SNP (Single Nucleotide Polymorphism) molecular marker related to disease resistance character of Tibetan sheep, detection method and application of SNP molecular marker
By using SNP molecular markers found on chromosome 3 of Tibetan sheep to assess the content of key cytokines, the problem of low efficiency in traditional disease resistance breeding has been solved, enabling early and accurate assessment of disease resistance traits and improving breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS
- Filing Date
- 2026-01-28
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are insufficient to effectively utilize the unique disease-resistant genetic basis of Tibetan sheep, and lack molecular markers that directly indicate their overall immune regulation capacity and disease resistance potential. Traditional disease-resistant breeding methods are inefficient and costly.
A SNP molecular marker at 64702329 bases on chromosome 3 of Tibetan sheep (g64702329G>A) was discovered and utilized. By detecting the genotype of this SNP molecular marker, the levels of key cytokines IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 were assessed, and a method and kit for detecting the SNP molecular marker were provided.
This technology enables early and accurate assessment of the immune status and disease resistance of Tibetan sheep, provides new SNP molecular marker resources, and assists in breeding to improve breeding efficiency and reduce costs.
Smart Images

Figure CN122012726A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of disease resistance detection technology for Tibetan sheep, and particularly relates to a SNP molecular marker, detection method and application related to disease resistance in Tibetan sheep. Background Technology
[0002] Tibetan sheep, a unique livestock genetic resource of the Qinghai-Tibet Plateau, have long adapted to extreme environments such as high altitude, low oxygen, and strong radiation, developing unique resilience, especially in disease resistance. Exploring and utilizing the disease-resistant genetic mechanisms of Tibetan sheep is of great significance for breeding new breeds with strong disease resistance, reducing economic losses in animal husbandry caused by disease, and promoting green and healthy farming practices.
[0003] In livestock breeding, traditional disease resistance selection mainly relies on phenotypic records (such as morbidity and mortality rates) of individuals and their relatives, as well as pathogen challenge tests. However, this method has inherent drawbacks such as long cycles, high costs, low efficiency, and susceptibility to environmental interference. More importantly, traditional breeding methods are difficult to implement effectively for certain diseases with long incubation periods or those that are difficult to artificially infect.
[0004] Disease resistance is essentially the immune system's ability to recognize and eliminate pathogens. Cytokines, as core regulatory molecules of the immune response, are closely related to disease-resistant phenotypes. Interleukin-1α (IL-1α), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), tumor necrosis factor-β (TNF-β), interleukin-1 receptor antagonist (IL-1Ra), and interleukin-10 (IL-10) constitute the core regulatory network of inflammation and immune homeostasis in the body: pro-inflammatory factors IL-1α, IL-6, TNF-α, and TNF-β can activate immune cells such as macrophages and T lymphocytes, initiating innate and adaptive immune responses to effectively resist pathogen invasion; anti-inflammatory factors IL-1Ra and IL-10, by inhibiting the overexpression of pro-inflammatory factors, prevent tissue damage caused by uncontrolled immune responses and maintain immune homeostasis. Studies have confirmed that the levels of these cytokines are significantly correlated with the disease resistance of livestock and poultry, and the genetic variations in their expression regulation are important factors determining an individual's disease resistance potential.
[0005] With the development of molecular biology, marker-assisted selection (MAS) technology has brought revolutionary progress to livestock breeding. Among them, single nucleotide polymorphisms (SNPs) have become one of the most ideal molecular markers in current genetic breeding due to their wide distribution, abundance, high stability, and ease of high-throughput automated detection in the genome. By identifying SNP sites closely linked to important economic traits (including disease resistance), early and accurate selection of breeding stock can be achieved, significantly shortening the generation interval and improving breeding efficiency.
[0006] Currently, although some candidate genes or molecular markers related to immune traits in livestock have been reported, the unique genetic basis of disease resistance in Tibetan sheep remains insufficiently understood. In particular, there is a lack of specific molecular markers that can directly and effectively indicate their overall immune regulatory capacity and disease resistance potential. Summary of the Invention
[0007] In view of this, the purpose of this invention is to provide a SNP molecular marker, detection method and application related to disease resistance traits in Tibetan sheep.
[0008] Cytokines are core mediators of immune regulation, and their expression levels directly reflect the body's immune status and the intensity of inflammatory responses. The levels of these key cytokines (IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, IL-10) in the blood are important phenotypic indicators for assessing an individual's immune homeostasis and disease resistance. This invention identifies SNP molecular markers that are significantly correlated with the levels of these key cytokines. By detecting the genotype of these SNP molecular marker sites, the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in Tibetan sheep individuals can be determined.
