Wrinkle-removing and anti-aging composition containing recombinant collagen as well as preparation method and application of wrinkle-removing and anti-aging composition

Abstract

The invention belongs to the technical field of cosmetics, and discloses a wrinkle-removing and anti-aging composition containing recombinant collagen as well as a preparation method and application of the wrinkle-removing and anti-aging composition. The composition is prepared from the following components: 20.4 to 35.6 percent of glycerol, 1.1 to 3.5 percent of 1, 2-hexanediol, 8.2 to 15.4 percent of apple fruit cell culture extract, 1.6 to 3.2 percent of inositol, 0.2 to 1.0 percent of elastin, 0.1 to 1.7 percent of hydroxyproline, 0.1 to 1.0 percent of sodium polyglutamate, 0.1 to 1.0 percent of sodium hyaluronate, 0.01 to 0.1 percent of acetyl hexapeptide-8, 0.01 to 0.1 percent of fibronectin, 1.72 to 3.21 percent of soluble collagen and the balance of deionized water. The amino acid sequence of the soluble collagen is as shown in SEQ ID NO. 1. The skin care product prepared by adding the anti-wrinkle and anti-aging composition is good in safety and has the effects of resisting wrinkles, improving skin elasticity and resisting aging.

Description

Technical Field

[0001] The present invention relates to the technical field of cosmetics, and in particular to a wrinkle-removing and anti-aging composition containing recombinant collagen, and a preparation method and application thereof. Background Art

[0002] As people age, wrinkles inevitably develop on their skin. The development of wrinkles is a dynamic, multifaceted process, primarily linked to the decline of multiple functional layers, including the epidermis and dermis. The metabolism of epidermal cells slows with age, reducing the water storage capacity of the stratum corneum and causing the epidermis to thin. This leads to increased risk of desquamation, dry lines, and fine lines. Currently, most anti-wrinkle products on the market struggle to provide rapid, sustained, and effective improvement. As people's living standards continue to improve, they are placing increasing emphasis on skin care and maintenance, and their expectations for skincare products are also rising.

[0003] Collagen is the most abundant protein in mammals, accounting for approximately 30% of the total protein weight. As the primary structural protein, collagen is present in numerous types, with the most common types being types I, II, III, V, and XI. In normal skin tissue, collagen primarily exists as type I and III collagen fibrils. Type III collagen, encoded by the COL3A1 gene, is a fibrillar collagen composed of three tightly packed peptide chains forming a homotrimer with a triple helical structure. Type III collagen is widely found in connective tissues such as the skin, lungs, liver, intestines, and blood vessels. Type III collagen often coexists with type I collagen, forming a major component of the extracellular matrix and participating in the regulation of fundamental cellular activities such as adhesion, proliferation, migration, and differentiation. Compared to type I collagen, type III collagen is found at lower levels in animal tissues, making its extraction more difficult and costly. Recombinant collagen III produced using recombinant DNA technology offers greater controllability and safety, and holds broad application prospects in biomedical research.

[0004] Currently, most anti-wrinkle products on the market have relatively limited action pathways for wrinkle improvement, making it difficult to achieve rapid, sustained, and effective results. Against this backdrop, the present invention provides a wrinkle-removing and anti-aging composition containing recombinant collagen, as well as its preparation method and application. This composition is safe, environmentally friendly, and can be widely used in skincare, cosmetics, and other fields. Summary of the Invention

[0005] In order to overcome the deficiencies of the prior art, the primary purpose of the present invention is to provide a wrinkle-removing and anti-aging composition containing recombinant collagen, which has the effect of significantly improving wrinkles and enhancing skin elasticity.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A wrinkle-removing and anti-aging composition containing recombinant collagen comprises the following components by mass fraction: 20.4-35.6% glycerol, 1.1-3.5% 1.2-hexanediol, 8.2-15.4% apple (MALUS DOMESTICA) fruit cell culture extract, 1.6-3.2% inositol, 0.2-1.0% elastin, 0.1-1.7% hydroxyproline, 0.1-1.0% sodium polyglutamate, 0.1-1.0% sodium hyaluronate, 0.01-0.1% acetyl hexapeptide-8, 0.01-0.1% fibronectin, 1.72-3.21% soluble collagen, and the balance being deionized water; the soluble collagen is recombinant type III collagen; the amino acid sequence of the recombinant type III collagen is shown in SEQ ID NO.1.

