Application of Rab27b and / or miR-295-3p in prevention and / or treatment of ejection fraction retention type heart failure

Abstract

The invention relates to the technical field of heart failure drugs, in particular to application of Rab27b and / or miR-295-3p in prevention and / or treatment of ejection fraction retention type heart failure. According to the construction of the gene delivery system of the targeted visceral adipose tissue Rab27b with the adeno-associated virus as the carrier, the system can accurately deliver shRNA to the target tissue, specific knock-down of Rab27b in the visceral adipose tissue is achieved, the'visceral adipose tissue-exosome-myocardial 'axis is blocked, and therefore the symptom of an HFpEF mouse model is remarkably improved. In addition, the invention also finds that the regulation of the expression of the miR-295-3p plays an important role in the treatment of the HFpEF, and the symptom of an HFpEF mouse model can also be effectively improved by inhibiting the expression of the miR-295-3p.

Description

Technical Field

[0001] The present invention relates to the technical field of heart failure drugs, and in particular to the use of Rab27b and / or miR-295-3p in treating heart failure with preserved ejection fraction. Background Art

[0002] Patients with heart failure with preserved ejection fraction (HFpEF) present with a left ventricular ejection fraction ≥50%. Unique clinical features of HFpEF include advanced age (approximately 70% are aged ≥65 years), and the presence of common conditions such as hypertension (75-90%), obesity (70-80%), hyperlipidemia (60-85%), and diabetes (50-100%). Statistics show that HFpEF accounts for approximately 40-50% of all heart failure patients, and this proportion will gradually increase with the aging and obesity of the global population. Currently, the core mechanisms of HFpEF remain unclear, with progress but no breakthroughs.

[0003] Overweight / obesity refers to the abnormal or excessive accumulation of fat cells, which can be detrimental to health. The prevalence of overweight / obesity is increasing, and is projected to comprise nearly 63.5% of adults by 2030. Overweight / obesity is closely associated with HFpEF, with over 70% of patients with HFpEF also experiencing overweight / obesity. A growing body of research suggests that these conditions are not simply comorbidities, but rather play a significant role in the pathophysiology of HFpEF. Compared with individuals of normal weight, individuals with overweight and obesity have a 38% and 56% higher risk of HFpEF, respectively, independent of other cardiovascular risk factors. Furthermore, visceral adipose tissue (including abdominal, omental, and mesenteric adipose tissue) is more strongly associated with the onset of HFpEF than subcutaneous fat. Some studies have even suggested that visceral adipose tissue has additional predictive value for the risk of HFpEF in individuals with overweight / obesity. Weight loss, whether through diet or surgery (subtotal gastrectomy), can improve cardiac diastolic function and alleviate HFpEF symptoms. Therefore, obesity may contribute to the onset of HFpEF. However, how excess fat cells in obesity communicate remotely with distant cardiomyocytes—the core mechanism by which obesity promotes the onset of HFpEF—remains unclear. Currently, no sufficiently effective drug therapy has been proven to alter disease progression and improve prognosis in patients with HFpEF. This dilemma has led to a huge unmet need in clinical treatment, urgently requiring the exploration and breakthrough of new interventions and treatment options. Summary of the Invention

[0004] The purpose of the present invention is to overcome the current shortage of HFpEF therapeutic drugs in the prior art, provide Rab27b and / or miR-295-3p that play a role in the treatment of HFpEF, and provide a valuable new drug development direction for the drug treatment of this disease.

[0005] To achieve the above objectives, the present invention provides the use of a preparation for inhibiting Rab27b gene expression and / or a preparation for inhibiting miR-295-3p expression in the preparation of a medicament for preventing and / or treating heart failure with preserved ejection fraction.

