However, relatively outdated production technology results in high production costs and low yields for L-tryptophan, thus limiting its larger-scale application.
[0004] In traditional industrial production, L-tryptophan fermentation methods are mainly divided into chemical synthesis and protein hydrolysis. However, this method of producing L-tryptophan through chemical synthesis has many drawbacks, such as high production costs, demanding process conditions, and environmental pollution. With the development of gene recombination technology and the continuous analysis of metabolic networks in model organisms, the use of genetic engineering to modify microorganisms to synthesize L-tryptophan has attracted widespread attention.
[0005] Escherichia coli is currently the main strain for producing L-tryptophan by fermentation. With the continuous development of metabolic engineering technology, the yield and efficiency of L-tryptophan production by microbial fermentation have been continuously improved. Based on the mutagenized strain E. coli TRP0, Guo et al. obtained the recombinant strain E. coli TRP12 by metabolic engineering methods such as relieving negative feedback effect, strengthening tryptophan transport and enhancing precursor supply. After fermentation in a 5L tank, the L-tryptophan concentration reached 52.1 g / L and the conversion rate reached 0.171 g / g (Guo L et al., Biotechnol Bioeng., 2022, 119(3):983-993). Based on tryptophan-producing strains, Xiong et al. increased precursor supply by introducing a phosphoryl ketonease pathway, a non-PTS system, and an oxaloacetate carboxylkinase pathway. In a 5L fermenter, the recombinant strain they constructed achieved an L-tryptophan conversion rate of 0.227 g / g (Xiong Bet al., Biotechnol Bioeng., 2021, 118(3):1393-1404). Furthermore, Corynebacterium glutamicum has also been developed for L-tryptophan production. Dong et al. engineered C. glutamicum through systems metabolic engineering, including enhancing the L-tryptophan biosynthetic pathway, reprogramming central metabolic flux, identifying metabolic bottlenecks, enhancing transport systems and precursor supply, and inhibiting competitive pathways. The resulting recombinant strain achieved an L-tryptophan accumulation of 16.2 g / L in shake-flask fermentation, with a conversion rate of 0.160 g / g (Dong YF et al., BioRxiv., 2024, 11.04.621991).
[0006] Although existing microbial fermentation methods have achieved significant results in increasing the yield and efficiency of L-tryptophan, further expanding fermentation methods and improving yield and efficiency remain ongoing goals in this field. Microorganisms such as Klebsiella oxytoca can efficiently synthesize 2,3-butanediol or acetoin from carbohydrates such as glucose (Jantama K., Metab Eng., 2015, 30:16-26). The precursors for the 2,3-butanediol and acetoin synthesis pathways are pyruvate, implying that K. oxytoca possesses a high glycolytic flux. Based on this, a metabolic flux redirection strategy is expected to redirect the high metabolic flux of the 2,3-butanediol and acetoin synthesis pathways to L-tryptophan synthesis.
[0007] Therefore, designing a strategy for constructing a strain that produces high levels of L-tryptophan and applying it to the fermentation production of L-tryptophan remains a challenge in this field. Summary of the Invention
[0008] To address the shortcomings of existing technologies, this invention provides a recombinant microorganism that produces high levels of L-tryptophan and its construction method, with the aim of efficiently preparing L-tryptophan.
[0009] This invention provides a recombinant microorganism for producing L-tryptophan, wherein the starting strain of the recombinant microorganism is selected from Klebsiella spp.; the recombinant microorganism overexpresses the phosphoenolpyruvate synthase gene ppsA and the tryptophan operon partial gene cluster trpE. fbr D gene.
[0010] Preferably, the tryptophan operon partial gene cluster trpE fbr The nucleotide sequence of the D gene is shown in SEQ ID NO. 15.
[0011] Preferably, the starting strain is selected from at least one of Klebsiella acidogenic, Klebsiella terrestrial, Klebsiella plantarum, or Klebsiella pneumoniae.
[0012] This invention provides a recombinant microorganism for producing L-tryptophan as described in any of the above claims. The recombinant microorganism is constructed by inactivating byproduct and / or enzyme genes in the 2,3-butanediol synthesis pathway and enhancing genes related to L-tryptophan synthesis flux, based on a starting strain. The byproduct is selected from at least one of acetic acid, formic acid, succinic acid, and lactic acid. The genes related to L-tryptophan synthesis flux are selected from at least one of L-tryptophan synthesis-related enzyme genes, metabolic pathway-related genes, efflux protein genes, and endogenous strong promoter genes.
[0013] Preferably, the inactivation includes knockout or knockdown, and the enhancement includes overexpression.
[0014] Preferably, the enzyme genes in the byproduct and / or 2,3-butanediol synthesis pathway are selected from at least sixteen of the following: pyruvate kinase encoding gene pykF, tryptophanase encoding gene tnaA, transcriptional repressor trpR of the tryptophan operon, attenuator trpL of the tryptophan operon, pyruvate oxidase gene pox, phosphotransacetylase gene pta, acetate kinase ackA, fumarate reductase subunit A gene frdA, lactate dehydrogenase gene ldhD, pyruvate formate lyase gene pflB, alcohol dehydrogenase gene adhE, α-acetolactate synthase gene budB, α-acetolactate decarboxylase gene budA, 2,3-butanediol dehydrogenase gene budC, glycerol dehydrogenase gene gldA, and 1,3-propanediol dehydrogenase gene dhaT.
[0015] Preferably, the gene associated with L-tryptophan synthesis flux is selected from the promoter P of the 2,3-butanediol synthesis gene cluster. budABCThe gene encoding the mutant protein of 3-deoxy-d-arabinohepeptulose-7-phosphate synthase, aroG. fbr The gene encoding the mutant protein of 3-phosphoglycerate dehydrogenase, serA, is... fbr The following are at least one to thirteen of the following genes: 3-dehydroquinic acid synthase encoding gene aroB, shikimate dehydrogenase encoding gene aroE, branched acid synthase encoding gene aroC, tryptophan operon partial gene cluster trpDC, tryptophan operon partial gene cluster trpBA, transketolase encoding gene tktA, aromatic amino acid efflux protein encoding gene ywkB, phosphoenolpyruvate carboxykinase gene pck, glutamine synthase encoding gene glnA, and L-tryptophan efflux protein gene yddG.
[0016] This invention provides a method for constructing a recombinant microorganism for producing L-tryptophan as described in any of the above claims. The method comprises, based on a starting strain, inactivating enzyme genes in the byproduct and / or 2,3-butanediol synthesis pathway, and constructing genes related to enhancing L-tryptophan synthesis flux. The byproduct is selected from at least one of acetic acid, formic acid, succinic acid, and lactic acid. The L-tryptophan synthesis flux-related genes are selected from at least one of L-tryptophan synthesis-related enzyme genes, metabolic pathway-related genes, efflux protein genes, and endogenous strong promoter genes.
[0017] The present invention provides the use of the recombinant microorganisms for producing L-tryptophan described in any of the above claims in the production of L-tryptophan.
[0018] Preferably, the gene overexpressing phosphoenolpyruvate synthase gene ppsA and the tryptophan operon partial gene cluster trpE is selected. fbr Recombinant microorganisms containing the D gene are obtained by culturing them in a glucose-containing fermentation medium.
[0019] Preferably, the concentration of glucose in the fermentation medium is 80-100 g / L;
[0020] And / or, the inoculum size of the recombinant microorganism during cultivation is 5-10% by volume;
[0021] And / or, the stirring speed during the culture is 500-1000 rpm; and / or, the pH during the culture is 6.8±0.1; and / or, the temperature during the culture is 37±0.5℃; and / or, the glucose concentration is maintained at 0-5 g / L during the culture; and / or, the culture time is 40-60 hours.
[0022] This invention provides a recombinant microorganism producing high levels of L-tryptophan, its construction method, and its applications. By screening for gene knockout or addition, this invention has optimized a recombinant Klebsiella oxytoca that produces high levels of L-tryptophan. The recombinant Klebsiella oxytoca of this invention can be used for efficient L-tryptophan production. The features and key effects of this invention are as follows:
[0023] (1) This invention designs a strategy for constructing a high-yield L-tryptophan engineered strain. By systematically reconstructing the metabolism of 2,3-butanediol or acetoin-producing strains, and by knocking out genes related to byproduct synthesis to inhibit the synthesis of 2,3-butanediol, acetic acid, formic acid, succinic acid and lactic acid, an exogenous L-tryptophan biosynthesis pathway is introduced to redirect the intracellular pyruvate synthesis metabolic flux from 2,3-butanediol synthesis to L-tryptophan production, thus constructing an L-tryptophan-producing strain. Furthermore, by enhancing the L-tryptophan synthesis flux and strengthening L-tryptophan efflux, an engineered strain capable of efficiently producing L-tryptophan is obtained.
