Multi-detection method for five-target pathogenic fungi based on qPCR and dPCR technologies
By combining qPCR and dPCR technologies and designing specific primers and fluorescent probes, the problems of long fungal detection time, low sensitivity and insufficient specificity in existing technologies have been solved, and efficient and accurate quantitative detection of multiple fungi has been achieved.
Patent Information
- Application Number
- CN202510907928.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-02
- Publication Date
- 2025-09-23
AI Technical Summary
In the existing technology, fungal detection methods based on single-gene detection have problems such as long time period, low sensitivity and insufficient specificity, making it difficult to accurately quantify multiple clinically important yeast-like pathogenic fungi at the same time.
Using a combination of qPCR and dPCR techniques, specific primers and fluorescent probes were designed for the simultaneous detection of Candida auris, Cryptococcus gattii, Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis. The detection specificity and sensitivity were improved through the design of primer combinations and probes.
It achieved high specificity and high sensitivity detection of five fungi, was able to identify target sequences from gene templates that differed by only one nucleotide, and was capable of accurate quantification, with a detection limit of 6 copies/reaction.
Smart Images

Figure CN120683302A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological detection technology, and specifically to a fungus detection method based on a combination of fluorescent quantitative polymerase chain reaction (qPCR) and digital polymerase chain reaction (dPCR) technology, which is used to simultaneously detect and accurately quantify five clinically important yeast-like pathogenic fungi. Background Art
[0002] Invasive fungal infections are a leading cause of death in immunocompromised patients. Currently, common pathogenic fungi in clinical practice include but are not limited to Candida auris, Cryptococcus gattii, Cryptococcus neoformans, Histoplasma capsulatum, Coccidiodes immitis, and Paracoccidioides brasiliensis.
[0003] Currently, commercial kits for detecting the five pathogenic fungi mentioned above are available for real-time fluorescence quantitative PCR methods for individual pathogens. However, these methods can only detect single genes and require a long time to accurately quantify.
[0004] The prior art CN116837136A discloses a composition for detecting invasive fungi, which solves the problem of long detection time period for a single fungus species. However, this patent only uses the qPCR method for the detection of Fusarium, Histoplasma capsulatum, Mucorales fungi, and Cryptococcus, and the detection sensitivity of this patent is low, at 500 copies / mL.
[0005] The prior art CN119410835A discloses a composition for respiratory fungal infections, which solves the problem of time-consuming single detection. However, this patent only uses the qPCR method for the detection of Blastomyces dermatitidis, Paracoccidioides brasiliensis, Histoplasma capsulatum, and Scedosporium. However, this patent lacks specificity, and the Paracoccidioides brasiliensis amplification primers can also amplify Blastomyces dermatitidis. Summary of the Invention
[0006] The purpose of the present invention is to provide a five-fold fungal detection kit for combined qPCR and dPCR detection. Using five fungal-specific targets, it can simultaneously detect and accurately quantify five important yeast-like pathogenic fungi in clinical samples, including Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis and Paracoccidioides brasiliensis, overcoming the problems of traditional fungal detection methods such as long cycle, inability to perform accurate quantification, low sensitivity, and insufficient specificity.
[0007] To this end, the first aspect of the present invention is to provide upstream and downstream primer combinations for fungal qPCR detection and dPCR multiplex detection. The gene sequences of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis were obtained from the NCBI gene database. The upstream and downstream primers designed are as follows: The upstream primer of Candida auris (abbreviated as Candida-F) is shown in SEQ ID NO.1: 5´CAGCCTTGGTGAGCTTTGTT3´ The Candida auris downstream primer (abbreviated as Candida-R) is shown in SEQ ID NO.2: 5´CTCAGACTCGGACTCTCCAC3´ The Cryptococcus gattii (Cryptococcus neoformans) upstream primer (abbreviated as Cryptococcus gattii (Cryptococcus neoformans)-F) is shown in SEQ ID NO.4: 5´CCACCACAATCCTGCAACAA3´ The Cryptococcus gattii (Cryptococcus neoformans) downstream primer (abbreviated as Cryptococcus gattii (Cryptococcus neoformans)-R) is shown in SEQ ID NO.5: 5´CGCAATCGGGCTTGTAGAAA3´ Histoplasma capsulatum-F: (SEQ ID NO.7) 5'TTCCGTGCAGAAAATTCG3' Histoplasma capsulatum -R: (SEQ ID NO.8) 5´GATCCAATGTCCGTTCAC3´ The upstream primer of Coccidioides immitis (abbreviated as Coccidioides immitis-F) is shown in SEQ ID NO.10: 5'TGCCATGGTAATCCTGCTCA3' The downstream primer of Coccidioides immitis (abbreviated as Coccidioides immitis-R) is shown in SEQ ID NO.11: 5'CCTCAGCCAAGCACATACAC3' Paracoccidioides brasiliensis-F: (SEQ ID NO.13) CCTCGACACATACCACAACC Paracoccidioides brasiliensis-R: (SEQ ID NO.14) GCACCGCTCCACTCTTTC.