[0008] Preferably, the nucleotide sequence encoding recombinant type III collagen is shown as SEQ ID NO.2.

[0009] Preferably, the specific preparation process of the recombinant type III collagen is as follows:

[0010] (1) Optimizing the effective sequence of human type III collagen mature peptide, optimizing the functional fragment combination and protein stability and other physical and chemical properties, and designing the amino acid sequence of recombinant type III collagen CeI1 as shown in SEQ ID NO.1;

[0011] (2) Reverse designing the gene sequence based on the amino acid sequence of recombinant type III collagen CeI1 SEQ ID NO.1, performing codon optimization, and obtaining the nucleotide sequence encoding recombinant type III collagen SEQ ID NO.2;

[0012] (3) ligating the nucleotide sequence encoding recombinant type III collagen to the vector pET30a to obtain a recombinant plasmid;

[0013] (4) Transforming the recombinant plasmid into E. coli BL21 (DE3) engineered bacteria to construct a recombinant strain;

[0014] (5) inoculating the recombinant strain constructed in step (4) into LB medium and shaking overnight, and adding IPTG to induce the expression of recombinant type III collagen;

[0015] (6) Recombinant type III collagen was purified by affinity chromatography to obtain recombinant type III collagen.

[0016] Preferably, the LB culture medium in step (5) is an LB culture medium containing 50-100 μg / mL of kanamycin, and the induction expression concentration of IPTG is 0.4-0.6 mmol / L.

[0017] Another object of the present invention is to provide a method for preparing a wrinkle-removing and anti-aging composition containing recombinant collagen.

[0018] The purpose of the present invention is achieved through the following technical solutions:

[0019] The method for preparing the above-mentioned wrinkle-removing and anti-aging composition containing recombinant collagen comprises the following specific steps:

[0020] (1) Mix 1,2-hexanediol, inositol, and apple (MALUS DOMESTICA) fruit cell culture extract with water according to the weight percentage of the raw materials, heat to 65-70° C., and stir until completely dissolved;

[0021] (2) adding hydroxyproline, sodium polyglutamate, and sodium hyaluronate to the solution of step (1) and stirring until uniformly dispersed;

[0022] (3) Cool to 60°C, add pH adjuster, stir for 10 minutes until uniform, and continue cooling;

[0023] (4) Cool down to 40°C, add elastin, acetyl hexapeptide-8, fibronectin, recombinant type III collagen, and glycerol, and stir evenly.

[0024] The third object of the present invention is to provide an application of an anti-wrinkle and anti-aging composition containing recombinant collagen in the preparation of skin care products.

[0025] The purpose of the present invention is achieved through the following technical solutions:

[0026] The use of the above-mentioned wrinkle-removing and anti-aging composition containing recombinant collagen in the preparation of skin care products.

[0027] Preferably, based on the total mass of the skin care product, the mass percentage of the wrinkle-removing and anti-aging composition is 3%-5%.

[0028] Compared with the existing technology, the present invention has the following effects: the present invention uses gene recombination technology to construct and express a recombinant type III collagen. The wrinkle-removing and anti-aging composition added with recombinant type III collagen has good safety, can promote skin collagen absorption, inhibit skin aging, remove wrinkles and tighten, and improve skin elasticity, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the expression diagram of the purified recombinant type III collagen prepared by the present invention;

[0030] Figure 2 The percentage of wrinkle reduction of the skin care product prepared by the present invention;

[0031] Figure 3 The percentage of skin elasticity improved by the skin care product prepared by the present invention. DETAILED DESCRIPTION

[0032] The present invention will be described in further detail below in conjunction with the examples, but embodiments of the present invention are not limited thereto. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. The test methods for which specific experimental conditions are not specified in the following examples are usually based on conventional experimental conditions or the experimental conditions recommended by the manufacturer. Unless otherwise stated, the reagents and raw materials used in the present invention can be obtained commercially.