[0006] Through the above technical solution, the present invention proposes for the first time that specific knockdown of Rab27b and / or inhibition of miR-295-3p expression can significantly improve HFpEF symptoms, providing a new idea for the treatment of HFpEF. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] Figure 1 Results from preliminary experiments demonstrate that upregulation of Rab27b in visceral adipose tissue and circulating exosomal miR-295-3p are characteristic features of the metabolic HFpEF mouse model. A: Relative expression levels of Rab27a and Rab27b in visceral adipose tissue in control and HFpEF mice; B: Relative expression levels of miR-295-3p in visceral adipose tissue and circulating exosomal miR-295-3p (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns, not significant).

[0008] Figure 2 This is a map of the pAAV-U6-shRNA / spgRNA v2.0-CMV-EGFP-WPRE vector structure;

[0009] Figure 3Figure 3 is the effect of knockdown of Rab27b in visceral adipose tissue and its impact on circulating exosomes and HFpEF; A: Schematic diagram of the intervention of knockdown of Rab27b in visceral adipose tissue using AAVrec2; B: Representative immunofluorescence images confirm that AAVrec2-shRab27b#1 and #3 successfully knocked down Rab27b in visceral adipose tissue, scale bar = 500μm; C: Fluorescence quantitative PCR results confirm that AAVrec2-shRab27b#1 and #3 successfully knocked down the level of Rab27b in visceral adipose tissue; D: AAVrec2-shRab27b#1 and #3 significantly reduced the production of exosomes secreted by visceral adipose tissue; E: AAVrec2-shRab27b#1 and #3 significantly reduced the content of plasma exosomes; F: Effect of knockdown of Rab27b in visceral adipose tissue on small intestine G: Effect of knockdown of Rab27b in visceral adipose tissue on alleviating diastolic dysfunction (echocardiography) in mice; H: Effect of knockdown of Rab27b in visceral adipose tissue on alleviating pulmonary congestion (lung wet weight / dry weight) in mice; I: Effect of knockdown of Rab27b in visceral adipose tissue on alleviating cardiac hypertrophy (heart weight / tibia length) in mice; J: Effect of knockdown of Rab27b in visceral adipose tissue on alleviating cardiac fiber hypertrophy (myocardial cross-sectional area) in mice; K: Effect of knockdown of Rab27b in visceral adipose tissue on reducing heart failure markers (Nppa and Nppb mRNA, encoding A-type natriuretic peptide [ANP] and B-type natriuretic peptide [BNP], respectively) in mice (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns not significant);

[0010] Figure 4 The miR-295-3p antagonist reduces the progression of HFpEF. A: The relative expression level of circulating exosomal miR-295-3p after knockdown of Rab27b in visceral adipose tissue using AAVrec2. B: Schematic diagram of the intervention of miR-295-3p antagonist. C: The miR-295-3p antagonist reduces diastolic dysfunction (echocardiography) in mice. D: The miR-295-3p antagonist reduces pulmonary congestion (lung wet weight / dry weight) in mice. E: The miR-295-3p antagonist reduces exercise tolerance in mice. F: miR-295-3p antagonist reduces myocardial hypertrophy (heart weight / tibia length) in mice; G: miR-295-3p antagonist reduces myocardial fiber hypertrophy (myocardial cross-sectional area) in mice; H: miR-295-3p antagonist reduces heart failure indicators (Nppa and Nppb mRNA, encoding A-type natriuretic peptide [ANP] and B-type natriuretic peptide [BNP], respectively) in mice (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns not significant). DETAILED DESCRIPTION

[0011] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0012] The present invention provides use of a preparation for inhibiting Rab27b gene expression and / or a preparation for inhibiting miR-295-3p expression in preparing a medicament for preventing and / or treating heart failure with preserved ejection fraction.