[0024] (2) The optimal Klebsiella acid-producing strain of the present invention produces L-tryptophan using glucose as a substrate under the fermentation conditions given in the present invention, with a yield of 60 g / L and a yield of 0.23 g / g.
[0025] (3) The recombinant strain constructed in this invention requires a simple culture medium, low fermentation substrate and culture cost, and the engineered strain has a high L-tryptophan yield, and the product has a single component and is easy to separate.
[0026] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0027] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0028] Figure 1 This invention describes the L-tryptophan synthesis and metabolism pathway of recombinant Klebsiella acidogenic bacteria. Detailed Implementation
[0029] Unless otherwise specified, all reagents and materials used in the following examples and experimental cases are commercially available.
[0030] Unless otherwise specified, all materials, reagents, plasmids, special kits, and strains used in the following examples were obtained commercially.
[0031] The nucleotide sequence information of the gene involved in this invention is as follows:
[0032] The nucleotide sequence of gene ppsA (SEQ ID NO.1):
[0033]
[0034] Nucleotide sequence of gene budA (SEQ ID NO.2):
[0035] ATGAACCATTCTGCTGAATGCTCTTGTGAAGAGAGCCTGTGTGAAACTCTACGAGGGTTTTCCGCGCAACATCCCGATAGCGTCATCTACCAGACCTCTCTGATGAGCGCGCTGTTGAGCGGCGTTTATGAAGGTAATACCACCATCGCTGATTTACTCACCCACGGCGATTTTGGCCTGGGAACCTTTAATGAACTGGACGGCGAGCTGATCGCGTTTAGCAGCGAGGTATACCAGCTGCGCGCCGACGGCAGCGCCCGTAAAGCCCGAATGGAACAGCGCACGCCGTTTGCGGTGATGACCTGGTTTCAGCCGCAGTATCGTAAAACGTTCGATAAACCGGTGAGCCGCCAGCAGTTGCACGACATTATCGACCAGCAAATACCCTCCGATAATCTCTTCTGCGCCTTGCGCATTAACGGTCATTTTCGTCATGCGCATACCCGCACCGTACCGCGCCAGACCCCGCCCTACCGGGCGATGACCGACGTGCTCGACGACCAGCCGGTATTCCGCTTCAACCAGCGCGAAGGGGTACTGGTCGGCTTCCGTACCCCGCAGCATATGCAGGGCATTAACGTTGCCGGCTACCACGAACATTTCATCACCGATGACCGTCAGGGCGGCGGTCATCTGCTCGATTATCAGCTCGACCACGGCGTGCTGACCTTTGGCGAAATCCACAAATTGATGATTGACCTTCCTGCCGATAGCGCCTTCCTGCAGGCGGATCTGCACCCGGACAATCTAGATGCCGCTATTCGCTCAGTCGAAAACTAA
[0036] Mutant protein gene aroG fbr(D146N) Nucleotide sequence (SEQ ID NO.3):
[0037]
[0038] The nucleotide sequence of gene budB (SEQ ID NO.4):
[0039]
[0040] The nucleotide sequence of gene tnaA (SEQ ID NO.5):
[0041]
[0042] Promoter P budABC Nucleotide sequence (SEQ ID NO.6):
[0043] ATCGAAAACGTCTCAAACAATCATAGATTCTATATTGGAACTGTGAGCTGAATCG CGTCAACATTTATTTAACCTTTCTGATATTCGTTGAACGAGGAAGCGGGTA
[0044] Nucleotide sequence of gene trpL (SEQ ID NO.7):
[0045] GATGACTCCTGCTGGACATGAACCTGTACCCGTCATACTTTAAGTCACAAGCAGATTGACTGATGTTCTGCAGCTTAAGGGATTAAGGATAGTGATAAGCGCATCATCATACCGACTGATAGAGAAAATCTGCAAACGGGGGTTGACTTTAATCTCTCGGACTAGTTAACTAGTACGCAAGTTCACATGAAGGGGTATCATCAATGAAAACGCAACTCATCACTCTGCACGGCTGGTGGCGCACCTCCTGTTATCGGGCGGCGTGATCGCGTTTTGCACTCAGCATACAGATACCCGGCCCGCCAATGAGCGGGCTTTTTATTGGACAAATTATTACAGCGAACAGGCGACAACAAATA
[0046] Nucleotide sequence of gene trpR (SEQ ID NO.8):
[0047] ATGACCCAACAATCCCCCTATTCAGCAGCGGTAGCCGAACAGCGTCATCAGGAGTGGCTGCGTTTTGTCGCGCTCTTACAGCAGGCGTACGCCGACGATCTTCATCTGCCGCTTTTACAGCTTATGCTGACCCCCGACGAGCGCGAGGCGCTGGGTACGCGGGTACGTATTATTGAAGAGCTGCTGCGCGGTGAGATGAGCCAGCGCGAGCTAAAAAATGAACTCGGCGCCGGCATCGCGACCATCACCCGCGGTTCGAACAGCCTCAAATCAGCGCCGCCGGAGCTGCGTTTATGGCTGGAGCAGTCGTTGTTTAACGCTGGCGATAAATAG
[0048] Nucleotide sequence of gene aroB (SEQ ID NO.9):
[0049]
[0050] The nucleotide sequence of the ldhD gene (SEQ ID NO.10):
[0051] ATGAAAATCGCTGTGTACAGTACGAAACAGTACGACAAGAAGTATCTGCAGCATGTCAATGATGCATACGGCTTTGAACTGGAATTTTTTGACTTCCTGCTCACCGAAAAGACCGCCAAAACCGCCAACGGCTGTGAAGCGGTATGCATTTTCGTTAACGATGACGGTAGCCGCCCGGTACTTGAAGAACTGAAAGCCCACGGCGTGAAGTACATCGCGCTGCGCTGCGCCGGGTTCAACAACGTTGACCTCGACGCCGCGAAAGAGCTGGGCCTGCGGGTAGTACGCGTCCCGGCCTACTCGCCGGAAGCGGTCGCTGAGCACGCAATCGGCATGATGATGTCGCTGAACCGCCGCATTCATCGCGCCTATCAGCGCACTCGCGATGCTAACTTCTCCCTTGAGGGGCTGACCGGCTTCACTATGCACGGTAAAACCGCTGGCGTTATCGGCACCGGTAAGATTGGCGTTGCCGCGCTGCGCATCCTTAAAGGTTTCGGTATGCGCCTGCTGGCGTTTGATCCCTATCCAAGCGCCGCCGCGCTGGATATGGGCGTGGAGTATGTCGATCTGGAAACGCTATACCGGGAGTCCGATGTTATCTCCCTGCACTGCCCGCTGACCGATGAGAACTATCATTTGCTGAACCATGCCGCGTTCGATCGGATGAAAGATGGGGTGATGATCATCAACACCAGTCGCGGCGCGCTTATCGATTCGCAGGCAGCGATCGATGCCCTGAAGCACCAGAAAATTGGCGCGCTGGGGATGGACGTGTATGAGAACGAACGCGATCTGTTCTTTGAAGATAAGTCTAACGACGTTATTCAGGACGATGTCTTCCGCCGTCTTTCCGCCTGCCACAACGTTCTGTTTACCGGTCACCAGGCGTTTTTGACCGCAGAGGCGTTGATCAGTATCTCGCAGACCACCCTCGACAACCTGCGTCAGGTGGATGCTGACGAAACCTGCCCTAACGCACTGGTCTGA
[0052] Nucleotide sequence of gene aroE (SEQ ID NO.11):
[0053] ATGGAAACCTATGCTGTTTTTGGTAATCCGATAGCCCACAGCAAATCGCCATTCATTCATCAGCAATTTGCTCAGCAACTGAATATTGAACATCCCTATGGGCGCGTGTTGGCACCCATCAATGATTTCATCAACACACTGAACGCTTTCTTTAGTGCTGGTGGTAAAGGTGCGAATGTGACGGTGCCTTTTAAAGAAGAGGCTTTTGCCAGAGCGGATGAGCTTACTGAACGGGCAGCGTTGGCTGGTGCTGTTAATACCCTCATGCGGTTAGAAGATGGACGCCTGCTGGGTGACAATACCGATGGTGTAGGCTTGTTAAGCGATCTGGAACGTCTGTCTTTTATCCGCCCTGGTTTACGTATTCTGCTTATCGGCGCTGGTGGAGCATCTCGCGGCGTACTACTGCCACTCCTTTCCCTGGACTGTGCGGTGACAATAACTAATCGGACGGTATCCCGCGCGGAAGAGTTGGCTAAATTGTTTGCGCACACTGGCAGTATTCAGGCGTTGAGTATGGACGAACTGGAAGGTCATGAGTTTGATCTCATTATTAATGCAACATCCAGTGGCATCAGTGGTGATATTCCGGCGATCCCGTCATCGCTCATTCATCCAGGCATTTATTGCTATGACATGTTCTATCAGAAAGGAAAAACTCCTTTTCTGGCATGGTGTGAGCAGCGAGGCTCAAAGCGTAATGCTGATGGTTTAGGAATGCTGGTGGCACAGGCGGCTCATGCCTTTCTTCTCTGGCACGGTGTTCTGCCTGACGTAGAACCAGTTATAAAGCAATTGCAGGAGGAATTGTCCGCGTGA
