Application of KASP molecular marker in identification of red peel / clausena lansium character of muskmelon

Through PCR amplification and fluorescence detection of KASP molecular markers RY-1 or RY-2, the problems of long cycle and low efficiency in melon peel color breeding were solved, and the rapid identification of the red/yellow skin traits of melons was achieved, thereby improving breeding efficiency.

CN120683308AActive Publication Date: 2025-09-23SANYA PEARL MELON & WATERMELON DISPLAY & EVALUATION RES CENT +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511196160.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-26
Publication Date
2025-09-23
Estimated Expiration
2045-08-26

AI Technical Summary

Technical Problem

In the existing technology, the selection and breeding of melon peel color mainly relies on traditional phenotypic observation, which has the problems of long cycle and low efficiency.

Method used

Using KASP molecular markers RY-1 or RY-2, the red/yellow skin trait of melon can be identified using genomic DNA through PCR amplification and fluorescence detection. This process is simplified to a single PCR amplification, avoiding complex steps such as enzyme cutting and electrophoresis, and achieving high-throughput genotyping.

Benefits of technology

It realizes the rapid, simple and efficient identification of the red/yellow skin traits of melons, shortens the breeding cycle and improves the breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683308A_ABST
    Figure CN120683308A_ABST
Patent Text Reader

Abstract

The invention discloses application of a KASP molecular marker in identification of red peel / yellow peel characters of muskmelon, and belongs to the technical field of molecular markers. The invention aims to promote gene localization and molecular-assisted breeding processes by utilizing molecular marker-assisted selective breeding on the red peel / yellow peel character of the muskmelon. The invention relates to a method for identifying red peel / yellow peel characters of muskmelons, which comprises the following steps: extracting the genome DNA of a target muskmelon, carrying out PCR amplification by taking the genome DNA of the target muskmelon as a template, and carrying out fluorescence detection based on a primer pair of a KASP molecular marker RY-1 or RY-2 to obtain the gene type of the target muskmelon, on the basis of the detected gene type, judging the character of the target muskmelon; wherein the KASP molecular marker RY-1 and the KASP molecular marker RY-2 are respectively designed according to SNP (Single Nucleotide Polymorphism) loci at the position of Chr04: 469552 and the position of Chr04: 760234. The identification method provided by the invention can be more efficiently applied to the fields of muskmelon molecular marker-assisted breeding, variety purity detection, gene editing target screening and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application belongs to the field of molecular marker technology, and specifically relates to the application of a KASP molecular marker in identifying the red / yellow skin trait of melon. Background Art

[0002] Muskmelon (Cucumis melo L.) is a major economic crop in the Cucurbitaceae family, with a long history of cultivation in my country. Muskmelon is divided into two subspecies: thick-skinned melon (Cucumis melo L. spp. melo) and thin-skinned melon (Cucumis melo L. spp. agrestis). As one of the secondary origins of muskmelon, my country possesses an extremely rich germplasm resource. This resource exhibits remarkable diversity in morphology, physiology, and genetic characteristics, with particular distinction in melon peel color.

[0003] Peel color is an important commercial trait of muskmelon, and understanding its regulatory mechanisms is crucial for variety improvement, market segmentation, and germplasm resource utilization. Currently, melon peel color selection relies primarily on traditional phenotypic observations, which suffer from long cycles and low efficiency. Summary of the Invention

[0004] The purpose of this application is to provide an application of KASP molecular markers in identifying the red / yellow skin trait of melons, aiming to use KASP molecular markers to identify seeds or seedlings of red / yellow skin melons, so as to improve the breeding efficiency of melons with target traits, thereby shortening the breeding cycle.

[0005] To achieve the above objectives, the present application provides an application of a KASP molecular marker in identifying the red / yellow skin trait of a melon, wherein the identification of the red / yellow skin trait of a melon comprises the following steps: Extracting genomic DNA from a target melon, performing PCR amplification using the genomic DNA from the target melon as a template, and performing fluorescence detection based on a primer pair for the KASP molecular marker RY-1 or RY-2 to obtain the genotype of the target melon; and determining the traits of the target melon based on the detected genotype; The KASP molecular marker RY-1 was designed based on the SNP site at Chr04:469552; The KASP molecular marker RY-2 was designed based on the SNP site at Chr04:760234.