[0008] In the above description, the molar concentration ratio of the upstream primer to the downstream primer for the five bacterial species was 1:1, and the amount added to the reaction system was 200 nM. When the kit was used for five-plex real-time fluorescence quantitative PCR detection of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis, the specificity was higher, reaching 100%.
[0009] As a second aspect, the present invention also relates to a kit for a multiplex detection method for five target pathogenic fungi. The kit comprises the aforementioned primer combination and fluorescent probes for detecting Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis. The probes designed were obtained from the NCBI gene database using the gene sequences of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis. The Candida auris fluorescent probe (abbreviated as Candida-P) is shown in SEQ ID NO.3: VIC 5´ACCCAACTCACCAATTGGTACGTCCG3´BHQ1 The Cryptococcus gattii (Cryptococcus neoformans) fluorescent probe (abbreviated as Cryptococcus gattii (Cryptococcus neoformans)-P) is shown in SEQ ID NO.6: FAM 5´CGCAGGATCCCGACGCCGCT3´BHQ1 Histoplasma capsulatum-P: (SEQ ID NO.9) Texas Red 5´CCAAGCCACCGATACAGTTCTCT3´ BHQ2 The Coccidioides immitis fluorescent probe (abbreviated as Coccidioides immitis-P) is shown in SEQ ID NO.12: Cy5 5´TCTGAACCTGCGGGTTCCTCTCGT3´BHQ2 Paracoccidioides brasiliensis-P: (SEQ ID N0.15) Cy5 .5 5´CAATCAACGGCTTATCGGCTCCTCT3´BHQ2 In the above, the fluorescent groups and quenching groups of the five bacteria are: The Candida auris fluorescent probe, the probe 5 'labeled with a fluorescent group VIC, 3 'labeled with a quenching group BHQ1; The Cryptococcus neoformans fluorescent probe, the probe 5 'labeled with a fluorescent group FAM, 3 'labeled with a quencher group BHQ1; The capsular Histoplasma fluorescent probe, the probe 5 'labeled with the fluorescent group Texas Red, 3 'labeled with the quencher group BHQ2; The Coccidioides immitis fluorescent probe, the probe 5 'labeled with a fluorescent group Cy5, 3 'labeled with a quencher group BHQ2; The Paracoccidioides brasiliensis fluorescent probe is 5' labeled with a fluorescent group Cy5.5 and 3' labeled with a quenching group BHQ3.
[0010] In the above, the molar concentration ratio of the probe to the upstream primer for the five bacteria was 1:2, and the amount added to the reaction system was 100 nM. Thus, when the kit was used for five-fold real-time fluorescence quantitative PCR detection of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis, the specificity was higher and the sensitivity was better.
[0011] In the above, the present invention provides qPCR premix and quality control reagents, The main components of the qPCR premix are Taq enzyme, buffer, dNTP, Mg 2+ , nuclease-free water, etc.; The positive quality control is: the concentration of 5×10 7 The plasmids of ITS gene of Candida auris, CAP59 gene of Cryptococcus gattii (Cryptococcus neoformans), Hcp100 gene of Histoplasma capsulatum, ITS gene of Coccidioides immitis and GP43 gene of Paracoccidioides brasiliensis were mixed in the same volume at a ratio of 1:1:1:1:1 to prepare the positive quality control. The plasmid concentration of the mixed positive quality control was 1×10 7 copies / mL; The negative quality control was DEPC water.