[0054] Nucleotide sequence of gene adhE (SEQ ID NO.12):
[0055]
[0056] The nucleotide sequence of gene aroC (SEQ ID NO.13):
[0057]
[0058] The nucleotide sequence of gene frdA (SEQ ID NO.14):
[0059]
[0060] mutant protein gene trpE fbr(S40F) D nucleotide sequence (SEQ ID NO.15):
[0061]
[0062] The nucleotide sequence of gene pflB (SEQ ID NO.16):
[0063]
[0064] The nucleotide sequence of the gene trpDC (SEQ ID NO.17):
[0065]
[0066] The nucleotide sequence of the gene pox (SEQ ID NO.18):
[0067]
[0068] The nucleotide sequence of the gene trpBA (SEQ ID NO.19):
[0069]
[0070] PTA gene nucleotide sequence (SEQ ID NO.20):
[0071]
[0072] The nucleotide sequence of gene tktA (SEQ ID NO.21):
[0073]
[0074] The nucleotide sequence of the gene pykF (SEQ ID NO.22):
[0075]
[0076] mutant protein gene serA fbr(H344A,N346A,N364A) Nucleotide sequence (SEQ ID NO.23):
[0077]
[0078] Nucleotide sequence of gene budC (SEQ ID NO.24):
[0079] ATGAAAAAAGTCGCACTCGTGACCGGCGCAGGCCAGGGTATCGGTAAAGCTATCGCCCTTCGCCTGGTTCAAGATGGCTTTGCCGTGGCCATCGCCGATTATAACGATGCCACCGCACAGGCGGTTGCTGACGAAATTAACCAGCACGGCGGCCAGGCGCTGGCGGTGAAGGTCGATGTCTCGAAACGCGATCAGGTTTTTGCCGCCGTTGAGCAGGCGCGTAAGGGCCTTGGCGGTTTTGACGTGATCGTTAACAACGCCGGGGTCGCGCCCTCTACGCCTATCGAAGAGATTCGCGAGGACGTCATCGATAAAGTCTACAATATCAACGTTAAGGGCGTTATCTGGGGCATTCAGGCCGCGGTAGATGCGTTTAAAAAAGAGGGCCACGGCGGCAAGATCATCAACGCCTGCTCCCAGGCGGGCCACGTGGGTAACCCGGAACTGGCGGTCTACAGTTCAAGCAAGTTTGCCGTGCGCGGCCTGACGCAAACCGCCGCCCGCGATCTGGCGCATCTGGGAATTACCGTTAACGGCTACTGCCCGGGGATCGTCAAAACCCCCATGTGGGCGGAAATTGACCGTCAGGTTTCCGAAGCGGCGGGCAAACCGCTGGGCTACGGAACCCAGGAATTTGCGAAACGCATTACCCTCGGTCGTCTTTCCGAACCGGAAGACGTCGCGGCCTGCGTCTCTTATCTGGCCGGTCCGGACTCCAACTACATGACCGGTCAGTCGCTGCTGATCGATGGCGGTATGGTATTCAGTTAA
[0080] Nucleotide sequence of gene glnA (SEQ ID NO.25):
[0081]
[0082] The nucleotide sequence of the dhaT gene (SEQ ID NO.26):
[0083]
[0084] The nucleotide sequence of gene ywkB (SEQ ID NO.27):
[0085] TTGAGCATCTTAGATATCTTAATCCTCCTGGCGCCGATCTTCTTTGTTATCGTGCTGGGTTGGTTTGCAGGACATTTTGGAAGTTATGATGCCAAGTCGGCAAAAGGGGTAAGTACGTTAGTAACGAAATACGCACTTCCAGCTCACTTTATCGCTGGTATTTTGACAACTTCCAGAAGTGAATTTTTATCACAAGTACCTTTAATGATTTCTTTAATTATTGGGATTGTTGGTTTCTATATCATCATTCTTTTGGTTTGCAGATTTATATTCAAGTATGATTTAACGAACTCATCTGTATTTTCTTTGAACTCTGCACAGCCGACATTCGCATTTATGGGTATCCCGGTATTGGGAAGCTTATTCGGAGCGAATGAAGTTGCGATTCCGATCGCGGTCACAGGTATCGTGGTTAACGCGATTCTTGATCCGCTCGCGATCATTATCGCTACTGTTGGTGAGTCTTCTAAGAAAAACGAAGAGAGTGGCGACAGCTTCTGGAAGATGACAGGAAAATCAATCCTGCATGGTCTTTGTGAGCCGCTTGCAGCTGCTCCGTTAATCAGTATGATCTTGGTGCTGGTTTTCAATTTCACTCTTCCTGAGCTGGGTGTTAAAATGCTTGATCAGCTTGGAAGCACAACATCTGGTGTTGCTCTCTTCGCTGTTGGTGTTACCGTTGGTATTCGTAAAATTAAACTCAGTATGCCGGCTATCGGTATTGCGTTACTAAAAGTTGCGGTTCAGCCTGCGTTAATGTTCCTGATTGCTCTTGCTATCGGACTTCCAGCTGACCAAACAACAAAAGCAATCCTTCTTGTTGCATTCCCTGGTTCTGCCGTTGCAGCCATGATTGCGACTCGTTTCGAGAAACAAGAAGAAGAAACTGCAACTGCGTTTGTGGTCAGTGCGATTCTGTCATTGATTTCACTTCCAATCATTATCGCGCTTACTGCGTAA
[0086] The nucleotide sequence of gene gldA (SEQ ID NO.28):
[0087]
[0088] Gene pck nucleotide sequence (SEQ ID NO.29):
[0089]
[0090] nucleotide sequence of gene ackA (SEQ ID NO.30):
[0091]
[0092] Example 1: Construction of an L-tryptophan-producing strain starting from Klebsiella oxytoca CICC21518.
[0093] The starting strain, *Klebsiella oxytoca* CICC21518, was purchased from the China Industrial Microbiological Culture Collection Center (accession number: CICC21518). *Klebsiella oxytoca* CICC21518 is a Gram-negative bacterium that grows aerobicly or facultatively anaerobicly, with an optimal culture temperature of 37°C. *Klebsiella oxytoca* CICC21518 is positive for the Voges-Proskauer reaction (VP), indicating its ability to metabolize citrate for growth. *Klebsiella oxytoca* has a broad substrate spectrum, slowly fermenting lactose, and fermenting mannitol, inositol, sorbitol, melibiose, calendula alcohol, and raffinose.
[0094] 1.1 The α-acetolactate decarboxylase gene budA was replaced with the phosphoenolpyruvate synthase gene ppsA from Escherichia coli W3110.
[0095] The phosphoenolpyruvate synthase gene ppsA has a sequence length of 2379 bases, and its nucleotide sequence is shown in SEQ ID NO.1. The α-acetolactate decarboxylase gene budA has a sequence length of 780 bases, and its nucleotide sequence is shown in SEQ ID NO.2.
[0096] (1) Construction of gene substitution vector: Genomic DNA of K. oxytoca CICC21518 was prepared using conventional methods, referring to the small-scale preparation method of bacterial genomes in the "Concise Guide to Molecular Biology" published by Science Press. Genomic DNA of Klebsiella oxytoca CICC21518 was extracted. Using the genomic DNA of K. oxytoca CICC21518 as a template, the upstream and downstream homologous arms of the budA gene were amplified by PCR for subsequent gene substitution. The intermediate substitution gene ppsA was amplified using the genome of E. coli W3110 as a template. The obtained upstream homologous arm and gene ppsA were used as templates for recombinant PCR. The obtained recombinant fragment and the upstream and downstream homologous arms were then subjected to recombinant PCR to obtain the gene substitution fragment ΔbudA::ppsA, which contains EcoRI and BamHI restriction sites at both ends.