[0013] In the present invention, the disease is Heart Failure with Preserved Ejection Fraction (HFpEF), which is a special type of heart failure. It is characterized by the inability of the heart to effectively pump blood to the whole body when the cardiac ejection fraction (LVEF) is normal or near normal (usually greater than or equal to 50%), resulting in insufficient blood supply to various parts of the body. This type of heart failure is common in the elderly, women, and people with chronic diseases such as hypertension and diabetes. The treatment goals of HFpEF are mainly to relieve symptoms, improve quality of life, and reduce the risk of cardiovascular events. Treatment methods include lifestyle intervention, drug therapy, cardiac resynchronization therapy (CRT), and surgical treatment. The management of HFpEF requires comprehensive consideration of the patient's individual situation, including controlling cardiovascular risk factors, managing symptoms, and regular follow-up.

[0014] In the present invention, the agent for inhibiting Rab27b gene expression can inhibit the expression of Rab27b gene by any mechanism, for example, by inhibiting the expression of Rab27b at the RNA or protein level, such as knocking down the Rab27b gene, reducing or inhibiting the transcription of the gene, and / or reducing or inhibiting the translation of the mRNA product of the gene.

[0015] Preferably, the agent for inhibiting the expression of the Rab27b gene is a recombinant vector that specifically targets the Rab27b gene.

[0016] In the present invention, the recombinant vector includes a gene silencing tool and a viral vector. Preferably, the gene silencing tool is selected from at least one of shRNA, siRNA, antisense RNA or CRISPR gene editing system, more preferably, shRNA.

[0017] In the present invention, the shRNA refers to short hairpin RNA, also known as "short hairpin RNA". shRNA includes two short inverted repeat sequences. The shRNA cloned into the shRNA expression vector includes two short inverted repeat sequences separated by a stem-loop sequence in the middle, forming a hairpin structure. As a method of RNA interference, shRNA targets are designed based on the transcript of the mouse Rab27b gene, and primer synthesis is arranged. The single-stranded primer is annealed into a double-stranded oligo sequence, connected to a double-enzyme linearized RNA interference vector, and the original ccdB toxic gene (such as Figure 2 (As shown, between the U6 promoter and gRNA v2.0). Transcription is performed using RNA polymerase III (Pol III) promoters, including human and mouse U6 and H1. The shRNA transcribed in the cell is processed and incorporated into an RNA-induced silencing complex, which directs nuclease degradation of Rab27b mRNA.

[0018] According to some preferred embodiments of the present invention, the agent capable of inhibiting Rab27b gene expression comprises shRNA.

[0019] According to some preferred embodiments of the present invention, the coding sequence of the shRNA comprises at least one sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0020] In the present invention, the viral vector is selected from at least one of lentivirus, adeno-associated virus (AAV) and adenovirus.

[0021] According to some preferred embodiments of the present invention, the viral vector is an adeno-associated virus (AAV), preferably an AAVrec2 serotype, and the shRNA is located between the U6 promoter and gRNA v2.0 in the adeno-associated viral vector.

[0022] According to some preferred embodiments of the present invention, the recombinant vector specifically targeting the Rab27b gene is administered by injection, preferably intraperitoneal injection.

[0023] In the present invention, the agent for inhibiting miR-295-3p expression is preferably a miR-295-3p antagonist.

[0024] More preferably, the miR-295-3p antagonist is a nucleic acid fragment having a sequence as shown in SEQ ID NO:14.

[0025] According to some preferred embodiments of the present invention, the miR-295-3p antagonist is administered by injection, preferably intravenous injection, more preferably tail vein injection.

[0026] In the present invention, the dosage form of the drug is at least one of injection, oral solution, tablet, granule, capsule and pill, preferably injection.

[0027] In the present invention, the drug further comprises a pharmaceutically acceptable excipient, which is at least one of an excipient, a filler, a binder, a wetting agent, a sustained-release agent, an absorption enhancer, a surfactant, and a lubricant. Those skilled in the art can select the specific type of excipient according to the dosage form of the drug.

[0028] The present invention will be described in detail below through examples.

[0029] In the following examples, adeno-associated virus (AAVrec2 serotype) was purchased from Heyuan Biotechnology (Shanghai) Co., Ltd.