[0009] This invention provides a SNP molecular marker associated with disease resistance in Tibetan sheep. The SNP molecular marker is located at 64,702,329th base on chromosome 3 of the International Sheep Reference Genome Oar_v4.0. The variant type is G / A. The levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep individuals with the SNP molecular marker genotype GG are significantly lower than those with genotypes GA and AA. The level of IL-10 in Tibetan sheep individuals with the genotype AA is significantly lower than that in Tibetan sheep individuals with the genotype GG.
[0010] The present invention provides a DNA molecule containing the SNP molecular marker described above, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0011] This invention provides a kit for detecting the genotype of the SNP molecular marker, including amplification primers and PCR reaction reagents.
[0012] Preferably, the amplification primers include an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.
[0013] This invention provides a method for detecting the genotype of the aforementioned SNP molecular marker, comprising the following steps: 1) Extract genomic DNA from the blood sample to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification using the primers in the kit to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype at position 268 of the amplification products to determine the genotype of the SNP molecular marker.
[0014] This invention provides the application of the SNP molecular marker, the DNA molecule, and the kit in the assisted breeding of disease resistance traits in Tibetan sheep.
[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a SNP molecular marker, detection method, and application related to disease resistance traits in Tibetan sheep. The levels of key cytokines (IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, IL-10) in the blood are important phenotypic indicators for assessing individual immune homeostasis and disease resistance. This invention identifies SNP molecular markers that are significantly correlated with the levels of these key cytokines. The SNP molecular marker is located at 64,702,329th base on chromosome 3 of the International Sheep Reference Genome Oar_v4.0. The variant type is G / A, named g64702329G>A, and there are three genotypes. When the 64,702,329th base on chromosome 3 is G, the genotype is GG or GA; when the 64,702,329th base on chromosome 3 is A, the genotype is AA. Through association analysis between different genotypes and the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10, it was found that the levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep individuals with the GG genotype were significantly lower than those with the GA and AA genotypes (p<0.05), and the IL-10 level in Tibetan sheep individuals with the AA genotype was significantly lower than that in individuals with the GG genotype (p<0.05). This invention demonstrates that the base at the g64702329G>A SNP site on Tibetan sheep chromosome 3 is a SNP marker related to IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in Tibetan sheep. By detecting the base at nucleotide site 64702329 on Tibetan sheep chromosome 3, the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in an individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes. Attached Figure Description
[0016] Figure 1The results of agarose gel electrophoresis for detecting the amplification products of the g64702329G>A SNP site on chromosome 3 of Tibetan sheep, where M is the Marker and 1-3 are three replicates of the amplification product; Figure 2 The peak diagram and sequence of SNP sites obtained after purification and sequencing of PCR amplification products. Detailed Implementation
[0017] This invention provides a SNP molecular marker associated with disease resistance in Tibetan sheep. The SNP molecular marker is located at 64,702,329th base on chromosome 3 of the International Sheep Reference Genome Oar_v4.0. The variant type is G / A. The levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep individuals with the SNP molecular marker genotype GG are significantly lower than those with genotypes GA and AA. The level of IL-10 in Tibetan sheep individuals with the genotype AA is significantly lower than that in Tibetan sheep individuals with the genotype GG.
[0018] The present invention also provides a DNA molecule comprising the aforementioned SNP molecular marker, the nucleotide sequence of which is shown in SEQ ID NO.1, specifically as follows: TATGCTCCTCATGTCCCGGCAATTGGAATAAACTGTAAATTAGGTGTTACAGTGCTGTAGTTTGGTTAGATGCAATGGTTTAGAAATGTAGCTTTCGTTTGTTATGAGATAATAGCTGCTTTGCTTTGTTGTG ACAGTAGCAATAAAGTAAAGTTACTACGATGTAAAATGTGGTAACCAGCCCAAACTACTGAAACACAGCTACAAATCAGGGGTGGCCCAACTCTGAGAACTTTATGCGGAGCGCCATCTCTGCACAAGTGGCAC AGAGAGCCTTGCTCTCATAGCCATCACATGGGTCATATTGCTGCGGGTCAAACCATGTCCTTAAACTACAGGGTAAAGCTCTGTTGGGAAAGGGAAAATTTTCATGCCATTAACTTCACATAGAAGGGAGGCTTTGTTGA GCCTAAGCTGGTATTCAGATGTGCCTGGACAAGTTCTTCAGAATTGGGATATGGTTCAATGTCTCTAGGAACCAATTTTCTGAGAAAATTGGCTGGGGAAGTACTCTTTGTACCATTGCCTGGGAGAAAGCCTGAGATG.
[0019] This invention provides a kit for detecting the genotype of the SNP molecular marker, including amplification primers and PCR reaction reagents.
[0020] The amplification primers include the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3, as detailed below: F: 5'-TATGCTCCTCATGTCCCG-3' (SEQ ID NO. 2); R: 5'-CATCTCAGGCTTTCTCCC-3' (SEQ ID NO. 3).
