Marine-derived carboxylesterase and application thereof in degradation of PET (Polyethylene Terephthalate) plastic

By efficiently expressing the carboxylesterase RbCE1 identified and optimized from thermophilic microorganisms in Escherichia coli, the problems of insufficient substrate specificity and low catalytic efficiency of existing PET hydrolases were solved, efficient biodegradation of PET plastics was achieved, and the industrial recycling of PET was promoted.

CN120683076APending Publication Date: 2025-09-23SOUTH CHINA SEA INST OF OCEANOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510826388.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-19
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing PET hydrolases have insufficient substrate specificity and low catalytic efficiency under mild conditions, which limits the industrial recycling application of PET plastics.

Method used

A new carboxylesterase RbCE1 was identified from the thermophilic microorganism Rhodothermus bifroesti strain and efficiently expressed in Escherichia coli. Its gene sequence and protein structure were optimized to achieve efficient PET degradation.

Benefits of technology

RbCE1 is highly expressed in Escherichia coli, has good thermal stability and the ability to efficiently degrade PET plastics, significantly reducing production costs and increasing the industrial application potential of PET biodegradation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683076A_ABST
    Figure CN120683076A_ABST
Patent Text Reader

Abstract

The invention discloses a marine-derived carboxylesterase and an application of the marine-derived carboxylesterase in degradation of PET (Polyethylene Terephthalate) plastics. The amino acid sequence of the enzyme is as shown in SEQ ID NO.1, experiments show that Tm of RbCE1 is 79.5 DEG C, 40 mM of depolymerization monomers can be generated after the enzyme treats low-crystallinity PET powder at 60 DEG C for 4 hours, the catalytic activity is equivalent to that of LCC, and good degradation activity is shown. Through escherichia coli heterologous expression, 0.4 g / L high expression quantity can be achieved in a shake flask, and the potential of remarkably reducing the enzyme production cost is achieved. Therefore, the novel carboxylesterase RbCE1 is suitable for degrading PET plastics and composite materials thereof, and is a potential enzyme preparation for efficient biological catalysis of a waste PET plastic waste enzymatic depolymerization recovery treatment process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical field:

[0001] The invention belongs to the technical field of enzyme engineering, and particularly relates to a marine-derived carboxylesterase and application thereof in degrading PET plastic. Background technology:

[0002] Polyethylene terephthalate (PET) is the world's most produced and widely used polyester material, with an annual output exceeding 70 million tons. Due to its excellent mechanical properties, chemical stability, transparency, and lightweight properties, PET is widely used in food packaging (such as beverage bottles), textile fibers (such as polyester), film materials, and medical devices. However, traditional PET waste is primarily disposed of by landfill or incineration, which not only causes serious environmental pollution and resource waste, but also exacerbates the problems of microplastics and carbon emissions.

[0003] In recent years, enzymatic degradation technology has become a research hotspot in the field of PET waste recycling due to its advantages, including mild reaction conditions (ambient temperature and pressure), high selectivity, low energy consumption, and environmental friendliness. The core of this technology lies in the efficient depolymerization of PET into monomers such as terephthalic acid (TPA), monoethylene glycol terephthalate (MHET), and ethylene glycol (EG) using PET hydrolases (such as cutinases and esterases) under mild conditions (e.g., 40-80°C and neutral or slightly alkaline pH). These degradation products can be further purified and repolymerized to produce recycled plastics with properties comparable to petroleum-based PET, thus achieving a closed-loop circular economy model of "plastic → monomer → plastic" and significantly reducing dependence on fossil feedstocks. Compared to traditional mechanical recycling (downcycling) and chemical depolymerization (high temperature, high pressure, strong acid and strong base), enzymatic recycling offers significant advantages, including high product purity, low energy consumption, and no secondary pollution. It is considered the most promising green technology for the sustainable recycling of PET in the future.