[0097] The suicide plasmid pR6KmobsacB was double-digested with restriction endonucleases EcoRI and BamHI. After the digestion products were recovered by nucleic acid gel, they were ligated with the gene replacement fragment using T5 exonuclease to obtain the gene replacement plasmid pR6KmobsacB-ΔbudA::ppsA.
[0098] (2) Gene knockout procedure: Inoculate *E. coli* S17-1λpir carrying the plasmid obtained in step (1) and *Klebsiella oxytoca* CICC21518 and culture overnight at 37°C. Transplant the above strains and culture at 37°C until OD. 600nm The concentration was approximately 0.6-0.8. 5 mL of *E. coli* culture and 1 mL of *Klebsiella pneumoniae* culture were collected separately. The cells were collected by centrifugation at 6500 rpm for 3 minutes. The cells were washed twice with 0.85% physiological saline. The two cell mixtures were then mixed with 100 μL of physiological saline and dropped onto LB agar plates. The plates were incubated overnight at 37°C. After rinsing the bacterial membrane with 0.85% physiological saline and collecting the cells, the cells were collected by centrifugation at 6500 rpm for 3 minutes. The cells were washed twice with 0.85% physiological saline, diluted 4-10 times, and spread onto M9 solid plates containing 20% citrate and kanamycin. The plates were incubated at 37°C for 36-48 hours. Single colonies were picked and incubated in LB medium containing kanamycin at 37°C. Colony PCR was performed using upstream and downstream primers to verify the bacterial culture, yielding the correct single-crossover target bacteria capable of simultaneously PCR-producing both long and short fragments.
[0099] The correct single-crossover target strain was transferred to antibiotic-free LB medium and cultured overnight at 37°C. Then, it was transferred to LB medium containing 15% sucrose and cultured at 37°C for 10–12 hours. After two generations, the strain was serially diluted and plated onto LB solid medium containing 15% sucrose and cultured overnight at 37°C. Single colonies were picked and placed in LB medium for colony PCR verification using upstream and downstream primers. The genome of the single colony with the correct PCR band size was extracted. Genomic temperature gradient PCR was then performed using the same primers. Strains with the correct band size were identified as double-crossover target strains.
[0100] 1.2 The gene aroG, encoding the mutant protein of 3-deoxy-D-arabinohepulose-7-phosphate synthase from Escherichia coli W3110, was used. fbr(D146N) Replace the α-acetolactate synthase gene budB
[0101] 3-Deoxy-D-arabinohepenoyl-7-phosphate synthase mutant protein gene aroG fbr(D146N) The sequence length is 1053 bases, and its nucleotide sequence is shown in SEQ ID NO.3. The α-acetolactate synthase gene budB has a sequence length of 1680 bases, and its nucleotide sequence is shown in SEQ ID NO.4.
[0102] The gene aroG, encoding a mutant protein of 3-deoxy-D-arabinohepulose-7-phosphate synthase from Escherichia coli W3110, is used. fbr(D146N) The α-acetolactate synthase encoding gene budB was replaced. The vector construction and operation steps were the same as those for replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The Klebsiella pneumoniae used in this step was based on step 1.1.
[0103] 1.3 Knockout of tnaA gene encoding tryptophanase
[0104] The tryptophanase encoding gene tnaA has a sequence length of 1416 bases, and its nucleotide sequence is shown in SEQ ID NO.5.
[0105] Knockout vector construction: The upstream and downstream homologous arms of the tnaA gene were amplified by PCR. The obtained upstream and downstream homologous arms were used as templates for recombination. The recombinant fragment was amplified by PCR to obtain a truncated fragment of tnaA containing EcoRI and BamHI restriction sites at both ends.
[0106] The truncated recombinant fragment of tnaA and the suicide plasmid pR6KmobsacB were double-digested with restriction endonucleases EcoRI and BamHI, respectively. After recovery of the digestion products via nucleic acid gel, the gene replacement fragment was ligated to the gene replacement plasmid pR6KmobsacB-ΔtnaA using T5 exonuclease. The gene manipulation procedure was the same as the procedure for replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The Klebsiella pneumoniae used in this step was based on the method described in 1.2.
[0107] 1.4 promoter P of the endogenous 2,3-butanediol synthesis pathway gene cluster budABC The attenuator trpL replaces the tryptophan operon
[0108] Promoter P of the endogenous 2,3-butanediol biosynthesis pathway gene cluster budABC The sequence length is 106 bases, and its nucleotide sequence is shown in SEQ ID NO.6. The attenuator trpL sequence of the tryptophan operon is 45 bases long, and its nucleotide sequence is shown in SEQ ID NO.7.
[0109] The promoter P of the endogenous 2,3-butanediol synthesis pathway gene cluster budABC The construction and operation steps of the attenuator trpL vector replacing the tryptophan operon are the same as those in step 1.1 of this embodiment, which involves replacing the budA gene with the ppsA gene. The Klebsiella pneumoniae used in this step is based on step 1.3.
[0110] Knockout of trpR, the transcriptional repressor of the 1,5-tryptophan operon
[0111] The transcriptional repressor trpR of the tryptophan operon has a sequence length of 327 bases, and its nucleotide sequence is shown in SEQ ID NO.8.
[0112] The construction and operation steps of the trpR knockout vector for the tryptophan operon transcription repressor are the same as those for the tnaA gene knockout in step 1.3 of this embodiment. The Klebsiella pneumoniae used in this step is based on the method described in 1.4.
[0113] 1.6 The lactate dehydrogenase gene ldhD was replaced with the 3-dehydroquinic acid synthase gene aroB from E. coli W3110.
[0114] The 3-dehydroquinic acid synthase gene aroB from E. coli W3110 has a sequence length of 1089 bases, and its nucleotide sequence is shown in SEQ ID NO.9. The lactate dehydrogenase gene ldhD has a sequence length of 990 bases, and its nucleotide sequence is shown in SEQ ID NO.10.
[0115] The construction and operation steps of the vector to replace the lactate dehydrogenase gene ldhD with the 3-dehydroquinic acid synthase gene aroB from E. coli W3110 are the same as the operation steps of replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The Klebsiella acid-producing bacteria used in this step are based on 1.6.
[0116] 1.7 The alcohol dehydrogenase gene adhE was replaced with the shikimate dehydrogenase encoding gene aroE from E. coli W3110.
[0117] The shikimate dehydrogenase encoding gene aroE from E. coli W3110 has a sequence length of 819 bases, and its nucleotide sequence is shown in SEQ ID NO.11. The alcohol dehydrogenase gene adhE has a sequence length of 780 bases, and its nucleotide sequence is shown in SEQ ID NO.12.
[0118] The construction and operation steps of the vector replacing the alcohol dehydrogenase gene adhE with the shikimate dehydrogenase encoding gene aroE from E. coli W3110 are the same as the operation steps of replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The acid-producing Klebsiella used in this step is based on 1.7.
[0119] 1.8 The frdA gene for fumarate reductase subunit A was replaced with the aroC gene, which encodes branched acid synthase, from E. coli W3110.
[0120] The aroC gene encoding branched acid synthase from E. coli W3110 has a length of 1086 bases, and its nucleotide sequence is shown in SEQ ID NO.13. The gene sequence of fumarate reductase subunit A has a length of 1791 bases, and its nucleotide sequence is shown in SEQ ID NO.14.
[0121] The construction and operation steps of the vector to replace the frdA gene of fumarate reductase subunit A with the aroC gene of E. coli W3110 are the same as those for replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The Klebsiella acidogenic bacteria used in this step are based on 1.8.
[0122] 1.9 The tryptophan operon partial gene cluster trpE from E. coli W3110 fbr(S40F) D replaces the pyruvate formate lyase gene pflB
[0123] The tryptophan operon partial gene cluster trpE from E. coli W3110 fbr(S40F) The D sequence is 3158 bases long, and its nucleotide sequence is shown in SEQ ID NO.15. The pyruvate formate lyase gene pflB has a sequence length of 2283 bases, and its nucleotide sequence is shown in SEQ ID NO.16.
[0124] The tryptophan operon partial gene cluster trpE from E. coli W3110 fbr(S40F) The construction and operation steps of the pflB vector, which replaces the pyruvate formate lyase gene D, are the same as those in step 1.1 of this embodiment, which replaces the budA gene with the ppsA gene. The Klebsiella pneumoniae used in this step is based on step 1.8.
[0125] 1.10 The pyruvate oxidase gene pox was replaced with the tryptophan operon partial gene cluster trpDC from E. coli W3110.