[0021] In this invention, the detection reagent is preferably a PCR reaction reagent. This invention does not specifically limit the type of PCR reaction reagent; any commercially available PCR reaction reagent in the art can be used. In the specific implementation of this invention, the PCR reaction reagent is preferably Gold Mix (green).
[0022] The present invention also provides a method for detecting the genotype of the SNP molecular marker, comprising the following steps: 1) extracting genomic DNA from the blood of the sample to be tested; 2) using the genomic DNA obtained in step 1) as a template, performing PCR amplification with primers in the kit to obtain amplification products; 3) sequencing the amplification products and analyzing the genotype of the 268-position of the amplification products to determine the genotype of the SNP molecular marker.
[0023] In this invention, genomic DNA is extracted from the blood sample to be tested. The method for extracting the blood genomic DNA is not particularly limited in this invention; conventional genomic DNA extraction methods in the art can be used.
[0024] In this invention, genomic DNA is used as a template, and PCR amplification is performed using the primers in the kit to obtain amplification products. In this invention, the PCR amplification system is in 25 μL units, preferably comprising: 22 μL of gold-labeled mix (green), 1 μL of upstream primer, 1 μL of downstream primer, and 1 μL of template (genomic DNA). The preferred PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min. After obtaining the amplification products, the amplification products are sequenced, and the genotype at position 268 of the amplification products is analyzed to determine the genotype of the SNP molecular marker. In this invention, the amplification products are preferably sequenced after passing agarose gel electrophoresis. The sequencing is preferably performed using direct sequencing. The nucleotide sequence of the amplification products is shown in SEQ ID No. 1, and the SNP marker is located at position 268 of the nucleotide sequence shown in SEQ ID No. 1. In this invention, the sequencing results of the amplified products are preferably compared using the bioanalysis software MEGA 6.0, the sequencing peak diagram is analyzed, and genotyping is completed.
[0025] This invention also provides the application of the SNP molecular marker, the DNA molecule, and the kit in the assisted breeding of disease resistance traits in Tibetan sheep.
[0026] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0027] Example 1
[0028] 1. Sample collection
[0029] The samples were collected from Tibetan sheep populations under natural grazing conditions, including 70 samples from Gannan Tibetan Autonomous Prefecture in Gansu Province, 44 samples from Yushu Tibetan Autonomous Prefecture in Qinghai Province, and 40 samples from Shigatse City in Tibet Autonomous Region. 5 mL of blood samples were collected from 154 fasting Tibetan sheep in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 15 min. The supernatant was collected into clean PE tubes, sealed, and stored at -20°C as serum samples for the detection of pro-inflammatory and anti-inflammatory factors. Separately, 5 mL of blood samples were collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed, placed in a sampling box with ice packs for temporary storage, and then transported back to the laboratory and frozen at -20°C for DNA extraction.
[0030] 2. Main Reagents and Instruments
[0031] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomics extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL1000 markers, agarose, and nucleic acid dyes were purchased from Beijing Solarbio Science & Technology Co., Ltd.; the gold-labeled mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. The IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.
[0032] 3 Methods
[0033] 3.1 Detection of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra and IL-10
[0034] The assay was performed using the enzyme-linked immunosorbent assay (ELISA) method according to the test kit from Nanjing Jiancheng Biotechnology Research Institute. The assay steps were as follows: (1) Serial dilution of the standard according to the instructions; (2) Add 100 μL of antibody to each well, coat for 2 hours, discard the liquid and spin dry; (3) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (4) Add 200 μL of blocking buffer to each well, gently shake to mix, let stand at room temperature for 30 minutes, discard the liquid and spin dry; (5) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (6) Add 25 μL of coating buffer, 25 μL of sample and 50 μL of standard to each well, gently shake to mix; (7) Add 100 μL of antibody to each well. (8) Gently shake HRP to mix, let stand at room temperature for 60 min, then discard the liquid and spin dry; (9) Add 300 μL of diluted washing solution to each well, shake for 30 s, then discard the washing solution and pat dry with absorbent paper, repeat 5 times; (10) Add 100 μL of color developing solution to each well, gently shake to mix, and develop color for 15 min; (11) Add 100 μL of stop solution to each well to stop the reaction (at this time, the blue color immediately turns yellow); (12) Zero the blank well and measure the OD value of each well at a wavelength of 450 nm; (13) Make a standard curve using the OD value of the standard and obtain the curve formula, then substitute the OD measured by the sample test tube into the calculation formula to obtain the result.
[0035] 3.2 Extraction of genomic DNA from blood
[0036] Genomic DNA was extracted from blood samples using the blood genome extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA were detected by ultraviolet spectrophotometer. A concentration >20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 were sufficient for the experiment. The DNA was stored at -20℃ for later use.