[0033] The preparation method of the apple (MALUS DOMESTICA) fruit cell culture extract used in the embodiment of the present invention is as follows:

[0034] Apple pulp was rinsed and cut into small pieces. The pulp tissue was cultured in an induction medium at 25°C and light <1000 lux for 18 days to obtain callus tissue. The callus tissue was transferred to a growth medium and cultured with shaking and aeration to obtain single cells. The single cells were inoculated into the growth medium and expanded for 26 days. The precipitate was removed by centrifugation, and 6 volumes of water were added. The cells were disrupted under 220 kHz ultrasonic conditions for 2 hours, concentrated, and dried.

[0035] Example 1

[0036] A wrinkle-removing and anti-aging composition containing recombinant collagen comprises the following components in mass fractions: 28% glycerol, 2.3% 1.2-hexanediol, 11.8% apple (MALUS DOMESTICA) fruit cell culture extract, 2.4% inositol, 0.6% elastin, 0.9% hydroxyproline, 0.5% sodium polyglutamate, 0.5% sodium hyaluronate, 0.05% acetyl hexapeptide-8, 0.05% fibronectin, 2.47% soluble collagen (recombinant type III collagen), and the balance is deionized water.

[0037] The method for preparing the recombinant type III collagen specifically includes the following steps.

[0038] (1) According to the amino acid sequence of human type III collagen (TniProtKB / Swiss-Prot: P02461.4), important functional sites of type III collagen were selected, including amino acids 381-530, 885-902 and 1152-1190. The three segments of human type III collagen were connected end to end to form a new short peptide. The N-terminus of the short peptide was modified with GTSGHPGSPGSPGYQ, and the C-terminus was modified with GAPGAAGARGND to obtain recombinant humanized type III collagen. The recombinant collagen strictly complies with the Gly-XY repeating sequence 100%, and there is no risk of disease caused by mutation. Its properties are close to those of natural type III collagen, and the recombinant expression efficiency is high. The amino acid sequence of the recombinant type III collagen CeI1 is shown in SEQ ID NO.1.

[0039] (2) The gene sequence was reverse-designed based on the amino acid sequence of recombinant type III collagen SEQ ID NO.1, and the corresponding base sequence was codon-optimized according to the codon preference of Escherichia coli for expressing heterologous proteins to obtain the nucleotide sequence encoding recombinant type III collagen, as shown in SEQ ID NO.2. Based on the optimized sequence, upstream and downstream primers for amplifying recombinant type III collagen were designed. The upstream primer was GGATCCGGCACCAGCGGTCACCCGGGCTCCC, containing the BamH I restriction site GGATCC, and the downstream primer was GAGCTCGTCGTTGCCGCGGGCACCCGCTGCAC, containing the Sac I restriction site GAGCTC. The gene was amplified by PCR, and the target fragment was purified using a gel recovery kit.

[0040] Table 1 Sequence Listing

[0041]

[0042] (3) Plasmid pET30a was double-digested with restriction endonucleases BamHI and SacI. The double-digestion reaction system is shown in Table 2. The recombinant collagen CeI1 gene fragment recovered after amplification was ligated with the target fragment of the expression vector pET30a using T4 DNA ligase. The T4 DNA ligase reaction system is shown in Table 3. The recombinant plasmid pET30a-CeI1 was obtained after identification and sequencing.

[0043] Table 2 Double enzyme digestion reaction system

[0044]

[0045] Table 3 T4 DNA ligase reaction system

[0046]

[0047] (4) The recombinant plasmid pET30a-CeI1 constructed in step (3) was transformed into E. coli BL21 (DE3) competent cells, spread on LB plates containing 100 μg / mL kanamycin, and incubated inverted at 37°C overnight to obtain a recombinant strain named pET30a-CeI1 / BL21.

[0048] (5) Positive monoclonal colonies were selected and inoculated into LB culture medium containing 100 μg / mL kanamycin, cultured at 37°C overnight with shaking, and 0.5 mmol / L IPTG was added to induce the expression of recombinant type III collagen.