[0126] The trpDC sequence of the tryptophan operon from E. coli W3110 is 2958 bases long, and its nucleotide sequence is shown in SEQ ID NO.17. The pox gene sequence of pyruvate oxidase is 1719 bases long, and its nucleotide sequence is shown in SEQ ID NO.18.
[0127] The construction and operation steps of the vector to replace the pyruvate oxidase gene pox with the tryptophan operon partial gene cluster trpDC from E. coli W3110 are the same as the operation steps of replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The acid-producing Klebsiella used in this step is based on 1.9.
[0128] 1.11 The phosphoryltransferase gene pta was replaced with trpBA, a partial gene cluster from the tryptophan operon of E. coli W3110.
[0129] The trpBA gene cluster from the tryptophan operon of E. coli W3110 has a length of 2000 bases, and its nucleotide sequence is shown in SEQ ID NO.19. The pta gene, a phosphoryltransferase gene, has a length of 2199 bases, and its nucleotide sequence is shown in SEQ ID NO.20.
[0130] The construction and operation steps of the vector to replace the phosphate transacetylase gene pta with the tryptophan operon partial gene cluster trpBA from E. coli W3110 are the same as the operation steps of replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The acid-producing Klebsiella used in this step is based on 1.10.
[0131] 1.12 The pyruvate kinase gene pykF was replaced with the transketolase-encoding gene tktA from E. coli W3110.
[0132] The transketolase encoding gene tktA from E. coli W3110 has a sequence length of 1992 bases, and its nucleotide sequence is shown in SEQ ID NO.21. The pyruvate kinase gene pykF has a sequence length of 1413 bases, and its nucleotide sequence is shown in SEQ ID NO.22.
[0133] The construction and operation steps of the vector to replace the pykF gene with the tktA gene encoding the transketolase from E. coli W3110 are the same as those for replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The Klebsiella acidogenic bacteria used in this step are based on 1.11.
[0134] 1.13 The gene encoding the serA 3-phosphoglycerate dehydrogenase mutant protein from E. coli W3110. fbr(H344A ,N346A,N364A) Replace the 2,3-butanediol dehydrogenase gene budC
[0135] The gene encoding the mutant protein serA from E. coli W3110, 3-phosphoglycerate dehydrogenase. fbr(H344A,N346A,N364A) The sequence length is 1233 bases, and its nucleotide sequence is shown in SEQ ID NO.23. The budC sequence of the 2,3-butanediol dehydrogenase gene is 771 bases long, and its nucleotide sequence is shown in SEQ ID NO.24.
[0136] The gene encoding the serA 3-phosphoglycerate dehydrogenase mutant protein from E. coli W3110. fbr(H344A ,N346A,N364A) The construction and operation steps of the vector replacing the 2,3-butanediol dehydrogenase gene budC are the same as those in step 1.1 of this embodiment, where the ppsA gene is replaced with the budA gene. The Klebsiella pneumoniae used in this step is based on step 1.12.
[0137] 1.14 The 1,3-propanediol dehydrogenase gene dhaT was replaced with the glutamine synthase encoding gene glnA from Corynebacterium glutamicum ATCC13032.
[0138] The glutamine synthase encoding gene glnA from Corynebacterium glutamicum ATCC13032 has a sequence length of 1434 bases, and its nucleotide sequence is shown in SEQ ID NO.25. The 1,3-propanediol dehydrogenase gene dhaT has a sequence length of 1164 bases, and its nucleotide sequence is shown in SEQ ID NO.26.
[0139] The construction and operation steps of the vector to replace the 1,3-propanediol dehydrogenase gene dhaT with the glutamine synthase encoding gene glnA from Corynebacterium glutamicum ATCC13032 are the same as those for replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The Klebsiella acidogenic bacteria used in this step are based on 1.13.
[0140] 1.15 The glycerol dehydrogenase gene gldA was replaced with the aromatic amino acid efflux protein gene ywkB from Bacillus subtilis 168.
[0141] The aromatic amino acid efflux protein gene ywkB from B. subtilis 168 has a sequence length of 960 bases, and its nucleotide sequence is shown in SEQ ID NO.27. The glycerol dehydrogenase gene gldA has a sequence length of 1104 bases, and its nucleotide sequence is shown in SEQ ID NO.28.
[0142] The construction and operation steps of the vector replacing the glycerol dehydrogenase gene gldA with the aromatic amino acid efflux protein gene ywkB from Bacillus subtilis 168 are the same as the operation steps of replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The acid-producing Klebsiella used in this step is based on 1.14.
[0143] 1.16 The acetyl kinase gene ackA was replaced with the phosphoenolpyruvate carboxykinase gene pck from Bacillus subtilis 168.
[0144] The phosphoenolpyruvate carboxykinase gene pck from B. subtilis 168 has a sequence length of 1584 bases, and its nucleotide sequence is shown in SEQ ID NO. 29. The acetate kinase gene ackA has a sequence length of 1203 bases, and its nucleotide sequence is shown in SEQ ID NO. 30.
[0145] The construction and operation steps of the vector to replace the acetate kinase gene ackA with the phosphoenolpyruvate carboxykinase gene pck from Bacillus subtilis 168 are the same as the operation steps of replacing the budA gene with the ppsA gene in step 1.1 of this embodiment. The Klebsiella acidogenic bacteria used in this step are based on 1.15.
[0146] The recombinant acid-producing Klebsiella was ultimately named Klebsiella oxytoca TRP-27, with the genotype K. oxytoca CICC21518ΔbudA::ppsAΔbudB::aroG fbr(D146N) ΔtnaAΔtrpL::P budABC ΔtrpRΔldhD::aroBΔadhE::aroEΔfrdA::aroCΔpflB::trpE fbr(S40F) DΔpox::trpDCΔpta::trpBAΔpykF::tktAΔbudC::serA fbr(H344A,N346A,N364A) ΔdhaT::glnAΔgldA::ywkBΔackA::pck. Figure 1 The diagram shows the L-tryptophan synthesis pathway of the recombinant bacteria in this embodiment.
[0147] Example 2: Production of L-tryptophan by Recombinant Klebsiella oxytoca TRP-27 from Glucose via Shake Flask Fermentation
[0148] (1) Plate culture: The recombinant strain K. oxytoca TRP-27 was streaked onto LB medium containing 1.8% agar by weight and volume and cultured at 37°C for 10 hours;
[0149] (2) Seed culture: Under aseptic conditions, pick a single colony from the plate in step (1) with the tip of a sterile pipette, and then inoculate it into 5 mL of LB liquid medium and shake it at 37°C for 10 hours; then inoculate it into 100 mL of LB liquid medium at an inoculation rate of 1% (v / v) and shake it at 37°C for 10 hours.
[0150] (3) Shake-flask fermentation: Under aseptic conditions, the bacterial culture obtained in step (2) was inoculated into a fermentation medium containing 80 g / L glucose at an inoculation rate of 5% (v / v). The fermentation conditions were: a culture temperature of 37°C, a shaker culture at a speed of 180 rpm, and a pH of 6.8 adjusted with ammonia. The concentration of L-tryptophan in the fermentation broth was determined by high-performance liquid chromatography (HPLC). Fermentation was stopped when glucose was no longer consumed, and L-tryptophan was obtained from the fermentation broth.
[0151] The results showed that after culturing the recombinant strain K. oxytoca TRP-27 for 60 h, it consumed 80 g / L of glucose, and the L-tryptophan concentration reached 14.6 g / L, with an L-tryptophan yield of 0.183 g / g.
[0152] Wherein: the LB culture medium formula mentioned in steps (1) to (2) above is: 10 g / L peptone; 5 g / L yeast powder; 10 g / L NaCl, pH 7.0; sterilized at 121℃ for 20 minutes.
[0153] The fermentation medium formula mentioned in step (3) above is: 80 g / L glucose, 5 g / L yeast powder, 10 g / L K2HPO4, 2 g / L NaH2PO4, 10 g / L NH4SO4, 0.7 g / L MgSO4·7H2O, and 1 mL of 1000× trace element solution; wherein, the formula of the 1000× trace element solution is: 3 g / L CaCl2·2H2O, 3 g / L ZnCl2, 20 g / L FeCl3·2H2O, 11 g / L MnCl2·2H2O, 1 g / L CuCl2·2H2O, 2 g / L CoCl2·2H2O, 0.35 g / L H3BO3, and 0.024 g / L NaMoO4·2H2O. In other embodiments, the glucose content can be adjusted within the range of 80–90 g / L.