[0012] A third aspect of the present invention is a multiplex detection method for five-target pathogenic fungi using qPCR and dPCR techniques, characterized in that the detection method is used for a kit to detect five-target pathogenic fungi, wherein the detection method comprises the following steps: (1) The plasmids carrying the ITS gene of Candida auris, the plasmids carrying the CAP59 gene of Cryptococcus gattii (Cryptococcus neoformans), the plasmids carrying the Hcp100 gene of Histoplasma capsulatum, the plasmids carrying the ITS gene of Coccidioides immitis and the plasmids carrying the GP43 gene of Paracoccidioides brasiliensis were mixed in the same volume at a ratio of 1:1:1:1:1 to prepare a standard. DNA was extracted from the standard using an extraction reagent. The number of copies was 10. 0 , 10 1 , 10 2 , 10 3 , 104 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 The samples were serially diluted at 100 copies / μL and used as templates, i.e., the samples to be tested. A qPCR reaction program was created, and qPCR detection was performed using the above primers and fluorescent probes. After the detection, the concentration log value of each standard (X-axis) was plotted against its corresponding Ct value (Y-axis) to draw a standard curve. (2) According to the change and intensity of the fluorescence signal, the five genes in the sample to be tested are detected. The fluorescence amplification curve in the FAM channel indicates that the sample contains the CAP59 gene of Cryptococcus gattii; the fluorescence amplification curve in the VIC channel indicates that the sample contains the ITS gene of Candida auris; the fluorescence amplification curve in the TexasRed channel indicates that the sample contains the Hcp100 gene of Histoplasma capsulatum; the fluorescence amplification curve in the Cy5 channel indicates that the sample contains the ITS gene of Coccidioides immitis; the fluorescence amplification curve in the Cy5.5 channel indicates that the sample contains the GP43 gene of Paracoccidioides brasiliensis. No fluorescence amplification curve appears, indicating that the sample does not contain the above five genes. Then, based on the fluorescence signal intensity of the sample and the standard curve, the copy number of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis DNA contained in the sample to be tested is obtained; (3) Absolute quantification curve: The DNA extracted from the standard sample in step (1) was quantified according to the copy numbers of 1.5, 3, and 6 × 10 0 , 6×10 1 , 6×10 2 , 6×10 3 , 6×10 4 The samples were serially diluted at 100 copies / µL and used as templates, i.e., the samples to be tested. A dPCR reaction program was created, and dPCR detection was performed using the above primers and fluorescent probes. After the test, the Log value of the theoretical dilution concentration of each standard (X-axis) was plotted against the Log value of the actual detection concentration (Y-axis) to draw an absolute quantitative standard curve. The qPCR detection reaction procedure is: Pre-denaturation at 95°C for 1 minute; 95°C for 5 seconds, 58°C for 15 seconds, for a total of 40 cycles; The dPCR detection reaction procedure is: Pre-denaturation at 95°C for 5 minutes; 45 cycles of 95°C for 15 seconds and 58°C for 30 seconds.
[0013] Summary: The beneficial effects of the present invention are: 1. High specificity: The present invention provides a five-plex qPCR kit and primer and probe combination for dPCR detection of five target pathogenic fungi. When using this primer combination for five-plex qPCR detection of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis, the corresponding target sequence can be found and amplified from genetic samples that differ by only one nucleotide. 2. Absolute quantification: Combining qPCR technology and dPCR technology can achieve accurate quantification; 3. High sensitivity: When performing five-plex dPCR testing, the minimum detection rate is 6 copies / reaction, so the sensitivity is high.
[0014] In summary, the technology for rapid detection and identification of five pathogenic fungi in the present invention has the advantages of high sensitivity, strong specificity, simple operation, and low cost. It can be used to assist in the clinical rapid diagnosis of pathogenic fungal infection and provide a reference basis for clinical treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 qPCR specific detection results of primers and probes designed for the ITS gene region of Candida auris, the CAP59 gene region of Cryptococcus gattii and Cryptococcus neoformans, the Hcp100 gene region of Histoplasma capsulatum, the ITS gene region of Coccidioides immitis, and the GP43 gene region of Paracoccidioides brasiliensis according to the embodiments of the present invention; Figure 2 This is a physical map of the recombinant vector PUC57-C.auris carrying the Candida ITS gene according to an embodiment of the present invention; Figure 3 This is a physical map of the recombinant vector PUC57-C.gattii carrying the CAP59 gene of Cryptococcus neoformans according to an embodiment of the present invention; Figure 4 This is a physical map of the recombinant vector PUC57-H.capsulatum carrying the Histoplasma capsulatum Hcp100 gene according to an embodiment of the present invention; Figure 5 This is a physical map of the recombinant vector PUC57- C. immitis carrying the ITS gene of Coccidioides immitis according to an embodiment of the present invention; Figure 6 This is a physical map of the recombinant vector PUC57-P. brasiliensis carrying the GP43 gene of Paracoccidioides brasiliensis according to an embodiment of the present invention; Figure 7 is an amplification curve of real-time fluorescence quantitative PCR using a Candida auris standard plasmid as a template according to an embodiment of the present invention; Figure 8is an amplification curve of real-time fluorescence quantitative PCR using a standard plasmid of Cryptococcus gattii as a template according to an embodiment of the present invention; Figure 9 This is an amplification curve of real-time fluorescence quantitative PCR using a capsular tissue cytoplasm standard plasmid as a template according to an embodiment of the present invention; Figure 10 This is an amplification curve of real-time fluorescence quantitative PCR using a Coccidioides immitis standard plasmid according to an embodiment of the present invention, wherein; Figure 11 is an amplification curve of real-time fluorescence quantitative PCR using a standard plasmid of Paracoccidioides brasiliensis according to an embodiment of the present invention; Figure 12 Fluorescence amplification curve of real-time fluorescence quantitative PCR performed using a mixed plasmid of Candida auris standard plasmid, Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, capsular tissue cytoplasm standard plasmid, Coccidioides immitis, and Paracoccidioides brasiliensis standard plasmid in the same volume at a ratio of 1:1:1:1:1 as a template in an embodiment of the present invention; Figure 13 The standard curve of real-time fluorescence quantitative PCR is performed using a mixed plasmid of Candida auris standard plasmid, Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, capsular tissue cytoplasm standard plasmid, Coccidioides immitis, and Paracoccidioides brasiliensis standard plasmid as a template in the embodiment of the present invention; Figure 14 Specificity test results of the five-plex dPCR detection method according to an embodiment of the present invention, wherein Fluorophore represents fluorescence intensity, the abscissa represents sample number, and the middle line represents the threshold line; Figure 15 This is a droplet image of one-dimensional amplification of Candida auris using a standard plasmid of Candida auris, a standard plasmid of Cryptococcus gattii (Cryptococcus neoformans), a standard plasmid of histoplasmosis, a standard plasmid of Coccidioides immitis, and a standard plasmid of Paracoccidioides brasiliensis at the same volume in a ratio of 1:1:1:1:1 as a template for a quintuple dPCR reaction according to an embodiment of the present invention; Figure 16 This is an image of a one-dimensional amplification droplet of Cryptococcus gattii using a Candida auris standard plasmid, a Cryptococcus neoformans standard plasmid, a capsular tissue cytoplasm standard plasmid, Coccidioides immitis, and a Paracoccidioides brasiliensis standard plasmid in an equal volume at a ratio of 1:1:1:1:1 as templates for a quintuple dPCR reaction according to an embodiment of the present invention.