[0030] Example 1

[0031] Validation of visceral adipose tissue Rab27b upregulation and circulating exosomal miR-295-3p as hallmarks of a metabolic HFpEF mouse model

[0032] Male wild-type (6-week-old, 18-22 g, Charles River) C57BL / 6N mice were randomly divided into groups and exposed to a normal diet (chow) or a high-fat diet (HFD, #D12492, Research Diet) plus L-NAME (0.5 g / L dissolved in drinking water, pH adjusted to 7.4, #S2446, Sigma Aldrich) for 5 weeks to establish the HFpEF mouse model.

[0033] The relative expression levels in visceral adipose tissue of control mice and HFpEF mice were detected. To detect the expression of Rab27a and Rab27b, TRIzol reagent was used to extract RNA from visceral adipose tissue (Cat. No. 15596026CN, Invitrogen) and GoScript was used according to the manufacturer's instructions. TM Reverse Transcription System Technical Manual (Cat. No.: A5001, Brand: Promage) was used to reverse transcribe RNA into cDNA; qPCR SYBR Green MasterMix (Cat. No. 11201ES03, Yisheng Biotechnology) and gene-specific primers were used to detect the relative expression levels of the target genes. Gapdh was used as an internal reference for both Rab27a and Rab27b. The primer sequences were obtained from the public database pPrimerbank (https: / / pga.mgh.harvard.edu / primerbank / ). The experimental results are shown in Figure 2. Figure 1 As shown in A, there was no significant difference in the expression of Rab27a in visceral adipose tissue between the control group and HFpEF mice, but Rab27b was significantly upregulated in the visceral adipose tissue of HFpEF mice.

[0034] The relative expression levels of miR-295-3p in the visceral adipose tissue and circulating exosomes of the control mice and HFpEF mice were detected. Fluorescence quantitative PCR detection of miR-295-3p was performed using the Hairpin-it miRNA-295-3p RT-PCR Quantitation Kit from Genetron Health according to the instructions. Primer sequences: Mmu-miR-295-3p Forward: CGAGCCTGCAAAGTGCTACTACT (SEQ ID NO: 1), Reverse: TATGGTTGTTCACGACTCCTTCAC (SEQ ID NO: 2); internal reference U6 Forward: CGCTTCGGCAGCACATATAC (SEQ ID NO: 3), Reverse: TTCACGAATTTGCGTGTCATC (SEQ ID NO: 4). The experimental results are shown in Figure 2. Figure 1 As shown in Figure 2, the relative expression levels of miR-295-3p in visceral adipose tissue and circulating exosomes were significantly increased in HFpEF mice.

[0035] Example 2

[0036] (I) Construction of an adeno-associated virus (AAVrec2 serotype) vector targeting Rab27b in visceral adipose tissue

[0037] 1. Interference target design and primer synthesis:

[0038] Design shRNA targets and arrange primer synthesis. Based on the sequence of Rab27b (from the NCBI database), three pairs of shRab27b were designed. The specific coding sequences are shown in Table 1.

[0039] Table 1. shRNA sequences

[0040] serial number Target Gene ID Sequence (5'-3') #1 Rab27b NM_030554.4 GCATACCATACTTCGAAACAA(SEQ ID NO:5) #2 Rab27b NM_030554.4 GCTTCTGGACTTAATCATGAA(SEQ ID NO:6) #3 Rab27b NM_030554.4 ACCCAGACATAGTATTAATTG(SEQ ID NO:7) NC — — CCTAAGGTTAAGTCGCCCTCG(SEQ ID NO:8)

[0041] 2. Primers anneal to form double-stranded fragments with sticky ends:

[0042] Dissolve the synthesized oligo in oligo annealing buffer to 20 μM and mix 30 μL of each complementary single-stranded oligo. Heat the oligo mixture in a water bath at 95°C for 5 minutes. Then, remove the lid and allow the mixture to cool to room temperature to form double-stranded oligo fragments. Use 1 μL for the subsequent ligation reaction and store the remaining fragment at -20°C.