[0004] Current studies have shown that some members of the cutinase, lipase, and esterase families can depolymerize PET plastics under mild conditions. However, these hydrolases generally suffer from insufficient substrate specificity, low catalytic efficiency, and low yield, which severely limit their industrial application value. To promote the green recycling of PET plastics, the development of new PET hydrolases with high thermal stability, high degradation efficiency, and good expression characteristics has become a research focus. Due to their unique living environment, thermophilic microorganisms generally have excellent thermal stability in their metabolic enzyme systems, making them an important resource for the discovery of high-performance PET hydrolases. Based on this, this study successfully identified a new carboxylesterase RbCE1 from the Rhodothermus bifroesti strain through a systematic analysis of microbial genomes and metagenomic data from extreme thermophilic environments in the ocean (including deep-sea hydrothermal vents and volcanic vents). Summary of the invention:

[0005] The first object of the present invention is to provide a carboxylesterase, the amino acid sequence of which is shown in SEQ ID NO.1.

[0006] The second object of the present invention is to provide a gene encoding the above-mentioned carboxylesterase, preferably, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0007] The third object of the present invention is to provide a recombinant vector containing the above encoding gene.

[0008] The fourth object of the present invention is to provide a recombinant engineered bacterium containing the above-mentioned recombinant vector.

[0009] Preferably, the recombinant engineered bacteria is Escherichia coli.

[0010] Preferably, the Escherichia coli is BL21(DE3).

[0011] A fifth object of the present invention is to provide the use of the above-mentioned carboxylesterase, the gene encoding the carboxylesterase, the above-mentioned recombinant vector or the above-mentioned recombinant engineered bacteria in the degradation of polyethylene terephthalate or plastic materials containing PET.

[0012] A sixth object of the present invention is to provide a method for degrading polyethylene terephthalate or a plastic material containing PET, wherein the method comprises using the above-mentioned carboxylesterase, the above-mentioned recombinant vector or the above-mentioned recombinant engineered bacteria to carry out the reaction.

[0013] Preferably, the ratio of carboxylesterase to substrate is 2 mg (enzyme) / g (PET).

[0014] Based on gene function prediction, protein structure simulation and molecular docking technology, the present invention successfully screened out carboxylesterase RbCE1 with efficient PET degradation activity. Its expression level in Escherichia coli is much higher than that of currently reported wild PET hydrolases, showing better industrial application potential in terms of reducing production costs and improving production efficiency, providing a more economical enzyme preparation solution for the industrial application of PET biodegradation.

[0015] Beneficial effects:

[0016] 1. The carboxylesterase RbCE1 described in this invention possesses the following significant advantages: 1) efficient heterologous expression in an E. coli expression system; 2) excellent thermal stability with an optimal reaction temperature of 60°C; and 3) excellent degradation efficiency for PET plastics. Experimental data demonstrate that RbCE1 exhibits significant degradation activity against low-crystallinity PET at 60°C, with a catalytic efficiency far exceeding that of most reported wild-type PET plastic hydrolases. These properties hold great promise for the application of RbCE1 in the industrial enzymatic recycling of PET plastics.

[0017] 2. Based on gene function prediction, protein structure simulation, and molecular docking technology, the present invention successfully screened out the carboxylesterase RbCE1 with efficient PET degradation activity. Its expression level in Escherichia coli is much higher than that of currently reported wild PET hydrolases, showing greater industrial application potential in terms of reducing production costs and improving production efficiency, providing a more economical enzyme preparation solution for the industrial application of PET biodegradation. Description of the drawings:

[0018] Figure 1 This is the result of docking of carboxylesterase RbCE1 and 3PET molecules in Example 1.

[0019] Figure 2 These are the characteristics of carboxylesterase RbCE1 in Example 4 (A, temperature tolerance; B, pH tolerance; C, salinity tolerance).

[0020] Figure 3 This is the expression of the carboxylesterase RbCE1 protein in Example 3 (1 is the whole cell culture medium, 2 is the precipitated cells, and 3 is the purified protein RbCE1).

[0021] Figure 4 This is a comparison of the amount of depolymerized monomers of low-crystallinity PET powder by carboxylesterase RbCE1 at different times in Example 5 (1, 2, 3, and 4 represent time, in hours). Specific implementation method:

[0022] Specific molecular biology experimental methods are not described in the following examples. All experiments were performed with reference to the specific methods listed in the book "Molecular Cloning Laboratory Manual" (3rd edition) by J. Sambrook, or according to the kits and product instructions.