[0016] Figure 17This is an image of a one-dimensional amplification droplet of Histoplasma capsulatum using a Candida auris standard plasmid, a Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, a Histoplasma capsulatum standard plasmid, Coccidioides immitis, and a Paracoccidioides brasiliensis standard plasmid in an equal volume at a ratio of 1:1:1:1:1 as templates for a quintuple dPCR reaction according to an embodiment of the present invention.
[0017] Figure 18 This is a droplet image of one-dimensional amplification of Coccidioides immitis, which is obtained by mixing the Candida auris standard plasmid, Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, capsular tissue cytoplasm standard plasmid, Coccidioides immitis, and Paracoccidioides brasiliensis standard plasmid in the same volume at a ratio of 1:1:1:1:1 and using them as templates for a quintuple dPCR reaction according to an embodiment of the present invention; Figure 19 This is a droplet image of a one-dimensional amplification of Paracoccidioides brasiliensis using a mixture of a Candida auris standard plasmid, a Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, a capsular tissue cytoplasm standard plasmid, Coccidioides immitis, and a Paracoccidioides brasiliensis standard plasmid at a ratio of 1:1:1:1:1 in an embodiment of the present invention, and using the mixture as a template for a five-plex dPCR reaction; Figure 20 This is an embodiment of the present invention, in which the Candida auris standard plasmid, the Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, the capsular tissue cytoplasm standard plasmid, Coccidioides immitis, and the Paracoccidioides brasiliensis standard plasmid are mixed in the same volume at a ratio of 1:1:1:1:1:1 and used as templates for the precise quantitative curve of Candida auris for the quintuple dPCR reaction.
[0018] Figure 21 This is an accurate quantitative curve of Cryptococcus gattii using a Candida auris standard plasmid, a Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, a capsular tissue cytoplasm standard plasmid, Coccidioides immitis, and a Paracoccidioides brasiliensis standard plasmid in the same volume at a ratio of 1:1:1:1:1 as templates for a quintuple dPCR reaction according to the embodiment of the present invention; Figure 22 This is an accurate quantitative curve of Histoplasma capsulatum obtained by mixing the Candida auris standard plasmid, Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, Histoplasma capsulatum standard plasmid, Coccidioides immitis, and Paracoccidioides brasiliensis standard plasmid in the same volume at a ratio of 1:1:1:1:1 as templates for a quintuple dPCR reaction according to the embodiment of the present invention; Figure 23This is an accurate quantitative curve of Coccidioides immitis for a quintuple dPCR reaction using a mixed plasmid of Candida auris standard plasmid, Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, capsular tissue cytoplasm standard plasmid, Coccidioides immitis, and Paracoccidioides brasiliensis standard plasmid in the same volume at a ratio of 1:1:1:1:1 as a template in the embodiment of the present invention; Figure 24 This is an accurate quantitative curve of Paracoccidioides brasiliensis using a Candida auris standard plasmid, a Cryptococcus gattii (Cryptococcus neoformans) standard plasmid, a capsular tissue cytoplasm standard plasmid, Coccidioides immitis, and a Paracoccidioides brasiliensis standard plasmid in a 1:1:1:1:1 ratio as a template for a five-plex dPCR reaction according to the embodiment of the present invention; Figure 25 Graph showing amplification curves of quintuple real-time fluorescence quantitative PCR using total nucleic acid extracts from Candida auris infection samples and non-target fungal infection samples according to an embodiment of the present invention. DETAILED DESCRIPTION