[0037] 3.3 Primer Design
[0038] Based on the gene sequence of chromosome 3 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019460.2), a pair of specific primers containing the g64702329G>A SNP site was designed using Primer Premier 5.0 software.
[0039] Primer sequences: F: 5'-TATGCTCCTCATGTCCCG-3' (SEQ ID NO. 2); R: 5'-CATCTCAGGCTTTCTCCC-3' (SEQ ID NO. 3).
[0040] The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0041] 3.4 PCR amplification and sequencing
[0042] PCR amplification system 25μL: Gold Mix (green) 22μL, upstream and downstream primers 1μL each, template 1μL.
[0043] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.
[0044] PCR products were detected by 1.5% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID No. 1, with a length of 548 bp. The SNP marker is located at position 268 of the nucleotide sequence shown in SEQ ID No. 1.
[0045] The sequencing results of PCR products were compared using the bioanalysis software MEGA 6.0, and the sequencing peak diagrams were analyzed to complete the typing.
[0046] 4. Statistical Analysis
[0047] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. The frequency of the g64702329G>A gene, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test were calculated using Popgen32 software. The polymorphism information content (PIC) was calculated using PIC software. The association between different genotypes in Tibetan sheep and IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. Results are expressed as mean ± standard error.
[0048] 5 Results
[0049] 5.1 PCR amplification and sequencing results
[0050] The amplification products of the g64702329G>A SNP site on chromosome 3 of Tibetan sheep were detected using 1.5% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 548 bp, which is in line with the expected size, and the next step of the experiment can be carried out.
[0051] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2 .Depend on Figure 2 It can be seen that the GA mutation occurs at the g64702329G>ASNP site, resulting in three genotypes: GG, GA, and AA.
[0052] 5.2 Statistical Analysis Results
[0053] Genotype and allele frequencies of the g64702329G>A SNP locus on chromosome 3 of Tibetan sheep were analyzed from a population genetics perspective. Table 1 shows that the GG genotype had the highest frequency at the g64702329G>A SNP locus, indicating it was the dominant genotype, while the G allele frequency was 77.9%, also representing the dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.344, and the PIC was 0.285, indicating moderate polymorphism.
[0054] Table 1. Polymorphism of SNP site g64702329G>A on chromosome 3 of Tibetan sheep
[0055] 5.3 Association analysis between different genotypes and IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10
[0056] The association between different genotypes of Tibetan sheep and the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that the levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep with the GG genotype were significantly lower than those with the GA and AA genotypes (p<0.05), and the IL-10 level in Tibetan sheep with the AA genotype was significantly lower than that in those with the GG genotype (p<0.05). This indicates that the base at the g64702329G>A SNP site on chromosome 3 of Tibetan sheep is a SNP marker related to IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10. The results are shown in Table 2.
[0057] Table 2. Correlation analysis between different genotypes and the relative levels (concentrations) of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10.
[0058] Note: Different lowercase letters in the intercalation of data in the same row indicate significant differences (P < 0.05).
[0059] As can be seen from the above embodiments, the present invention has discovered SNP molecular markers that are significantly related to the content of key cytokines. By detecting the bases at the 64,702,329th nucleotide site on chromosome 3 of Tibetan sheep, the content of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in individual Tibetan sheep can be determined. The present invention provides a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes.
[0060] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A SNP molecular marker associated with disease resistance traits in Tibetan sheep, characterized in that, The SNP molecular marker is located at 64,702,329th base on chromosome 3 of the International Sheep Reference Genome Oar_v4.0; the variant type is G / A, with three genotypes: GG, GA, and AA. The levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep individuals with the SNP molecular marker genotype GG are significantly lower than those with genotypes GA and AA, while the IL-10 level in Tibetan sheep individuals with the genotype AA is significantly lower than that in Tibetan sheep individuals with the genotype GG.
2. A DNA molecule comprising the SNP molecular marker of claim 1, characterized in that, The nucleotide sequence of the DNA molecule is shown in SEQ ID NO.
1.
3. A kit for detecting the genotype of the SNP molecular marker as described in claim 1, characterized in that, This includes amplification primers and PCR reaction reagents.
4. The reagent kit according to claim 3, characterized in that, The amplification primers include an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.
3.
5. A method for detecting the genotype of the SNP molecular marker according to claim 1, characterized in that, Includes the following steps: 1) Extract genomic DNA from the blood sample to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification using the primers in the kit described in claim 3 or 4 to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype at position 268 of the amplification products to determine the genotype of the SNP molecular marker.
6. The application of the SNP molecular marker of claim 1, the DNA molecule of claim 2, and the kit of claim 3 or 4 in the assisted breeding of disease resistance traits in Tibetan sheep.