[0006] As some optional embodiments of the present application, the nucleotide sequence of the SNP site at Chr04:469552 is shown as SEQ ID NO.1; the nucleotide sequence of the SNP site at Chr04:760234 is shown as SEQ ID NO.2.

[0007] As some optional embodiments of the present application, the polymorphism of the KASP molecular marker is A or B, the AA genotype or the AB genotype is a red skin type, and the BB genotype is a yellow skin type.

[0008] As some optional embodiments of the present application, the gene type is obtained based on the following reaction system: 1 μL of 2×KASP Master Mix, 0.003 μL of primer F1 and primer F2 at a concentration of 100 μM, 0.008 μL of primer R, and 1 μL of DNA template.

[0009] As some optional embodiments of the present application, the PCR amplification includes: Pre-denaturation at 94°C for 15 min; Denature at 94°C for 20 seconds. 61°C-55°C annealing and extension for 60s, 10 cycles; Denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, for 26 cycles.

[0010] As some optional embodiments of the present application, the primer pair for the KASP molecular marker RY-1 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers; The two forward primers include RY-1-F1 as shown in SEQ ID NO.3 and RY-1-F2 as shown in SEQ ID NO.4, and the reverse primer is RY-1-R as shown in SEQ ID NO.5.

[0011] As some optional embodiments of the present application, the primer pair for the KASP molecular marker RY-2 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers; The two forward primers include RY-2-F1 as shown in SEQ ID NO.6 and RY-2-F2 as shown in SEQ ID NO.7, and the reverse primer is RY-2-R as shown in SEQ ID NO.8.

[0012] As some optional embodiments of the present application, the primer pair of the KASP molecular marker RY-1 or RY-2 can be used to prepare a kit for identifying the KASP molecular marker for the red or yellow trait of melon.

[0013] As some optional embodiments of the present application, the primer pair of the KASP molecular marker RY-1 or RY-2 can be used for melon molecular breeding or variety purity detection.

[0014] In summary, this application has the following advantages: Compared with the existing technology, this application successfully developed a KASP molecular marker RY-1 or RY-2 for identifying the red or yellow skin traits of melon; the RY-1 molecular marker consists of two forward primers RY-1-F1 and RY-1-F2 with lengths of 46bp and 47bp respectively, and a reverse primer RY-1-R with a length of 30bp; the RY-2 molecular marker consists of two forward primers RY-2-F1 and RY-2-F2 with lengths of 48bp and 49bp respectively, and a reverse primer RY-2-R with a length of 29bp.

[0015] This application utilizes the KASP molecular markers RY-1 or RY-2 to genotype red and yellow melons. This allows identification of target melon DNA through a single PCR amplification. The entire detection process is simple, eliminating the need for complex steps such as enzyme digestion, electrophoresis, and sequencing. Using a high-throughput genotyping system, genotyping maps and typing values ​​can be rapidly obtained, enabling rapid identification of the target plant's genotype. Therefore, the KASP molecular markers RY-1 or RY-2 described in this application can be easily, quickly, and efficiently applied to molecular-assisted breeding or variety purity testing for melons. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a schematic diagram of a mixed pool of extreme yellow skin in the F2 population in the embodiment of this application; Figure 2 This is a schematic diagram of an extreme red-skinned mixed pool in the F2 population in the embodiment of this application; Figure 3 Schematic diagram of the SNP-based Δ(SNP-index) association analysis of melon peel color; Figure 4 Schematic diagram of the validation of KSAP molecular markers RY-1, RY-2, RY-3, RY-4, RY-5, RY-6 and RY-7 in parents and F1; among them, KSAP molecular markers RY-1, RY-2, RY-3, RY-4, RY-5, RY-6 and RY-7 correspond to Figure 4 (a) Figure 4 (b) Figure 4 (c) Figure 4 (d) Figure 4 (e) Figure 4 (f) and Figure 4 (g); Figure 5 This is a schematic diagram of the typing results of KASP molecular markers RY-1 and RY-2 in the F2 population, where: Figure 5 (a) and Figure 5 (b) shows the typing results of RY-1. Figure 5 (c) and Figure 5(d) shows the typing results of RY-2. DETAILED DESCRIPTION