[0043] 3. Preparation of linearized expression vector:

[0044] The expression vector was digested with restriction endonucleases using the following digestion reaction system: 2 μg of plasmid, 5 μL of 10× reaction buffer, 1 μL of each restriction endonuclease, and deionized water to 50 μL. Incubate in a 37°C waterbath for at least 2 hours. The digestion products were examined by agarose gel electrophoresis. The target vector band was excised from the gel and recovered using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver. 3.0. For specific steps, refer to the kit instructions (Cat. No. 9763, Brand: TaKaRa, Japan).

[0045] 4. Connect the interference fragment into the expression vector:

[0046] Table 2. Ligation reaction system

[0047]

[0048] Ligation was carried out at 16°C overnight.

[0049] 5. Transformation of competent cells:

[0050] For details on transformation of DH5α competent cells (Heyuan Biotechnology (Shanghai) Co., Ltd.), please refer to the "Concise Molecular Biology Experiment Guide".

[0051] 6. Identification of positive transformants by colony PCR:

[0052] Transformants grown on the plates were picked and resuspended in 10 μL of LB medium. 1 μL was used as a template for colony PCR identification. PCR reaction system: 25 μL of PreMix Taq (TaKaRa Taq™ Version 2.0 plus dye), 10 μL of template, 1 μL each of primers 1 and 2 (20 μM), and sterile distilled water to 50 μL. PCR reaction conditions: three-step PCR, 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute / kb, for 30 cycles; two-step PCR, 98°C for 10 seconds, 68°C for 1 minute / kb, for 30 cycles.

[0053] 7. Send positive clones for sequencing:

[0054] Positive clones obtained from colony identification were sequenced and verified by Heyuan Biotechnology (Shanghai) Co., Ltd. The sequencing results were compared and analyzed using Vector NTI software.

[0055] 8. Plasmid extraction:

[0056] After sequencing, confirm the correct positive clones and arrange for plasmid mini-prep. For detailed steps, refer to the kit instructions (Cat. No. DP103-02, Manufacturer: Tiangen, China).

[0057] Sequencing results:

[0058] AAVrec2-shRab27b#1 sequencing results (SEQ ID NO: 9):

[0059] GAAGGATATTTGACTGTAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAAC ACCGGCATACCATACTTCGAAACAACTCGAGTGTTTTTCGAAGTA TGGTATGCTTTTTTGCTAGCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGTGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGTCCCCATCCAGGCTGTTTGGACCTCCATAAGAAGACACCGAGACCGATCCAGCCTCCGGTCGACGCCACCATGGATAACAAGGGCGAGAGCTGTTCCCCCGGGGTGGTGCCCATCCTGGTCCAACTGGACGGCGAACTTAAACGGCCAAAAGTTCGCCGGTTCCGGCGAAGGCAAGGTTATACCCCCTACAGCAAACTAACCCTAAATTTATTGGACCACCGTAAAATT

[0060] Sequencing result of AAVrec2 - shRab27b#2 (SEQ ID NO:10):

[0061] AAAAAGGGGAAATTAAATTTTGACTTGTAAAACACAAAGATAATTAGTAACAAAAATACGTGACGTAGAAAGTAATAATTACTTAGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAAC ACCGGCTTCTGGACTTAATCATGAACT CGAGTTCATGATTAAGTCCAGAAGCTTTTTTG CTAGCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCGATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGAAACCAAAAGTCAACGGAAACTTTTCCAAATGACGTAAACAACCTCCGGCCCCCATTTGACGCAAATTGGGGCGGGTAAGGGCGTTGGTACCGGGTGGGGGAGGACCTAATAATAAAAGCAAGAAGCTTCCGATTTTAAATTGGAAACCCGGTCCAAGAATCGGCCCCTGGAAGTTCCGCCCCAATCCCCACGGCCTGGTTTTTTTTGGACCCCTTCCCCAATTAGGAAAAGGAAACAACCCCGGAGGGAACCCGAATTTCCCAAGGCCCCTTCCCCGGGGTTCCGAAACCGGCCCCCACCCCCATTTGGGGGTTGGAAAGGCCCCAAAGGGGGGGCCGAAAAA