[0019] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0020] Example 1 The primer combination and probe design for a kit for a multiplex detection method for five-target pathogenic fungi based on qPCR and dPCR technology were obtained from the NCBI gene database. The primer combination and probe design are as follows: Candida-F: 5´CAGCCTTGGTGAGCTTTGTT3´ (SEQ ID NO. 1) Candida-R: 5'CTCAGACTCGGACTCTCCAC3' (SEQ ID NO. 2) Candida-P: VIC 5´ACCCAACTCACCAATTGGTACGTCCG3´BHQ1 (SEQ ID NO. 3) Cryptococcus gattii (Cryptococcus neoformans)-F: 5´CCACCACAATCCTGCAACAA3´ (SEQ ID NO. 4) Cryptococcus neoformans -R: 5´CGCAATCGGGCTTGTAGAAA3´ (SEQ ID NO. 5) Cryptococcus gattii (Cryptococcus neoformans) - P: FAM 5´CGCAGGATCCCGACGCCGCT3´BHQ1 (SEQ ID NO: 0.6) Histoplasma capsulatum-F: (SEQ ID NO.7) 5'TTCCGTGCAGAAAATTCG3' Histoplasma capsulatum -R: (SEQ ID NO.8) 5´GATCCAATGTCCGTTCAC3´ Histoplasma capsulatum-P: (SEQ ID NO.9) Texas Red 5´CCAAGCCACCGATACAGTTCTCT3´ BHQ2 Coccidioides immitis-F: 5´TGCCATGGTAATCCTGCTCA3´ (SEQ ID NO.10) Coccidioides immitis-R: 5´CCTCAGCCAAGCACATACAC3´ (SEQ ID NO.11) Coccidioides immitis-P: Cy5 5´TCTGAACCTGCGGTTCCTCTCGT3´BHQ2 (SEQ ID NO.12) Paracoccidioides brasiliensis-F: (SEQ ID NO.13) CCTCGACACATACCACAACC Paracoccidioides brasiliensis-R: (SEQ ID NO.14) GCACCGCTCCACTCTTTC Paracoccidioides brasiliensis-P: (SEQ ID N0.15) Cy5 .5 5´CAATCAACGGCTTATCGGCTCCTCT3´BHQ2.
[0021] Example 2 Plasmid Construction The plasmid carrying the ITS gene of Candida auris is PUC57-C.auris, which has Figure 2 The physical map shown; The plasmid carrying the CAP59 gene of Cryptococcus gattii / Cryptococcus neoformans is PUC57-C.gattii, which has Figure 3 The physical map shown; The plasmid carrying the Hcp100 gene of Histoplasma capsulatum is PUC57-H. capsulatum, which has Figure 4 The physical map shown; The plasmid carrying the ITS gene of Coccidioides immitis is PUC57-C.immitis, which has Figure 5 The physical map shown; The plasmid carrying the GP43 gene of Paracoccidioides brasiliensis is PUC57-P. brasiliensis, which has Figure 6 Physical map shown.
[0022] Example 3 Specificity Experiment Verification 1. qPCR experimental steps: 1.1 Plasmid Extraction: Plasmids carrying the ITS gene of Candida auris, the CAP59 gene of Cryptococcus gattii (Cryptococcus neoformans), the Hcp100 gene of Histoplasma capsulatum, the ITS gene of Coccidioides immitis, and the GP43 gene of Paracoccidioides brasiliensis were extracted using the Novizan Extraction Kit (DC102). OD values (i.e., the A260 / A280 ratio) were measured using a spectrophotometer. 1.2 Dilute the DNA of all the above strains and normal human whole blood DNA to 10 ng / μL to serve as template.
[0023] 1.3 Perform single-plex qPCR amplification experiments: 1.3.1 Single-plex qPCR reaction system (20 μL): Candida reaction system: 2×FastFire qPCR PreMix 10μL, Candida-F (10μM) 0.4μL, Candida-R (10 μM) 0.4 μL, Candida-P (10 μM) 0.2 μL, template DNA 1 μL, DEPC water 7 μL; Cryptococcus gattii (Cryptococcus neoformans) reaction system: 2×FastFire qPCR PreMix 10 μL, Cryptococcus gattii (Cryptococcus neoformans)-F (10 μM) 0.4 μL, Cryptococcus gattii (Cryptococcus neoformans)-R (10 μM) 0.4 μL, Cryptococcus gattii (Cryptococcus neoformans)-P (10 μM) 0.2 μL, template DNA 1 μL, DEPC water 7 μL; Histoplasma capsulatum-F (10 μM) 0.4 μL, Histoplasma capsulatum-R (10 μM) 0.4 μL, Histoplasma capsulatum-P (10 μM) 0.2 μL, template DNA 1 μL, DEPC water 7 μL; Coccidioides immitis reaction system: 2×FastFire qPCR PreMix 10μL, Coccidioides immitis-F (10μM) 0.4μL, Coccidioides immitis-R (10 μM) 0.4 μL, Coccidioides immitis-P (10 μM) 0.2 μL, template DNA 1 μL, DEPC water 7 μL; Paracoccidioides brasiliensis reaction system: 2×FastFire qPCR PreMix 10 μL, Paracoccidioides brasiliensis-F (10 μM) 0.4 μL, Paracoccidioides brasiliensis-R (10 μM) 0.4 μL, Paracoccidioides brasiliensis-P (10 μM) 0.2 μL, template DNA 1, DEPC water 7 μL; The above qPCR premix (2×FastFire qPCR PreMix) was purchased from Tiangen Reagents. Its main components include Taq enzyme, buffer, dNTP, Mg 2+ , nuclease-free water, etc.; The above primers, probes, and plasmid vectors were synthesized by Suzhou Hongxun Biotechnology Co., Ltd. The above DEPC water was purchased from Thermo Fisher Scientific.