[0154] The detection method for L-tryptophan, a fermentation product, is as follows:
[0155] Centrifuge the fermentation broth sample at 12,000 rpm for 1 min, collect 100 μL of the supernatant, add 400 μL of 0.5 mol / L sodium bicarbonate (pH = 9.0) and 100 μL of 1% 2,4-dinitrofluorobenzene (DNFB), shake to mix, and then incubate at 60 °C in the dark for 1 h. After cooling to room temperature, add 1 mL of 0.01 mol / L KH₂PO₄ (pH 7.0), shake well, centrifuge, collect the supernatant, filter through a 0.22 μm filter membrane, and then perform high-performance liquid chromatography (HPLC) to detect L-tryptophan. The specific HPLC detection conditions are as follows:
[0156] The liquid chromatograph used was an Agilent 1260, and the chromatographic column was a Welchrom C10. 18 (4.6mm*250mm, 5μm); Detector: VWD detector; Detection wavelength: 254nm; Mobile phase A: 0.1% trifluoroacetic acid (TFA) aqueous solution; Mobile phase B: acetonitrile; Gradient elution was performed using different ratios of mobile phases A and B as follows: 0-10min, 5% B; 10-13min, 80% B; 13.1-18min, 5% B; Flow rate: 1mL / min; Column temperature: 30℃; Injection volume: 5μL; Analysis time: 18min.
[0157] Example 3: L-Tryptophan production by fed-batch fermentation of recombinant Klebsiella oxytoca TRP-27 using glucose as a substrate.
[0158] (1) Plate culture: The recombinant strain K. oxytoca TRP-27 was streaked onto LB medium containing 1.8% agar by weight and volume and cultured at 37°C for 10 hours;
[0159] (2) Seed culture: Under aseptic conditions, pick a single colony from the plate in step (1) with the tip of a sterile pipette, and then inoculate it into 5 mL of LB liquid medium and shake it at 37°C for 10 hours; then inoculate it into 100 mL of LB liquid medium at an inoculation rate of 1% (v / v) and shake it at 37°C for 10 hours.
[0160] (3) 7.5L fermenter culture: Under aseptic conditions, take the bacterial solution obtained in step (2) and inoculate it into a fermentation medium containing 60g / L glucose at an inoculation rate of 10% (v / v). The fermentation conditions are as follows: liquid volume 5L, culture temperature 37℃, culture method is stirred culture, stirring speed is 500 rpm, dissolved oxygen level cascade speed and aeration rate are maintained at 15%~20%, pH is adjusted with ammonia water to maintain 6.8±0.1, and 500g / L glucose mother liquor is added according to the glucose concentration to maintain the glucose concentration at 0g / L. Fermentation is stopped after 40h, and L-tryptophan is obtained from the fermentation broth.
[0161] The results showed that after culturing the recombinant strain K. oxytoca TRP-27 for 60 h, it consumed 272.7 g / L of glucose, achieved an L-tryptophan concentration of 60.0 g / L, and a L-tryptophan yield of 0.23 g / g, which is the highest yield and conversion rate to date. It is also the first time that a high-yielding L-tryptophan strain has been obtained using Klebsiella oxytoca as the chassis strain.
[0162] The detection method for L-tryptophan, the product described in the above steps, as well as the LB medium formula and fermentation medium formula are the same as those in Example 2. The difference is that the concentration of glucose in the fermentation medium formula of this example is 60 g / L.
[0163] The technical solution of the present invention will be further explained through experiments below.
[0164] Experiment 1: Blocking the 2,3-butanediol synthesis pathway and enhancing the L-tryptophan synthesis pathway
[0165] In this experiment, Klebsiella oxytoca CICC21518 was selected as the production host. By blocking 2,3-butanediol synthesis to enhance the accumulation of the precursor pyruvate, and simultaneously enhancing the expression of phosphoenolpyruvate synthase and 3-deoxy-D-arabinohepulose-7-phosphate synthase which are insensitive to feedback inhibition, the metabolic flux of 2,3-butanediol synthesis was redirected from pyruvate to L-tryptophan synthesis.
[0166] The gene knockout and gene integration employed in this invention both utilize a two-step homologous recombination technique, the specific operation process of which is described in the above embodiments. This experimental example also selects the phosphoenolpyruvate synthase ppsA (nucleotide sequence SEQ ID NO.1) and the feedback-insensitive 3-deoxy-7-phosphate heptagenin synthase gene aroG from *E. coli*. fbr(D146N)(nucleotide sequence is SEQ ID NO.3), referring to the gene integration technology described above, the ppsA gene was integrated into the site of the α-acetolactate decarboxylase gene budA (nucleotide sequence is SEQ ID NO.2), a key gene in the 2,3-butanediol synthesis pathway, in the K. oxytoca genome, to obtain the recombinant strain K. oxytoca TRP-2; ppsA and aroG fbr(D146N) The genes were integrated into the sites of the key genes in the 2,3-butanediol synthesis pathway, α-acetolactate decarboxylase gene budA (nucleotide sequence SEQ ID NO.2) and α-acetolactate synthase gene budB (nucleotide sequence SEQ ID NO.4), respectively, to obtain the recombinant strain K. oxytoca TRP-4.
[0167] The starting strains K. oxytoca TRP-0, K. oxytoca TRP-2 and the recombinant strain K. oxytoca TRP-4 were cultured in shake flasks for 60 h according to the culture method in Example 2. The fermentation broth was analyzed for metabolites by high performance liquid chromatography (HPLC).
[0168] Table 1. Effects of blocking the 2,3-butanediol synthesis pathway and enhancing the L-tryptophan synthesis pathway
[0169]
[0170] The fermentation results are shown in Table 1. The results show that the main fermentation product of the starting strain K. oxytoca CICC21518 is 2,3-butanediol. Knocking out budA and budB and adding ppsA and aroG... fbr(D146N) After fermentation, the recombinant strain K. oxytoca TRP-4 almost stopped accumulating 2,3-butanediol, but accumulated 0.8 g / L of L-tryptophan.
[0171] Experiment Example 2: Blocking the L-tryptophan degradation pathway
[0172] In this experiment, the L-tryptophan enzyme encoding gene tnaA (nucleotide sequence SEQ ID NO.5) of K. oxytoca CICC21518 was knocked out to increase L-tryptophan accumulation.
[0173] The gene knockout technique used in this invention employs a two-step homologous recombination technique, and the specific operation process is described in Example 1 above. The recombinant strain K. oxytoca TRP-4 was modified by knocking out the tryptophanase tnaA to obtain the recombinant strain K. oxytoca TRP-5.
[0174] The recombinant strains K. oxytoca TRP-4 and K. oxytoca TRP-5 were cultured in shake flasks for 60 h according to the culture method in Example 2, and the fermentation broth was analyzed for metabolites by high performance liquid chromatography (HPLC).
[0175] Table 2. Effects of blocking the L-tryptophan degradation pathway on L-tryptophan production
[0176]
[0177] The fermentation results are shown in Table 2. The results show that after knocking out the tryptophanase tnaA, the L-tryptophan accumulation of the recombinant strain K. oxytocaTRP-5 increased to 1.3 g / L.
[0178] Experiment 3 introduces an endogenous strong promoter to enhance the expression of the tryptophan operon gene.
[0179] This experimental example attempts to introduce an intrinsic strong promoter P. budABC (nucleotide sequence SEQ ID NO.6) replaces thrL (nucleotide sequence SEQ ID NO.7) to enhance transcription of the L-tryptophan synthesis gene cluster.
[0180] The gene integration employed in this invention utilizes a two-step homologous recombination technique, the specific operation process of which is described in Example 1 above. Based on the recombinant strain K. oxytoca TRP-5, a strong promoter P is introduced. budABC The recombinant strain K. oxytoca TRP-6 was obtained by reaching the attenuator thrL site.
[0181] The recombinant strains K. oxytoca TRP-5 and K. oxytoca TRP-6 were cultured in shake flasks for 60 h according to the culture method in Example 2, and the fermentation broth was analyzed for metabolites by high performance liquid chromatography (HPLC).
[0182] Table 3. Introduction of endogenous strong promoters to enhance the expression of tryptophan operon genes
[0183]
[0184] The fermentation results are shown in Table 3. The results show that the strong promoter P budABC After replacing thrL, the L-tryptophan accumulation in the recombinant strain K. oxytocaTRP-6 was significantly increased to 5.2 g / L.