[0023] The following definitions are used in the present invention:

[0024] 1. Nomenclature of amino acid and DNA nucleotide sequences

[0025] The generally accepted IUPAC nomenclature for amino acid residues is used, using the three-letter code. The generally accepted IUPAC nomenclature for DNA nucleotide sequences is used.

[0026] The present invention will be further explained below with reference to the accompanying drawings and embodiments.

[0027] Example 1: Carboxylesterase sequence mining and structural analysis

[0028] Enzymes derived from thermophiles possess high catalytic activity and high-temperature stability, making them an important source of industrial enzyme preparations. First, genomic and metagenomic data from microorganisms originating from high-temperature marine environments were collected from the NCBI website. The EC numbers of the microbial genomic sequences were predicted using the CLEAN website (https: / / clean.platform.moleculemaker.org / ). Subsequently, structural predictions were performed for the hydrolase (EC 3.1) group. Molecular docking of 3PET molecules with the predicted structures was performed to score candidate sequences. Sequence analysis revealed that one of the sequences (from Rhodothermus bifroesti, tentatively named RbCE1) belongs to the carboxylesterase superfamily of α / β hydrolases, containing the catalytic triad Ser-His-Asp and the conserved GXSXG structure, and possessing one disulfide bond (C3-C5). The NCBI database found that the maximum amino acid sequence similarity between RbCE1 and the esterase from Thermotoga maritima was 36% (PDB: 3DOH). RbCE1 has a narrow substrate binding groove and a lid domain, which can bind well to the 3PET substrate ( Figure 1 ), which is an important part in its catalytic activity.

[0029] The amino acid sequence of carboxylesterase RbCE1 is shown in SEQ ID NO.1, specifically:

[0030]

[0031]

[0032] Example 2: Construction of a carboxylesterase-producing engineered strain

[0033] The carboxylesterase RbCE1 sequence was codon-optimized and sent to Tianyi Huiyuan (Guangzhou) Biotechnology Co., Ltd. for synthesis. The gene sequence is shown in SEQ ID NO. 2. Following gene synthesis, a six-histidine-encoding gene was added to the C-terminus of the sequence and ligated between the EcoRI-HindIII cloning sites of the pET-21a plasmid to generate pET-21a-RbCE1. Four μL of the constructed plasmid pET-21a-RbCE1 was added to 100 μL of E. coli BL21(DE3) competent cells. The cells were incubated on ice for 30 minutes, then heat-shocked at 42°C for 90 seconds and incubated on ice for 5 minutes. The E. coli cells were then plated onto LB culture plates containing ampicillin (100 μg / mL) and incubated at 37°C for 12 hours. Single colonies were selected for sequencing verification. Successful colonies were identified as genetically engineered BL21(DE3) / RbCE1 cells containing the carboxylesterase.

[0034] SEQ ID NO.2 (Nucleotide sequence of carboxylesterase RbCE1) is as follows:

[0035] GAATTC CAGGATTGTCCATGTGCACGTCAGGTTGGTTTTTTATTACGTACTGTTGAAGTTAACGGTCAGACCCATCGTTATCAGGTTTATGTTCCCGCCGATTATACCCCAGATCAGAAATGGCCAGTTATTTTATTTCTTCATGGTGCGGGTGAGCGTGGCGTTGATGGTTTTAAACAGACAGCAGTTGGTATTGGTCAGGCGATTCGTTTAGATCCGACGAGATTTCCGGCAATTGTTGTTTTTCCGCAGGTTCCTCCTGGTAAAGCATGGTTTGGTGAGCAGGCAGAAGTGGCAATGGCAGCACTGGATGCAGTTATGGCAACCTATAGCGTTGACCCGGATAGAGTTTATCTGACCGGTTTAAGTATGGGTGGTCATGGAACCTGGTATGTTGCATATCATTATCCGGATCGGTTTGCAGCAATTGTTCCGATTTGTGGTTTTGTTGTTTTTCCTGAGACAAGTCGGAGCTTTTTTGGTGAGCTGCCGCCGGAACAGCAGGCGATTCAGAGTGCGGCAGATCCTTATGCAAAAGTTGCAGAGCGTATTAAGCATTTACCGGTTTGGGTTTTTCATGGGGCAGATGATCCGGTTGTTCCGGTGGAAGCCAGCCGTCGTATGGTTGAAGCATTAAAAGCACTGGGTGCAGAAGTGCAGTATACCGAGTACAACGGCGTTGGTCATAATGCCTGGGATCCGGCGTATGCAGAAGCAGAACTGATGCCGTGGCTTCTTGCAAAAAGACGTGGCCAGAAA AAG CTT