[0024] 1.3.2 The qPCR amplification reaction program is as follows: pre-denaturation at 95°C for 1 minute; 95°C for 5 seconds, 58°C for 15 seconds, for a total of 40 cycles. Based on this amplification program, the detection time is approximately 35 minutes, which is a short time period.
[0025] 1.3.3 Experimental results: The target sample Cq value is ≤38, and there is an amplification curve. The non-target sample and blank control have no Cq value and amplification curve. Figure 1 As shown, it shows that the primer probe has high specificity.
[0026] 2. dPCR Experimental Steps: 2.1 Use the plasmid DNA of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis described in 1.2 as templates; 2.2 a) Prepare the dPCR reaction mixture: 1.4 μL of 1× Naica multiplex PCR MIX, 0.6 μL of primer (800 nM) and probe (400 nM) premix, 0.2 μL of EcoRI, 3 μL of template DNA, and 0.8 μL of DEPC water, for a total volume of 6 μL.
[0027] b) Remove the Ruby Chip from the biosafety cabinet and wipe the bottom and edges of the chip with antistatic wipes. Then, wipe the bottom of the chip dry with a lint-free tissue and return it to the chip tray.
[0028] c) Use a punching tool to punch a hole in the tin foil above the chip injection hole.
[0029] d) Use a pipette to draw up 6 μL of the prepared dPCR reaction solution. With one hand, press the chip onto the tray. With the other hand, hold the pipette and place the pipette tip over the injection well. Insert the pipette tip vertically into the chip injection well, ensuring that the tip touches the bottom of the well. Gently lift the pipette tip 1 mm from the bottom of the injection well to load the dPCR reaction solution into the chip.
[0030] e) Open the NioTM Digital PCR instrument, edit the PCR amplification program, chip reading program, and sample information. Select five channels for chip reading: FAM, VIC, Texas Red, Cy5, and Cy5.5.
[0031] f) Place the chip into the NioTM Digital PCR instrument and click "Run." The digital PCR instrument automatically performs droplet production (approximately 20,000 per sample), PCR amplification, and chip reading.
[0032] g) After dPCR is completed, the data is opened and the threshold of each channel is adjusted to draw the threshold line between the negative droplet and the positive droplet.
[0033] h) dPCR detection results are the copy number concentration of each target in each system, with the unit of copies / μL.
[0034] I) Reaction procedure: 95°C pre-denaturation for 5 minutes; 95°C for 15 seconds, 58°C for 30 seconds, for a total of 45 cycles 2.3 Experimental results Figure 14 As shown, all target strains were detected, indicating that the primer probe had high specificity.
[0035] Example 4 Sensitivity experiment: Singleplex qPCR experiments: 1. The plasmid DNA samples of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis and Paracoccidioides brasiliensis extracted in 1.1 of Example 3 were all subjected to 10 0 , 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 copies / μL gradient dilution:
[0036] 2. Amplification was performed according to the reaction system and reaction conditions of 1.3 in Example 3. The amplification curve results showed that Candida auris (such as Figure 7 As shown, the vertical axis RFU represents the fluorescence intensity, and the horizontal axis cycle represents the cycle number), Cryptococcus gattii (Cryptococcus neoformans) (as shown Figure 8 As shown, the vertical axis RFU represents the fluorescence intensity, and the horizontal axis cycle represents the cycle number), Histoplasma capsulatum (such as Figure 9 As shown, the vertical axis RFU represents the fluorescence intensity, and the horizontal axis cycle represents the cycle number), Coccidioides immitis (such as Figure 10 As shown, the vertical axis RFU represents the fluorescence intensity, and the horizontal axis cycle represents the cycle number), Paracoccidioides brasiliensis (such as Figure 11 As shown, the vertical axis RFU represents the fluorescence intensity, and the horizontal axis cycle represents the cycle number), from left to right, this is 10 10 , 10 9 , 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 Amplification curve using 100 copies / μL standard plasmid as template; the detection limit is 100 copies / μL, indicating high sensitivity of the primer probe; Quintuple qPCR experiment: The plasmid DNA samples of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis and Paracoccidioides brasiliensis extracted in 1.1 of Example 3 were all subjected to 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 The copies / μL were diluted in a gradient and mixed in the same volume ratio of 1:1:1:1:1. The results showed amplification curves and Cq values, such as Figure 12 As shown (Relative Fluorescence Units (RFU) indicates fluorescence intensity, cycles indicates cycle number, and Amplification indicates amplification curve); Standard curve results: Candida auris: y=-3.401x+43.99, Cryptococcus gattii: y=-3.314x+43.11, Histoplasma capsulatum: y=-3.264x+42.97, Coccidioides immitis: y=-3.245x+42.97, Paracoccidioides brasiliensis: y= -3.233x+42.67, as shown in 13.