[0017] The principles and features of the present invention are described below in conjunction with the examples. The examples are only used to explain the present invention and are not intended to limit the scope of the present invention. Where specific conditions are not specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. Where the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0018] Molecular marker technology has been widely used in the field of gene mapping. Currently, RFLP, RAPD, AFLP, SSR, InDel, and SNP techniques are commonly used in molecular marker technology. Competitive allele-specific PCR (KASP), a mainstream high-throughput SNP technology, achieves high-precision biallelic genotyping (SNP and InDel) with its excellent stability and accuracy. With the rapid development of sequencing technology in my country, InDel and SNP markers can be converted into high-throughput competitive allele-specific PCR markers (KASP) for genotyping of biological populations. This technological advancement will greatly advance the progress of gene mapping and molecular-assisted breeding.

[0019] To explore the genetic mechanisms of melon peel color, particularly the rare red skin trait, the applicant conducted hybridization experiments. Yellow-skinned melons were used as the male parent and red-skinned melons as the female parent to generate the F1 generation. This F1 generation was then self-pollinated to generate the F2 genetically segregating population. During the melon ripening period, the F2 population was investigated for peel color traits, and 30 plants with extreme red skin traits and 30 with extreme non-red skin traits were selected to construct a pool of plants with extreme traits. DNA extracted from the two parents and the pool of plants with extreme traits was subjected to BSA sequencing analysis, which initially mapped the key gene controlling the red skin trait to the 500,407-1,799,822 bp interval (approximately 1.3 Mb) on chromosome 4. Based on this localization, the applicant further developed seven KASP (Kompetitive Allele-Specific PCR) molecular markers, which were verified to be polymorphic between the parents. At the same time, molecular marker validation was conducted using F2 and F3 populations. The results showed that the typing accuracy of the RY-1 marker reached 95.2%, and that of the RY-2 marker reached 93.8%, both of which were highly correlated with the red skin trait. These research results provide an important technical foundation for molecular marker-assisted breeding of red skin in melons, and are expected to enable rapid identification of melon peel color at the seedling stage, providing a new technical means for variety purity testing and gene editing target screening.

[0020] Specifically, in the first aspect, a KASP molecular marker for identifying the red / yellow skin trait of melon in the present application is identified as KASP molecular marker RY-1 or KASP molecular marker RY-2. (1) The KASP molecular marker RY-1 was designed based on the single nucleotide polymorphism (SNP) at position 469552 on chromosome Chr04 in the melon genome (DHL92-V4). The SNP site is located at base 51 of the nucleotide sequence shown in SEQ ID NO.1.

[0021] Further analysis showed that the base of the SNP site mutated from thymine T to cytosine C. The nucleotide sequence is shown in the sequence identifier SEQ ID NO.1.

[0022] The sequence identifier SEQ ID NO.1 and its corresponding variant sites are detailed as follows: >chr04:469552=TATATAGACAGGGTTATTATATTATACGCAGAACTCTTCTTTTTATGTCTC[T / C]ATACTCGTCAGAATAAAAGAAGATGTTAGGTGAAGTGTTGTGGTACT.

[0023] (2) The KASP molecular marker RY-2 was designed based on the single nucleotide polymorphism (SNP) at position 760234 on chromosome Chr04 in the melon genome (DHL92-V4). The SNP site is located at base 51 of the nucleotide sequence shown in SEQ ID NO. 2.

[0024] Further analysis showed that the base of the SNP site mutated from cytosine C to thymine T. The nucleotide sequence is shown in the sequence identifier SEQ ID NO.2.

[0025] The sequence identifier SEQ ID NO.2 and its corresponding variant sites are detailed as follows: >chr04:760234=CAGAAATCTTTTCCCATGTATGGAAACAGTGGTAATTATCACACATATAC[C / T]GGTTCAAACATAAATGCCTCTTCATTGTCTCTTAAACCCCAACCTCATGA.