[0049] (6) The recombinant type III collagen was purified by affinity chromatography to obtain recombinant type III collagen. The purified recombinant type III collagen was detected by SDS-PAGE gel. The results were as follows: Figure 1 shown.

[0050] This embodiment also provides a method for preparing a wrinkle-removing and anti-aging composition containing recombinant collagen, which specifically comprises the following steps:

[0051] (1) According to the weight percentage of the raw materials, 1,2-hexanediol, inositol, apple (MALUS DOMESTICA) fruit cell culture extract and water were mixed, heated to 67°C, and stirred until completely dissolved;

[0052] (2) adding hydroxyproline, sodium polyglutamate, and sodium hyaluronate to the solution of step (1) and stirring until uniformly dispersed;

[0053] (3) Cool to 60°C, add pH adjuster, stir for 10 minutes until uniform, and continue cooling;

[0054] (4) Cooling to 40° C., adding elastin, acetyl hexapeptide-8, fibronectin, recombinant type III collagen, and glycerol, and stirring evenly to obtain an anti-wrinkle and anti-aging composition containing recombinant collagen.

[0055] Example 2

[0056] A wrinkle-removing and anti-aging composition containing recombinant collagen comprises the following components by mass fraction: 20.4% glycerol, 1.1% 1.2-hexanediol, 8.2% apple (MALUS DOMESTICA) fruit cell culture extract, 1.6% inositol, 0.2% elastin, 0.1% hydroxyproline, 0.1% sodium polyglutamate, 0.1% sodium hyaluronate, 0.01% acetyl hexapeptide-8, 0.01% fibronectin, 1.72% soluble collagen (recombinant type III collagen), and the balance is deionized water.

[0057] The preparation method of the recombinant type III collagen is the same as that in Example 1;

[0058] This embodiment also provides a method for preparing a wrinkle-removing and anti-aging composition containing recombinant collagen, which specifically comprises the following steps:

[0059] (1) According to the weight percentage of the raw materials, 1,2-hexanediol, inositol, apple (MALUS DOMESTICA) fruit cell culture extract and water were mixed, heated to 65°C, and stirred until completely dissolved;

[0060] (2) adding hydroxyproline, sodium polyglutamate, and sodium hyaluronate to the solution of step (1) and stirring until uniformly dispersed;

[0061] (3) Cool to 60°C, add pH adjuster, stir for 10 minutes until uniform, and continue cooling;

[0062] (4) Cooling to 40° C., adding elastin, acetyl hexapeptide-8, fibronectin, recombinant type III collagen, and glycerol, and stirring evenly to obtain an anti-wrinkle and anti-aging composition containing recombinant collagen.

[0063] Example 3

[0064] A wrinkle-removing and anti-aging composition containing recombinant collagen comprises the following components in mass fractions: 35.6% glycerol, 3.5% 1.2-hexanediol, 15.4% apple (MALUS DOMESTICA) fruit cell culture extract, 3.2% inositol, 1.0% elastin, 1.7% hydroxyproline, 1.0% sodium polyglutamate, 1.0% sodium hyaluronate, 0.1% acetyl hexapeptide-8, 0.1% fibronectin, 3.21% soluble collagen (recombinant type III collagen), and the balance is deionized water.

[0065] The preparation method of the recombinant type III collagen is the same as that in Example 1;

[0066] This embodiment also provides a method for preparing a wrinkle-removing and anti-aging composition containing recombinant collagen, which specifically comprises the following steps:

[0067] (1) According to the weight percentage of the raw materials, 1,2-hexanediol, inositol, apple (MALUS DOMESTICA) fruit cell culture extract and water were mixed, heated to 70°C, and stirred until completely dissolved;

[0068] (2) adding hydroxyproline, sodium polyglutamate, sodium hyaluronate, etc. to the solution of step (1) and stirring until uniformly dispersed;

[0069] (3) Cool to 60°C, add pH adjuster, stir for 10 minutes until uniform, and continue cooling;

[0070] (4) Cooling to 40° C., adding elastin, acetyl hexapeptide-8, fibronectin, recombinant type III collagen, and glycerol, and stirring evenly to obtain an anti-wrinkle and anti-aging composition containing recombinant collagen.