[0037] Quintuple dPCR experiment: (1) Five plasmid templates containing target fungal sequences were mixed and diluted to a final concentration of 6 × 10 4 The plasmid template was prepared at 100 copies / µL, and then 7 concentration gradient standard working solutions were prepared, with theoretical concentrations of 6×10 4 copies / μL, 6×10 3 copies / μL, 6×10 2 copies / μL, 6×10 1 copies / μL, 6copies / μL, 3copies / μL, 1.5copies / μL; (2) Reaction system: Refer to the quintuple dPCR reaction system, and set up three replicate wells for each gradient concentration; (3) Graphpad Prism 9.5 software was used to fit a linear regression equation to the experimental results. The vertical axis of the standard curve was the logarithmic value of the actual detection concentration (copies / μL) of the quintuple reaction system with a base of 10, and the horizontal axis was the logarithmic value of the theoretical concentration (copies / μL) of the quintuple reaction system with a base of 10. The linear regression equation of the quintuple dPCR was established and the R2 value was evaluated.
[0038] The results showed that the one-dimensional amplification diagram was Figures 15 to 19 As shown (the vertical axis represents fluorescence intensity, the horizontal axis represents sample number, and the middle line is the threshold line), the concentrations of the plasmid standards added from left to right are 6×10 4 copies / μL, 6×10 3 copies / μL, 6×10 2 copies / μL, 6×10 1 copies / μL, 6 copies / μL, 3 copies / μL, 1.5 copies / μL; Linear graph as Figure 20-24As shown (the vertical axis is the logarithm of the actual detection concentration (copies / μL) of the five-fold reaction system with a base of 10, and the horizontal axis is the logarithm of the theoretical concentration (copies / μL) of the five-fold reaction system with a base of 10): the amplification droplet scatter plots of all targets clearly distinguish between negative and positive droplets, and the droplets are highly concentrated; the R2 of all linear regression equations is greater than 0.99, and the fitting effect is good; the linear relationship equations of each system are as follows: Cryptococcus gattii: y=0.9750x-0.0798, The correlation coefficients for the linear equations of the five standard curves were all >0.99, indicating good correlation. The lower limit of detection was 6 copies / μL, indicating high sensitivity.
[0039] Example 5 Quintuple qPCR detection of clinical Candida auris samples: A total of 8 clinical samples infected only with Candida auris and 12 samples infected with other non-target fungi were used for testing. The reaction system was configured according to the quintuple qPCR reaction conditions and reaction procedures, and the test was performed on the machine.
[0040] The results show Figure 25 As shown in the figure (where the vertical axis RFU represents fluorescence intensity and the horizontal axis cycle represents cycle number), all Candida auris-positive samples were successfully detected, and the other four target strains were not detected in these samples; nor were they detected in clinical samples of non-target strains, indicating high specificity.
[0041] Although the embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and spirit of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.
Claims
1. A primer combination for five-target pathogenic fungal detection based on qPCR and dPCR technology, characterized in that: The five-target pathogenic fungal primer combination includes upstream and downstream primers designed for Candida auris, upstream and downstream primers designed for Cryptococcus gattii (Cryptococcus neoformans), upstream and downstream primers designed for Histoplasma capsulatum, upstream and downstream primers designed for Coccidioides immitis, and upstream and downstream primers designed for Paracoccidioides brasiliensis; The upstream primer designed for Candida auris: the sequence is shown in SEQ ID NO.1; The downstream primer designed for Candida auris: the sequence is shown in SEQ ID NO.2; The upstream primer designed for Cryptococcus gattii (Cryptococcus neoformans): the sequence is shown in SEQ ID NO.4; The downstream primer designed for Cryptococcus gattii (Cryptococcus neoformans): the sequence is shown in SEQ ID N0.5; The upstream primer designed for Histoplasma capsulatum: the sequence is shown in SEQ ID NO.7; The downstream primer designed for Histoplasma capsulatum: the sequence is shown in SEQ ID NO.8; The upstream primer designed for Coccidioides immitis: the sequence is shown in SEQ ID NO.10; The downstream primer designed for Coccidioides immitis: the sequence is shown in SEQ ID NO.11; The upstream primer designed for Paracoccidioides brasiliensis: the sequence is shown in SEQ ID NO.13; The downstream primer designed for Paracoccidioides brasiliensis: the sequence is shown in SEQ ID N0.