[0185] Experiment 4: Screening for different rate-limiting genes to enhance L-tryptophan production
[0186] To further improve L-tryptophan production, this experiment screened rate-limiting genes in the L-tryptophan synthesis pathway to ensure strong expression levels of L-tryptophan synthesis-related genes. Specifically, firstly, based on the recombinant strain K. oxytoca TRP-6, the transcriptional repressor trpR (SEQ ID NO. 8) of the L-tryptophan operon was inactivated to obtain the recombinant strain K. oxytoca TRP-7. Subsequently, based on the recombinant strain K. oxytoca TRP-7, the expression of key genes for shikimic acid synthesis and key genes for L-tryptophan synthesis was enhanced to increase L-tryptophan accumulation levels. Specifically, the expression of the 3-dehydroquinic acid synthase encoding gene aroB (SEQ ID NO. 9), the shikimic acid dehydrogenase encoding gene aroE (SEQ ID NO. 11), the cladodesmoic acid synthase encoding gene aroC (SEQ ID NO. 13), and a portion of the tryptophan operon gene cluster trpE from E. coli W3110 was enhanced. fbr Expression of D (SEQ ID NO.15), tryptophan operon partial gene cluster trpDC (SEQ ID NO.17), tryptophan operon partial gene cluster trpBA (SEQ ID NO.19) and transketolase encoding gene tktA (SEQ ID NO.21).
[0187] In this experimental example, the gene integration and gene knockout were performed using a two-step homologous recombination technique, and the specific operation process is as described in Example 1 above. The aforementioned gene was introduced into the ldhD (SEQ ID NO. 10) site of the D-lactate dehydrogenase gene in the recombinant strain K. oxytoca TRP-7. Furthermore, in this experimental example, all the selected rate-limiting genes were integrated into different gene sites of K. oxytoca TRP-7, namely adhE (SEQ ID NO. 12), frdA (SEQ ID NO. 14), pflB (SEQ ID NO. 16), pox (SEQ ID NO. 18), pta (SEQ ID NO. 20), and pykF (SEQ ID NO. 22).
[0188] The obtained series of recombinant K. oxytoca were cultured in shake flasks for 60 h according to the culture method of Example 2, and the fermentation broth was analyzed for metabolites by high performance liquid chromatography (HPLC).
[0189] Table 4. Effects of expression of different rate-limiting genes on improving L-tryptophan production.
[0190]
[0191]
[0192] The results are shown in Table 4. In the recombinant strains obtained by enhancing different rate-limiting genes, the production of L-tryptophan was increased to varying degrees. Among them, the production of L-tryptophan was increased by enhancing trpE. fbr(S40F) The recombinant strain with the D rate-limiting gene (TRP-11) showed the best enhancement effect. Further, all the screened rate-limiting genes were integrated into different gene loci of K. oxytoca TRP-7, resulting in strain K. oxytoca TRP-22, which accumulated 10.1 g / L of L-tryptophan.
[0193] Experimental Example 5: Enhancing L-serine synthesis to improve L-tryptophan production
[0194] In the L-tryptophan synthesis pathway, L-serine participates in the reaction catalyzed by tryptophan synthase, which is the final step in L-tryptophan synthesis. Therefore, a sufficient supply of L-serine is beneficial for L-tryptophan production. However, L-serine synthesis is mainly limited by the strict feedback inhibition of 3-phosphoglycerate dehydrogenase by L-serine.
[0195] Therefore, this invention employs a two-step homologous recombination technique to incorporate the serA gene encoding the 3-phosphoglycerate dehydrogenase mutant protein from E. coli W3110 into the recombinant strain K. oxytoca TRP-22. fbr(H344A,N346A,N364A) (SEQ ID NO.23) was inserted into the site of the 2,3-butanediol dehydrogenase gene budC (SEQ ID NO.24) to obtain the recombinant strain K. oxytoca TRP-23.
[0196] The obtained recombinant K. oxytoca was cultured in shake flasks for 60 h according to the culture method in Example 2, and the fermentation broth was analyzed for metabolites by high performance liquid chromatography (HPLC).
[0197] Table 5. Effect of overexpression of feedback-insensitive 3-phosphoglycerate dehydrogenase on enhancing L-tryptophan production.
[0198]
[0199] The results are shown in Table 5. Overexpression of feedback-insensitive 3-phosphoglycerate dehydrogenase can increase the accumulation level of L-tryptophan. The obtained strain K. oxytoca TRP-23 was able to accumulate 12.2 g / L of L-tryptophan.
[0200] Experimental Example 6: Enhancing glutamine supply to increase L-tryptophan production
[0201] In the L-tryptophan synthesis pathway, cladonic acid is a key intermediate metabolite and a precursor to L-phenylalanine and L-tyrosine. However, cladonic acid mainly enters L-tryptophan synthesis via aminobenzoic acid synthase, a reaction that requires glutamine. Therefore, a sufficient supply of glutamine is beneficial for L-tryptophan production. This invention employs a two-step homologous recombination technique. Based on the recombinant strain K. oxytoca TRP-23, the glutamine synthase encoding gene glnA (SEQ ID NO. 25) from Corynebacterium glutamicum ATCC13032 is inserted into the 1,3-propanediol dehydrogenase gene dhaT (SEQ ID NO. 26), resulting in the recombinant strain K. oxytoca TRP-24.
[0202] The obtained recombinant K. oxytoca was cultured in shake flasks for 60 h according to the culture method in Example 2, and the fermentation broth was analyzed for metabolites by high performance liquid chromatography (HPLC).
[0203] Table 6. Effects of enhanced glutamine supply on increased L-tryptophan production
[0204]
[0205]
[0206] The results are shown in Table 6. The introduction of the heterologous glutamine synthase encoding gene glnA can increase the accumulation level of L-tryptophan. The obtained strain K. oxytoca TRP-24 can accumulate 13.0 g / L of L-tryptophan.
[0207] Example 7: Enhancing the L-tryptophan efflux pathway to improve L-tryptophan production
[0208] The activity and expression of key enzymes in the L-tryptophan synthesis pathway are subject to strict feedback inhibition by L-tryptophan. To alleviate this negative feedback effect, in addition to the known introduction of negative feedback-insensitive mutation sites in key enzymes, reducing the intracellular L-tryptophan concentration is also an important approach. Furthermore, excessively high intracellular L-tryptophan concentrations can also inhibit strain growth, while increasing L-tryptophan efflux can effectively reduce the intracellular L-tryptophan concentration. Therefore, this invention employs a two-step homologous recombination technique. Based on the recombinant strain K. oxytoca TRP-24, the aromatic amino acid efflux protein gene ywkB (SEQ ID NO. 27) from Bacillus subtilis 168 and the L-tryptophan efflux protein gene yddG from Escherichia coli W3110 were inserted into the glycerol dehydrogenase gene gldA (SEQ ID NO. 28), respectively, to obtain recombinant strains K. oxytoca TRP-25 and TRP-26.
[0209] The obtained series of recombinant K. oxytoca were cultured in shake flasks for 60 h according to the culture method of Example 2, and the fermentation broth was analyzed for metabolites by high performance liquid chromatography (HPLC).
[0210] Table 7. Effects of enhanced L-tryptophan efflux on improving L-tryptophan production
[0211]
[0212] The results are shown in Table 7. The introduction of heterologous L-tryptophan efflux proteins can increase the L-tryptophan accumulation level in recombinant strains. In particular, the strain K. oxytocaTRP-25, obtained by introducing the aromatic amino acid efflux protein gene ywkB, can accumulate more L-tryptophan, with a shake-flask fermentation yield of 14.0 g / L.
[0213] Experiment 8: Enhancing the expression of phosphoenolpyruvate carboxykinase to improve L-tryptophan production.
[0214] Phosphoenolpyruvate carboxykinase catalyzes the conversion of oxaloacetate to phosphoenolpyruvate, a precursor for L-tryptophan synthesis. Therefore, enhancing the expression of phosphoenolpyruvate carboxykinase may be beneficial for L-tryptophan production. This invention employs a two-step homologous recombination technique. Based on the recombinant strain K. oxytoca TRP-26, the phosphoenolpyruvate carboxykinase gene pck (SEQ ID NO. 29) from Bacillus subtilis 168 was inserted into the acetate kinase gene ackA (SEQ ID NO. 30) to obtain the recombinant strain K. oxytoca TRP-27.
[0215] The obtained recombinant K. oxytoca was cultured in shake flasks for 60 h according to the culture method in Example 2, and the fermentation broth was analyzed for metabolites by high performance liquid chromatography (HPLC).
[0216] Table 8. Effects of enhanced phosphoenolpyruvate carboxykinase expression on increased L-tryptophan production
[0217]
[0218]
[0219] The results are shown in Table 8. The strain K. oxytoca TRP-27 obtained by enhancing the expression of phosphoenolpyruvate carboxykinase was able to accumulate 14.6 g / L of L-tryptophan during shake-flask fermentation.