[0071] Comparative Example 1

[0072] Comparative Example 1 provides a wrinkle-removing and anti-aging composition, which differs from Example 1 in that the recombinant type III collagen (soluble collagen) is omitted, and all other aspects are the same as Example 1.

[0073] Comparative Example 2

[0074] Comparative Example 2 provides an anti-wrinkle and anti-aging composition, which differs from Example 1 in that the recombinant type III collagen (soluble collagen) in Example 1 is replaced by human type III collagen (amino acid sequence TniProtKB / Swiss-Prot: P02461.4), and the rest is the same as Example 1.

[0075] Test Example 1

[0076] Safety evaluation of skin care products:

[0077] A skin care product is composed of the following raw materials in percentage by weight: 5% of an anti-wrinkle and anti-aging composition, 2% of carbomer, 3% of caprylic and capric triglyceride, and the balance being deionized water. Safety testing of the skin care product prepared by adding the anti-wrinkle and anti-aging compositions of Examples 1-3 and Comparative Examples 1-2 was performed, and the specific process is as follows:

[0078] Fifty women aged 18-35 years with no history of allergies were randomly divided into five groups. Skin care products prepared from the wrinkle-removing and anti-aging compositions of Examples 1-3 and Comparative Examples 1-2 were used, respectively. After cleaning the subject's back, a spot tester containing the sample was applied to a selected location on the back using non-irritating adhesive tape. After application, lightly press the tester with your fingers to evenly adhere the tester to the skin for 48 hours. After 48 hours, the subject removed the tester and marked the area. After 30 minutes, the tester was assessed under adequate lighting, once the indentation had disappeared. The criteria for adverse skin reactions are shown in Table 4.

[0079] Table 4 Standards for adverse skin reactions

[0080]

[0081] Test area

[0082]

[0083]

[0084] The results are shown in Table 5. All the subjects showed negative reactions, indicating that the skin care product prepared by the wrinkle-removing and anti-aging composition prepared by the present invention has no irritation to the skin and has good safety.

[0085] Test Example 2

[0086] Skin care product efficacy test:

[0087] The skin care products prepared by adding the anti-wrinkle and anti-aging compositions of Examples 1-3 and Comparative Examples 1-2 were tested for their anti-wrinkle effects and skin elasticity enhancement effects. The specific process is as follows:

[0088] 50 women with aging skin aged 30-45 years old were selected and randomly divided into 5 groups, with 10 people in each group. They used the skin care products made from the wrinkle removal and anti-aging compositions of Examples 1-3 and Comparative Examples 1-2 respectively. Wash your face with clean water before using the skin care products each time, twice a day, morning and evening, for 4 weeks. Eye wrinkles, skin elasticity, etc. were measured every 2 weeks. Eye wrinkles were measured using VISIACR, and the improvement of eye wrinkles after 14 days and 28 days was evaluated based on the values ​​measured by the VISIA tester, and the corresponding average values ​​for each group were obtained. The results are shown in Table 6. The percentage of wrinkle reduction after 28 days of use was calculated, and the results are shown in Table 6. Figure 2 The skin elasticity was measured using an ElastiMeter. The skin elasticity of the cheeks was measured for 14 days and 28 days, and the average values ​​for each group were obtained. The results are shown in Table 7. The skin lifting percentage after 28 days was calculated. Figure 3 shown.

[0089] Table 6 Anti-wrinkle efficacy evaluation results

[0090]

[0091] From Table 6 and Figure 2 It can be seen that the skin care products prepared in Examples 1-3 have a significant improvement on eye wrinkles compared to Comparative Examples 1 and 2. This indicates that the skin care products prepared from the wrinkle-removing and anti-aging composition can promote the absorption of skin collagen and have a significant effect on improving wrinkles.