[0036] Example 3: Preparation of novel carboxylesterase RbCE1 protein

[0037] The genetically engineered bacteria BL21 (DE3) / RbCE1 was inoculated into a 2YT liquid culture medium (16 g of tryptone, 10 g of yeast powder, 5 g of NaCl, 1000 mL of ultrapure water) containing ampicillin (100 μg / mL) at a volume ratio of 2%, and cultured at 37°C, 180 rpm / min with shaking until the OD600 was 0.6-0.8; then IPTG was added at a final concentration of 1 mM and cultured at 16°C with shaking for 20 hours. The cells were collected by centrifugation at 8000 r / min for 10 minutes at 4°C (13.6 g of wet cells were collected in 1000 mL of culture medium), washed 3 times with phosphate buffer (50 mM Na2HPO4, 50 mM NaCl, pH 8.0), resuspended and ultrasonically disrupted, and then centrifuged at 4°C, 10000 r / min to remove the precipitate. The supernatant obtained was the crude enzyme solution. The crude enzyme solution was treated with Ni 2+ Protein purification was performed using an affinity chromatography column, eluted with an imidazole gradient, and the eluate was collected. The eluate was then replaced with a 50 mM pH 8.0 phosphate buffer using a 10 kDa ultrafiltration tube to obtain the purified protein RbCE1. The concentration of the concentrated protein was detected using an ultra-micro protein detector. 10 μL of 5X protein loading buffer was added to the induced cell culture medium (40 μL), the precipitate collected after disruption (40 μL of ultrapure water added to 10 mg of solid), and the purified target protein solution (40 μL), respectively. The mixture was boiled at 100 ° C for 10 min, and the purity of the protein was tested by SDS-PAGE ( Figure 3 ), and determine the amount of target protein and protein solubility in the whole cell culture medium and cell pellet after disruption.

[0038] Through quantitative determination of the purified carboxylesterase RbCE1, it was found that the expression level of carboxylesterase RbCE1 in the shake flask exceeded 0.4g / L (100mL of purified protein with a concentration of 4mg / mL was obtained in 1L of culture medium), which exceeded the currently reported wild PET hydrolase production. This can significantly reduce the production cost of enzyme preparations, and thus provide an important basis for promoting the industrial enzymatic recovery of PET plastics.

[0039] Example 4: Characteristics of the novel carboxylesterase RbCE1 protein

[0040] The tolerance test of carboxylesterase's optimal reaction temperature, pH, salinity and other enzymatic characteristics was carried out according to the following steps:

[0041] 15 mg of PET powder (crystallinity 10.7%) was weighed and placed in a 2 mL EP tube. 0.5 mL of 0.2 M phosphate solution (pH 8.0) and 30 μg of purified carboxylesterase (Example 3) were then added (material ratio 2 mg / g PET). The reaction was carried out at 40, 50, 60, 65, and 70° C. for 2 h to study the effect of temperature on the catalytic activity of the enzyme. Subsequently, according to the above method, the effect of buffer solutions of different pH on the catalytic activity was selected (a 0.2 M citric acid-sodium citrate system was used for the pH 4-6 buffer solution; a 0.2 M disodium hydrogen phosphate-sodium dihydrogen phosphate system was used for the pH 6-9 buffer solution; and a 0.2 M disodium hydrogen phosphate-sodium hydroxide system was used for the pH 10-11 buffer solution). The reaction was carried out at 60° C. for 2 h. To study the effect of salinity on enzyme activity, 0.2 M phosphate buffer (pH 8.0) was used as the base solution, and 0.5, 1.0, 2.0, 3.0, and 4.0 M NaCl were supplemented to obtain phosphate buffer solutions with different salt concentrations. The reaction was carried out at 60°C for 2 h to evaluate the effect of salinity on the catalytic activity.