14.
2. A kit for a multiplex detection method of five-target pathogenic fungi based on qPCR and dPCR technology, characterized in that The method comprises the primer combination according to claim 1, and a probe for detecting Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis and Paracoccidioides brasiliensis, The fluorescent probe designed for Candida auris: the sequence is shown in SEQ ID NO.3; The fluorescent probe designed for Cryptococcus gattii (Cryptococcus neoformans): the sequence is shown in SEQ ID N0.6; The fluorescent probe designed for Histoplasma capsulatum: the sequence is shown in SEQ ID N0.9; The fluorescent probe designed for Coccidioides immitis: the sequence is shown in SEQ ID NO.12; The fluorescent probe designed for Paracoccidioides brasiliensis: the sequence is shown in SEQ ID N0.
15.
3. The kit according to claim 2, wherein The 5' ends of the five fluorescent probes are all connected with fluorescent reporter groups, which are FAM, VIC, Texas Red, CY5, and CY5.
5.
4. The kit according to claim 2, wherein The 3' ends of the five fluorescent probes are all connected to quenching groups, which are BHQ1, BHQ2, and BHQ3.
5. The kit according to any one of claims 2 to 4, characterized in that The molar concentration ratio of the upstream primer to the downstream primer is 1:
1.
6. The kit according to any one of claims 2 to 4, characterized in that The molar concentration ratio of the probe to the upstream primer is 1:
2.
7. The kit according to claim 2, characterized in that The kit contains qPCR premix, positive quality control and negative quality control; wherein: The qPCR premix includes Taq enzyme, buffer, dNTP, Mg2+, nuclease-free water, etc. The positive quality control is a mixture of plasmids of the ITS gene region of Candida auris, the CAP59 gene region of Cryptococcus gattii (Cryptococcus neoformans), the Hcp100 gene region of Histoplasma capsulatum, the ITS gene region of Coccidioides immitis, and the GP43 gene region of Paracoccidioides brasiliensis; The negative quality control was DEPC water.
8. A multiplex detection method for five-target pathogenic fungi using qPCR and dPCR technology, characterized in that: The detection method is used for the kit to detect five target pathogenic fungi, wherein the detection method comprises the following steps: (1) Preliminarily, a plasmid carrying the ITS gene of Candida auris, a plasmid carrying the CAP59 gene of Cryptococcus gattii (Cryptococcus neoformans), a plasmid carrying the Hcp100 gene of Histoplasma capsulatum, a plasmid carrying the ITS gene of Coccidioides immitis, and a plasmid carrying the GP43 gene of Paracoccidioides brasiliensis are mixed in the same volume at a ratio of 1:1:1:1:1 as standard products, and the standard products of different mixed concentrations are used as templates, and the primer combination of claim 1 or the kit of any one of claims 2-4 is used to perform qPCR detection and dPCR detection on the standard products; (2) Using the DNA of the sample to be tested as a template, performing qPCR detection on the sample to be tested using the primer composition of claim 1 or the kit of any one of claims 2 to 4; (3) Based on the fluorescence signal intensity of different channels of the sample to be tested and the fluorescence signal intensity of standards with different known concentrations, it can be determined whether the sample to be tested contains Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis and Paracoccidioides brasiliensis; (4) Using the DNA of the sample to be tested as a template, performing dPCR detection on the sample to be tested using the primer composition of claim 1 or the kit of any one of claims 2 to 4; (5) According to the absolute quantitative standard curve of the sample to be tested, accurate quantitative detection of Candida auris, Cryptococcus gattii (Cryptococcus neoformans), Histoplasma capsulatum, Coccidioides immitis and Paracoccidioides brasiliensis was performed.
9. The multiplex detection method for five-target pathogenic fungi using qPCR and dPCR technology according to claim 8, characterized in that: The kit performs qPCR detection on the sample to be tested, including: Create a qPCR reaction program, wherein the qPCR reaction program is: Pre-denaturation at 95°C for 1 minute; 95°C for 5 seconds, 58°C for 15 seconds. A total of 40 cycles.
10. The multiplex detection method for five-target pathogenic fungi using qPCR and dPCR technology according to claim 8, characterized in that: The kit performs dPCR detection on the sample to be tested, including: Create a dPCR reaction program, wherein the dPCR reaction program is: Pre-denaturation at 95°C for 5 minutes; 45 cycles of 95°C for 15 seconds and 58°C for 30 seconds.
Citation Information
Patent Citations
Composition and kit for detecting invasive fungi and application of composition and kit
CN116837136A
Respiratory system fungal infection detection system, kit and preparation method thereof
CN119410835A