[0220] The above experimental examples demonstrate that, by incorporating the metabolic pathways of Klebsiella acidogenic bacteria and introducing key genes for L-tryptophan synthesis from different sources, the metabolic flux can be shifted from 2,3-butanediol to L-tryptophan. Further optimization of the L-tryptophan synthesis pathway, blocking of the L-tryptophan degradation pathway, enhancement of precursor supply, and screening of transport proteins significantly promote the stability of the L-tryptophan metabolic flux and the accumulation of products. Thus, a genetically engineered strain capable of efficiently producing L-tryptophan was obtained.
[0221] As can be seen from the above embodiments and experimental examples, the present invention provides a recombinant microorganism with high L-tryptophan production, its construction method, and its application. The present invention, through screening for gene knockout or addition, has selected a recombinant L-tryptophan-producing Klebsiella oxytoca TRP-27, with the genotype K. oxytoca CICC21518ΔbudA::ppsAΔbudB::aroG. fbr(D146N) ΔtnaAΔtrpL::P budABC ΔtrpRΔldhD::aroBΔadhE::aroEΔfrdA::aroCΔpflB::trpE fbr(S40F) DΔpox::trpDCΔpta::trpBAΔpykF::tktAΔbudC::serA fbr(H344A,N346A,N364A) The recombinant Klebsiella acidogenic bacteria of this invention can be used for the fermentation production of L-tryptophan. Experiments have confirmed that the engineered strain of this invention can efficiently produce L-tryptophan by metabolizing glucose, with a yield of 60.0 g / L and a efficiency of 0.23 g / g. This invention provides a method for achieving efficient microbial production of L-tryptophan by redirecting the metabolic flux of 2,3-butanediol synthesis to L-tryptophan synthesis via pyruvate. The L-tryptophan production process provided by this invention is simple, low-cost, and has significant economic and social benefits.
Claims
1. A recombinant microorganism for producing L-tryptophan, characterized in that: The starting strain of the recombinant microorganism was Klebsiella acidogenic bacteria (Klebsiella pneumoniae). Klebsiella oxytoca The recombinant microorganism inactivated α-acetolactate decarboxylase gene); budA Overexpression of genes including phosphoenolpyruvate synthase ppsA Tryptophan operon partial gene cluster trpE fbr D Gene.
2. The recombinant microorganism for producing L-tryptophan according to claim 1, characterized in that: The tryptophan operon partial gene cluster trpE fbr D The nucleotide sequence of the gene is shown in SEQ ID NO.
15.
3. The recombinant microorganism for producing L-tryptophan according to claim 1 or 2, characterized in that: The recombinant microorganism is constructed by further inactivating byproducts and / or enzyme genes in the 2,3-butanediol synthesis pathway based on the starting strain, and enhancing genes related to L-tryptophan synthesis flux; the byproducts are selected from at least one of acetic acid, formic acid, succinic acid, and lactic acid; The genes related to L-tryptophan synthesis flux are selected from the promoter P of the 2,3-butanediol synthesis gene cluster. budABC 3-Deoxy-D-arabinohepeptulose-7-phosphate synthase mutant protein encoding gene aroG fbr The gene encoding the mutant protein of 3-phosphoglycerate dehydrogenase serA fbr 3-Dehydroquinic acid synthase encoding gene aroB Shikimate dehydrogenase encoding gene aroE , branched acid synthase encoding gene aroC Tryptophan operon partial gene cluster trpDC, Partial gene cluster of tryptophan operon trpBA transketolase encoding gene tktA Aromatic amino acid efflux protein encoding gene ywkB Phosphoenolpyruvate carboxykinase gene pck Glutamine synthase encoding gene glnA L-tryptophan efflux protein gene yddG At least one of them; Among them, promoter P budABC Replace attenuator thrL .
4. The recombinant microorganism for producing L-tryptophan according to claim 3, characterized in that: The enzyme genes in the byproduct and / or 2,3-butanediol synthesis pathway are selected from the pyruvate kinase encoding gene. pykF pyruvate oxidase gene pox Phosphotransacetase gene pta Acetylkinase ackA Fumarate reductase subunit A gene frdA lactate dehydrogenase gene ldhD pyruvate formate lyase gene pflB Ethanol dehydrogenase gene adhE α-acetolactate synthase gene budB 2,3-Butanediol dehydrogenase gene budC glycerol dehydrogenase gene gldA、 1,3-Propanediol dehydrogenase gene dhaT At least one of them; Alternatively, the recombinant microorganism may further inactivate the tryptophanase-encoding gene. tnaA Transcriptional repressor of the tryptophan operon trpR attenuators of the tryptophan operon trpL At least one of them.
5. The recombinant microorganism for producing L-tryptophan according to claim 4, characterized in that: The enzyme genes in the byproduct and / or 2,3-butanediol synthesis pathway are selected from the pyruvate kinase encoding gene. pykF pyruvate oxidase gene pox Phosphotransacetase gene pta Acetylkinase ackA Fumarate reductase subunit A gene frdA lactate dehydrogenase gene ldhD pyruvate formate lyase gene pflB Ethanol dehydrogenase gene adhE α-acetolactate synthase gene budB 2,3-Butanediol dehydrogenase gene budC glycerol dehydrogenase gene gldA and 1,3-propanediol dehydrogenase gene dhaT ; Furthermore, the recombinant microorganism further inactivates the tryptophanase encoding gene. tnaA Transcriptional repressor of the tryptophan operon trpR attenuators of the tryptophan operon trpL .
6. The recombinant microorganism for producing L-tryptophan according to claim 3, characterized in that: The genes related to L-tryptophan synthesis flux are selected from the promoter P of the 2,3-butanediol synthesis gene cluster. budABC 3-Deoxy-D-arabinohepeptulose-7-phosphate synthase mutant protein encoding gene aroG fbr The gene encoding the mutant protein of 3-phosphoglycerate dehydrogenase serA fbr 3-Dehydroquinic acid synthase encoding gene aroB Shikimate dehydrogenase encoding gene aroE , branched acid synthase encoding gene aroC Tryptophan operon partial gene cluster trpDC, Partial gene cluster of tryptophan operon trpBA transketolase encoding gene tktA Aromatic amino acid efflux protein encoding gene ywkB Phosphoenolpyruvate carboxykinase gene pck Glutamine synthase encoding gene glnA and L-tryptophan efflux protein gene yddG .
7. The method for constructing the recombinant microorganism for producing L-tryptophan according to any one of claims 1-6, characterized in that, The construction method involves, based on the starting strain, inactivating the α-acetyllactate decarboxylase gene. budA Overexpression of genes including phosphoenolpyruvate synthase ppsA Tryptophan operon partial gene cluster trpE fbr D Genes; genes that further inactivate byproducts and / or enzyme genes in the 2,3-butanediol synthesis pathway, and genes that enhance L-tryptophan synthesis flux; the byproducts are selected from at least one of acetic acid, formic acid, succinic acid, and lactic acid; The genes related to L-tryptophan synthesis flux are selected from the promoter P of the 2,3-butanediol synthesis gene cluster. budABC 3-Deoxy-D-arabinohepeptulose-7-phosphate synthase mutant protein encoding gene aroG fbr The gene encoding the mutant protein of 3-phosphoglycerate dehydrogenase serA fbr 3-Dehydroquinic acid synthase encoding gene aroB Shikimate dehydrogenase encoding gene aroE , branched acid synthase encoding gene aroC Tryptophan operon partial gene cluster trpDC, Partial gene cluster of tryptophan operon trpBA transketolase encoding gene tktA Aromatic amino acid efflux protein encoding gene ywkB Phosphoenolpyruvate carboxykinase gene pck Glutamine synthase encoding gene glnA L-tryptophan efflux protein gene yddG At least one of them; Among them, promoter P budABC Replace attenuator thrL .
8. The use of the recombinant microorganism for producing L-tryptophan according to any one of claims 1-6 in the production of L-tryptophan.
9. The application according to claim 8, characterized in that: The recombinant microorganism described in claim 1 is cultured in a glucose-containing fermentation medium to obtain the product.
10. The application according to claim 9, characterized in that: The concentration of glucose in the fermentation medium is 80-100 g / L; And / or, the inoculum size of the recombinant microorganism during cultivation is 5-10% by volume; And / or, the stirring speed during the culture is 500-1000 rpm; and / or, the pH during the culture is 6.8±0.1; and / or, the temperature during the culture is 37±0.5℃; and / or, the culture time is 40-60 hours.
Citation Information
Patent Citations
TrpE mutant and application thereof in genetically engineered bacteria for producing L-tryptophan
CN111926002A
Escherichia coli tryptophan synthesis strain capable of reducing generation of acetic acid
CN116536231A