[0042] Comparison of the catalytic activity of the enzyme under different reaction conditions revealed that the optimal reaction temperature for carboxylesterase RbCE1 is 60°C, the optimal pH is 9.0, and the optimal salinity is a buffer solution containing 1M NaCl. The Tm of RbCE1 is 79.5°C. The enzyme's weak alkalinity and salt tolerance are highly similar to those found in marine environments, indicating its adaptability to thermophilic marine environments.

[0043] Example 5: Analysis of the Degradation Efficiency of PET Plastics by Carboxylesterase RbCE1

[0044] The degradation experiment of PET powder by carboxylesterase RbCE1 was carried out according to the following steps:

[0045] PET powder degradation experimental procedures: 15 mg of PET powder (10.7% crystallinity) was weighed and placed in a 2 mL EP tube. 0.5 mL of 1 M phosphate solution (pH 8.5) and 30 μg of purified carboxylesterase (Example 3) were then added, with a material ratio of 2 mg / g PET. A control group was treated with 0.5 mL of 1 M phosphate solution (pH 8.5) and 15 mg of PET powder. Three replicates were set up for each treatment. The EP tubes were placed in a water bath at 60°C, and PET degradation products were detected. The reaction was terminated by adding methanol, and depolymerization products were then detected.

[0046] PET degradation product detection process: Take 20 μL of the reaction solution, dilute it 50-fold with ultrapure water, filter it through a 0.22 μm aqueous filter, and set aside. Shimadzu HPLC was used to determine the composition of TPA, MHET, and BHET. The column was a Zorbax SB-C18 ODS (4.6 x 150 mm, 5 μm), and the detection wavelength was 260 nm. Mobile phase A was deionized water containing 0.1% (v / v) formic acid; mobile phase B was 100% acetonitrile. Detection was performed at a flow rate of 0.8 mL / min, an A:B ratio of 70%:30%, and a column temperature of 40°C.

[0047] At 60°C and pH 8.5, it was found that carboxylesterase RbCE1 depolymerized PET plastics in 4 h to generate 40 mM depolymerized monomers MHET and TPA ( Figure 4 ), showing efficient PET hydrolase activity. The high expression level and catalytic efficiency of this enzyme provide a candidate enzyme preparation for the industrial depolymerization of waste PET plastics.

[0048] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A carboxylesterase, characterized in that Its amino acid sequence is shown in SEQ ID NO.

1.

2. A gene encoding the carboxylesterase according to claim 1.

3. The coding gene according to claim 2, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

2.

4. A recombinant vector containing the coding gene according to claim 2.

5. A recombinant engineered bacterium containing the recombinant vector according to claim 4.

6. The recombinant engineered bacterium according to claim 5, characterized in that The recombinant engineering bacteria is Escherichia coli.

7. The recombinant engineered bacterium according to claim 6, characterized in that The Escherichia coli is Escherichia coli BL21 (DE3).

8. A product comprising the carboxylesterase according to claim 1, the gene encoding the carboxylesterase according to claim 2, the recombinant vector according to claim 4, or the recombinant engineered bacterium according to claim 5.

9. Use of the carboxylesterase according to claim 1, the recombinant vector according to claim 4, or the recombinant engineered bacterium according to claim 5 in the degradation of polyethylene terephthalate or plastic materials containing PET.

10. A method for degrading polyethylene terephthalate or a substance containing PET plastic, characterized in that: The carboxylesterase according to claim 1, the recombinant vector according to claim 4 or the recombinant engineered bacteria according to claim 5 are reacted with PET.

Citation Information

Cited By

  • Marine metagenome-sourced low-temperature salt-tolerant hydrolase for efficiently degrading PET (polyethylene terephthalate) plastic and application thereof

    CN121555468A