[0026] In a second aspect, a primer pair for identifying a KASP molecular marker for the red / yellow skin trait of melon in the present application comprises: (1) RY-1-F1 as shown in SEQ ID NO.3, RY-1-F2 as shown in SEQ ID NO.4, and RY-1-R as shown in SEQ ID NO.5: Specifically, RY-1-F1 (SEQ ID NO. 3): GAAGGTGACCAAGTTCATGCTCGCAGAACTCTCTTTTTATGTCTCC.

[0027] RY-1-F2 (SEQ ID NO. 4): GAAGGTCGGAGTCAACGGATTACGCAGAACTCTCTTTTTATGTCTCT.

[0028] RY-1-R (SEQ ID NO. 5): AACATCTTCTTTTATTATTCTGACGAGTAT.

[0029] (2) RY-2-F1 as shown in SEQ ID NO.6, RY-2-F2 as shown in SEQ ID NO.7, and RY-2-R as shown in SEQ ID NO.8: RY-2-F1 (SEQ ID NO. 6): GAAGGTGACCAAGTTCATGCTAATGAAGAGGCATTTATGTTTGAACCG.

[0030] RY-2-F2 (SEQ ID NO. 7): GAAGGTCGGAGTCAACGGATTCAATGAAGAGGCATTTATGTTTGAACCA.

[0031] RY-2-R (SEQ ID NO. 8): CTTTTCCCATGTATGGAAACAGTGGTAAT.

[0032] In addition, the present application provides a kit for identifying KASP molecular markers for the red / yellow skin trait of melon, comprising a primer pair for the KASP molecular marker RY-1 or KASP molecular marker RY-2 as described above, namely, RY-1-F1 as shown in SEQ ID NO. 3, RY-1-F2 as shown in SEQ ID NO. 4, RY-1-R as shown in SEQ ID NO. 5, RY-2-F1 as shown in SEQ ID NO. 6, RY-2-F2 as shown in SEQ ID NO. 7, and RY-2-R as shown in SEQ ID NO. 8. RY-1-F1 as shown in SEQ ID NO. 3, RY-1-F2 as shown in SEQ ID NO. 4, RY-2-F1 as shown in SEQ ID NO. 6, and RY-2-F2 as shown in SEQ ID NO. 7 are forward primers, and RY-1-R as shown in SEQ ID NO. 5 and RY-2-R as shown in SEQ ID NO. 8 are reverse primers.

[0033] A method for identifying the red / yellow skin trait of a melon in this application comprises the following steps: First, genomic DNA of the target melon was extracted. Then, the genomic DNA was used as a template for PCR amplification and fluorescence detection using primer pairs labeled with KASP RY-1 or RY-2. The PCR amplification procedure is: Pre-denaturation at 94°C for 15 min; Denature at 94°C for 20 seconds. 61°C-55°C annealing and extension for 60s, 10 cycles; Denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, 26 cycles; The characteristics of the target melon are determined based on the gene type in the test results.

[0034] Specifically, if the detected genotype is AA or AB, the target melon is determined to have a red-skin genotype; if the detected genotype is BB, the target melon is determined to have a yellow-skin genotype. A red-skin genotype means that the distance from the fluorescence detection result to the Y-axis is less than the distance from the fluorescence detection result to the X-axis, meaning that the fluorescence detection result is closer to the Y-axis. Conversely, a yellow-skin genotype means that the distance from the fluorescence detection result to the Y-axis is greater than the distance from the fluorescence detection result to the X-axis, meaning that the fluorescence detection result is closer to the X-axis. The F1 genotype (AB) is located between the X and Y axes.

[0035] In a specific embodiment, the primer pair for the KASP molecular marker RY-1 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers; the two forward primers include RY-1-F1 as shown in SEQ ID NO.3 and RY-1-F2 as shown in SEQ ID NO.4, and the reverse primer is RY-1-R as shown in SEQ ID NO.5.

[0036] In a specific embodiment, the primer pair for the KASP molecular marker RY-2 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers; the two forward primers include RY-2-F1 as shown in SEQ ID NO.6 and RY-2-F2 as shown in SEQ ID NO.7, and the reverse primer is RY-2-R as shown in SEQ ID NO.8.