[0092] Table 7 Improvement of skin elasticity

[0093]

[0094]

[0095] From Table 7 and Figure 3It can be seen that the skin care products prepared in Examples 1-3 can significantly improve skin elasticity compared with Comparative Examples 1 and 2. This shows that the skin care products prepared from the anti-wrinkle and anti-aging compositions can promote the absorption of skin collagen and have a significant effect of improving skin elasticity.

[0096] The above embodiments are only preferred embodiments of the present invention and cannot be used to limit the scope of protection of the present invention. Any non-substantial changes and replacements made by technicians in this field on the basis of the present invention fall within the scope of protection required by the present invention.

Claims

1. A wrinkle-removing and anti-aging composition containing recombinant collagen, characterized in that: The wrinkle-removing and anti-aging composition comprises the following components by mass fraction: 20.4-35.6% of glycerol, 1.1-3.5% of 1.2-hexanediol, 8.2-15.4% of apple (MALUS DOMESTICA) fruit cell culture extract, 1.6-3.2% of inositol, 0.2-1.0% of elastin, 0.1-1.7% of hydroxyproline, 0.1-1.0% of sodium polyglutamate, 0.1-1.0% of sodium hyaluronate, 0.01-0.1% of acetyl hexapeptide-8, 0.01-0.1% of fibronectin, 1.72-3.21% of soluble collagen, and the balance being deionized water; the soluble collagen is recombinant type III collagen; the amino acid sequence of the recombinant type III collagen is shown in SEQ ID NO.

1.

2. The anti-wrinkle and anti-aging composition containing recombinant collagen according to claim 1, characterized in that: The nucleotide sequence encoding recombinant type III collagen is shown in SEQ ID NO.

2.

3. The anti-wrinkle and anti-aging composition containing recombinant collagen according to claim 2, characterized in that: The specific preparation process of the recombinant type III collagen is as follows: (1) Optimizing the effective sequence of human type III collagen mature peptide, optimizing the functional fragment combination and protein stability and other physical and chemical properties, and designing the amino acid sequence of recombinant type III collagen CeI1 as shown in SEQ ID NO.1; (2) Reverse designing the gene sequence based on the amino acid sequence of recombinant type III collagen CeI1 SEQ ID NO.1, performing codon optimization, and obtaining the nucleotide sequence encoding recombinant type III collagen SEQ ID NO.2; (3) ligating the nucleotide sequence encoding recombinant type III collagen to the vector pET30a to obtain a recombinant plasmid; (4) Transforming the recombinant plasmid into E. coli BL21 (DE3) engineered bacteria to construct a recombinant strain; (5) inoculating the recombinant strain constructed in step (4) into LB medium and shaking overnight, and adding IPTG to induce the expression of recombinant type III collagen; (6) Recombinant type III collagen was purified by affinity chromatography to obtain recombinant type III collagen.

4. The wrinkle-removing and anti-aging composition containing recombinant collagen according to claim 3, characterized in that: The LB culture medium described in step (5) is an LB culture medium containing 50-100 μg / mL of kanamycin, and the induction expression concentration of the IPTG is 0.4-0.6 mmol / L.

5. The method for preparing the anti-wrinkle and anti-aging composition containing recombinant collagen according to any one of claims 1 to 4, characterized in that: The specific steps include: (1) Mix 1,2-hexanediol, inositol, and apple (MALUS DOMESTICA) fruit cell culture extract with water according to the weight percentage of the raw materials, heat to 65-70° C., and stir until completely dissolved; (2) adding hydroxyproline, sodium polyglutamate, and sodium hyaluronate to the solution of step (1) and stirring until uniformly dispersed; (3) Cool to 60°C, add pH adjuster, stir for 10 minutes until uniform, and continue cooling; (4) Cool down to 40°C, add elastin, acetyl hexapeptide-8, fibronectin, recombinant type III collagen, and glycerol, and stir evenly.

6. Use of the anti-wrinkle and anti-aging composition containing recombinant collagen according to claim 1 in the preparation of skin care products.

7. Use of the anti-wrinkle and anti-aging composition containing recombinant collagen according to claim 6 in the preparation of skin care products, characterized in that: Based on the total mass of the skin care product, the mass percentage of the wrinkle-removing and anti-aging composition is 3%-5%.

Images