[0037] The above technical solutions of the present application are described in detail below with reference to specific embodiments.

[0038] Example 1 This example mainly provides a further detailed description of the BSA-seq localization analysis of the red / yellow skin trait gene of melon: Step 1: Construct a genetic population In this study, a high-generation inbred line of red-skinned melon (dark green in the young fruit stage and orange-red in the mature stage) was used as the female parent, and a high-generation inbred line of yellow-skinned melon (light green in the young fruit stage and bright yellow in the mature stage) was used as the male parent. The F1 generation was obtained by hybridization, and the F1 generation was then self-pollinated to obtain an F2 segregating population (n=440).

[0039] Step 2: Extreme phenotype screening method 1) Phenotypic evaluation criteria Dynamic observation of development: Record the changes in fruit skin color during the young fruit stage (15 days after pollination) and the mature stage (35 days after pollination).

[0040] Objective determination: A spectrophotometer (model: TS7708, Tri-Nutrient, Guangdong) was used to measure the chromaticity values ​​of L, a*, and b*. Three locations were measured for each fruit, and the average value was taken.

[0041] Subjective Verification: 3 professionals independently performed color grading.

[0042] 2) Screening of extreme individuals Combining colorimeter data measurement and subjective evaluation, plants with dark green fruit in the young stage and orange-red fruit in the mature stage were selected from the F2 population to construct an extreme red skin mixed pool (n=30) (e.g. Figure 1 shown); Combining colorimeter data measurement and subjective evaluation, plants with light green fruit at young stage and bright yellow fruit at mature stage were selected from the F2 population to construct an extreme yellow-skin mixed pool (n=30) (e.g. Figure 2 shown).

[0043] Step 3: BSA-seq localization analysis 1) DNA extraction The CTAB method was used to extract DNA from the parental strain and two extreme pools (concentration ≥ 50 ng / μL, OD260 / 280 = 1.8-2.0). 1.1) Weigh 0.1-0.3 g of fresh leaves and grind them into a powder in liquid nitrogen. Transfer the powder to a 2 mL centrifuge tube. Add 500 μL of DNA extraction buffer and vortex thoroughly to mix. 1.2) Incubate in a 65°C water bath for 15-20 minutes, vortexing the sample every 5 minutes. 1.3) Add an equal volume of chloroform-isoamyl alcohol and mix slowly on a shaker for 10-15 minutes; 1.4) Centrifuge at 7500 rpm for 15 min at 4°C. 1.5) Transfer the supernatant to a new 1.5 mL Eppendorf tube and extract once with 500 μL of an equal volume of phenol / chloroform mixture, and then extract once with an equal volume of chloroform; 1.6) Carefully transfer the supernatant to a new 1.5 mL Eppendorf tube, add 1 mL of anhydrous ethanol, invert several times, and incubate at -20°C for 10 min. 1.7) Centrifuge at 12000 rpm for 5 min to pellet the DNA and discard the excess liquid. 1.8) Wash the DNA with 75% ethanol, discard the ethanol, and air dry thoroughly. 1.9) Add 30-50 μL of TER (TE + RNase, final RNase concentration 50 μg / mL) buffer to dissolve the DNA. Prepare and sequence the library on the Illumina NovaSeq platform in PE150 mode at an average depth of ≥30×. TER buffer is a mixture of Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride) and EDTA (ethylenediaminetetraacetic acid). Tris-HCl maintains a stable pH, while EDTA chelates metal ions, inhibiting DNase activity and preventing DNA degradation. RNase is a ribonuclease that specifically degrades residual RNA (ribonucleic acid) in the sample, ensuring higher purity of the final extracted DNA product and reducing RNA interference in subsequent experiments (such as PCR and sequencing).

[0044] 2) Data Analysis SNP detection: GATK4.1 standard process, filtering parameters (QD < 2.0 | | FS > 60.0 | | MQ < 40.0); Association analysis: The SNP-index algorithm was used with a window step of 10 kb and a significance threshold of Δ(SNP-index)>0.4.

[0045] 3) Positioning results A significant association signal was obtained in the 500,407bp-1,799,822bp interval (about 1.3Mb) on melon chromosome 4 ( Figure 3 ), within this interval: there are 121 polymorphic genes (including 31 non-synonymous mutation genes, as shown in Table 1).

[0046] Table 1 Gene numbers and gene annotations within the BSA mapping interval

[0047] Example 2 This example mainly provides further details on the identification of the gene for the red / yellow skin trait of melon and the development of KASP markers: Step 1. KASP Marker Development Based on the preliminary positioning results of BSA-seq in Example 1, KASP primers were designed using professional software such as PrimerPicker in the candidate interval of 500407 bp-1799822 bp on melon chromosome 4 according to the SNP variation information in the interval.

[0048] During the design process, seven sets of KASP primers were developed evenly spaced at 0.2 Mb intervals (primer sequences are shown in Table 2). Each KASP molecular marker set consists of three primers: two forward primers (F1 and F2) and one reverse primer (R). A FAM fluorescent group was added to the 5' end of the F1 primer, and a HEX fluorescent group was added to the 5' end of the F2 primer.

[0049] Table 2

[0050] Step 2: Verify the group Ten plants from each parent (red-skinned muskmelon female parent and yellow-skinned muskmelon male parent) and the F1 generation were selected to verify the polymorphism of the seven KASP molecular markers described above. The results showed that all seven markers exhibited clear polymorphism between the parents: in the typing results, the genotype tending toward the Y-axis was the homozygous maternal type (AA), the genotype tending toward the X-axis was the homozygous paternal type (BB), and the genotype in between was the heterozygous F1 type (AB). This indicates that the seven developed KASP molecular markers conform to the law of genetic segregation and can be used for subsequent genotyping experiments.

[0051] Step 3: Genotyping Process 1) Extract DNA, the process is the same as Example 1.

[0052] 1.1) Weigh 0.1g-0.3g of fresh leaves and grind them into a powder in liquid nitrogen. Transfer to a 2mL centrifuge tube, add 500μL of DNA extraction buffer, and vortex thoroughly to mix. 1.2) Incubate in a 65°C water bath for 15-20 minutes, vortexing the sample every 5 minutes. 1.3) Add an equal volume of chloroform-isoamyl alcohol and mix slowly on a shaker for 10-15 minutes; 1.4) Centrifuge at 7500 rpm for 15 min at 4°C. 1.5) Transfer the supernatant to a new 1.5 mL Eppendorf tube and extract once with 500 μL of an equal volume of phenol / chloroform mixture, and then extract once with an equal volume of chloroform; 1.6) Carefully transfer the supernatant to a new 1.5 mL Eppendorf tube, add 1 mL of anhydrous ethanol, invert several times, and incubate at -20°C for 10 min. 1.7) Centrifuge at 12000 rpm for 5 min to pellet the DNA and discard the excess liquid. 1.8) Wash the DNA with 75% ethanol, discard the ethanol, and air dry thoroughly. 1.9) Dissolve the DNA in 30-50 μL of TER (TE + RNase, final RNase concentration 50 μg / mL) buffer. Prepare and sequence the library on an Illumina NovaSeq platform in PE150 mode at an average depth of ≥30×.

[0053] 2) PCR reaction system (2.014 μL total system) Includes: 2×KASP Master Mix 1 μL, primer mix 0.014 μL (F1 and F2 0.003 μL, R 0.008 μL), DNA template 1 μL.

[0054] 3) Amplification procedure Pre-denaturation at 94°C for 15 min; Denature at 94°C for 20 seconds. 61°C-55°C annealing and extension for 60s, 10 cycles; Denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, for 26 cycles.

[0055] 4) Testing platform The Matrix Arrayer 2250 (Hanchen Guangyi) detection system was used to collect and analyze fluorescence signals of PCR products. Accurate classification of melon peel traits was achieved based on the fluorescence typing results, providing an efficient and stable detection tool for molecular breeding.

[0056] Step 4: Calculation of typing accuracy Using the formula: Accuracy = (number of correctly typed samples / total number of samples) × 100%, which quantitatively evaluates the typing effect of the marker. "Correct typing" refers to samples whose molecular marker typing results are consistent with the actual phenotypic observation results.

[0057] Step 5: Marker validity screening and verification Seven groups of KASP markers were screened using plants with extreme phenotypes (red skin and yellow skin) in the F3 population, such as Figure 4 The results show that five marker groups (RY-1, RY-2, RY-3, RY-5, and RY-6) can be successfully used for typing. RY-1 and RY-2 had relatively high typing accuracy rates of 84.2% and 73.7%, respectively, suggesting a strong linkage relationship between RY-1 and RY-2 and the target gene. The remaining RY-3, RY-5, and RY-6 markers had typing accuracy rates of 68.4%, 65%, and 44.4%, respectively.

[0058] To further verify the reliability of the above markers, red-skin and yellow-skin melon samples from the F2 population were selected for expanded verification. The results showed that the typing accuracy of the RY-1 molecular marker increased to 95.2%, and the typing accuracy of the RY-2 molecular marker increased to 93.8%. Both showed a high correlation with the red / yellow skin traits (such as Figure 5 In summary, the RY-1 and RY-2 molecular markers can be stably used for the accurate identification of the red and yellow traits of melon peel.

[0059] Although the specific embodiments of the present application have been described in detail, this should not be construed as limiting the scope of protection of the present application. Within the scope described in the claims, various modifications and variations that can be made by those skilled in the art without creative work still fall within the scope of protection of the present application.

Claims

1. An application of a KASP molecular marker in identifying the red / yellow skin trait of melon, characterized in that: The identification of the red / yellow skin trait of the melon comprises the following steps: Extracting genomic DNA from a target melon, performing PCR amplification using the genomic DNA from the target melon as a template, and performing fluorescence detection based on a primer pair for the KASP molecular marker RY-1 or RY-2 to obtain the genotype of the target melon; and determining the traits of the target melon based on the detected genotype; The KASP molecular marker RY-1 is designed based on the SNP site at Chr04:469552. The KASP molecular marker RY-2 was designed based on the SNP site at Chr04:760234.

2. The use according to claim 1, characterized in that The SNP site at Chr04:469552 is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.1; the SNP site at Chr04:760234 is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The polymorphism of the KASP molecular marker is A or B, the AA genotype or the AB genotype is a red skin type, and the BB genotype is a yellow skin type.

4. The use according to claim 1, characterized in that The gene type was obtained based on the following reaction system: 1 μL of 2×KASP Master Mix, 0.003 μL each of primer F1 and primer F2 at a concentration of 100 μM, 0.008 μL of primer R, and 1 μL of DNA template.

5. The use according to claim 1, characterized in that The PCR amplification comprises: Pre-denaturation at 94°C for 15 min; Denature at 94°C for 20 seconds. 61°C-55°C annealing and extension for 60s, 10 cycles; Denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, for 26 cycles.

6. The use according to claim 1, characterized in that The primer pair for the KASP molecular marker RY-1 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers; The two forward primers include RY-1-F1 as shown in SEQ ID NO.3 and RY-1-F2 as shown in SEQ ID NO.4, and the reverse primer is RY-1-R as shown in SEQ ID NO.

5.

7. The use according to claim 1, characterized in that The primer pair for the KASP molecular marker RY-2 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers; The two forward primers include RY-2-F1 as shown in SEQ ID NO.6 and RY-2-F2 as shown in SEQ ID NO.7, and the reverse primer is RY-2-R as shown in SEQ ID NO.

8.

8. The use according to claim 6 or 7, characterized in that The primer pair of the KASP molecular marker RY-1 or RY-2 can be used to prepare a kit for identifying the KASP molecular marker for the red or yellow trait of melon.

9. The use according to claim 6 or 7, characterized in that The primer pair of the KASP molecular marker RY-1 or RY-2 can be used for melon molecular breeding or variety purity detection.

Citation Information

Patent Citations

  • APRR2 gene related to green peel traits of melons

    CN110106186A

  • Molecular marker related to peel color of muskmelon as well as method and application thereof

    CN112375839A

  • SNP (Single Nucleotide Polymorphism) molecular marker for identifying sweet melon peel color and application of SNP molecular marker

    CN117965790A