[0062] Sequencing result of AAVrec2-shRab27b#3 (SEQ ID NO:11):

[0063] GAGTAAAATTGGGGAAATATTTGGACTGTAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATAACTATGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAAC ACCGACCCAGACATAGTATTAATTGCTCGAG CAATTAATACTATGTCTGGGTTTTTTTGCTAGCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGTCGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGTCGACGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGACTGGACGGGAACGTAAAGGCACAATTCAACGTGTCCGGCGAGGGCAAGGGCGATGCCCCTAT

[0064] Sequencing result of AAVrec2 - shNC (NC control plasmid containing a non - related sequence) (SEQ ID NO:12):

[0065] ATAGAAAATGGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGG C TAGCAAAAAACCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGCGGTGTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAATTATTACTTTCTACGTCACGTATTTTGTACTAATATCTTTGTGTTTACAGTCAAATTAATTCCAATTATCTCTCTAACAGCCTTGTATCGTATATGCAAATATGAAGGAATCATG GGAAATAGGCCCTCGGTGAAGGGGGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCAGTGAGCCAGCGAGCGCGCAGCTACCTTGCGGGACATGTGAGCAAAAGGCCAGCAAAAGGCCAGCAATCGTAAAAAGGCCGCGTATGCTGGCGTTTTTCCCTAGGCT

[0066] (II) Effects of knocking down Rab27b expression on HFpEF

[0067] The mice in the control group and HFpEF group in Example 1 were injected with corresponding AAVrec2 (four AAVrec2s, i.e., shRab27b#1, #2, #3, and shNC) intraperitoneally (1 injection in each of the bilateral abdominal flanks, 1×10 11 vg, volume 50 μL), and the mice were evaluated at week 12 (i.e., mice were 18 weeks old) ( Figure 3 A).

[0068] Immunofluorescence was used to examine the expression of Rab27a and Rab27b in visceral adipose tissue. Visceral adipose tissue was embedded in OCT cryosection embedding medium (C0171A-118ml, Beyotime, China) and cut into 5-μm sections using a cryostat. After rinsing three times with pure water, sections were blocked with sheep serum working solution (ZLI-9022, Zhongshan Jinqiao, China) for 30 minutes at room temperature and incubated with primary antibodies against Rab27a and Rab27b (Proteintech, China) at 4°C overnight. After rewarming, sections were rinsed three times with pure water and incubated with fluorescently labeled secondary antibodies (Proteintech, China) for 1 hour at room temperature. After rinsing three times with pure water, sections were mounted with anti-quenching mounting solution (containing DAPI) (P0131, Beyotime, China). Fluorescence signals were detected under the corresponding excitation light.

[0069] The relative expression level of Rab27b was detected by fluorescence quantitative PCR to test the knockdown effect of AAVrec2. The specific steps are shown in Example 1.

[0070] To evaluate the ability of visceral adipose tissue to release exosomes, it was cut into small pieces (<0.1 cm 3 ) and cultured in serum-free DMEM for 24 hours. The supernatant was collected and exosomes were isolated using the ExoQuick-TC kit (EXOTC10A-1, SBI). Plasma exosome (circulating exosome) concentrations were measured using the ExoQuick Plasma Preparation and Exosome Precipitation Kit (EXOQ5TM-1, SBI). Circulating exosome concentrations were measured using nanoparticle tracking analysis (NTA) using a NanoSight instrument (Malvern Instruments).

[0071] Evaluation of AAV knockdown and inhibition of exosome production in visceral adipose tissue: Immunofluorescence and qPCR results showed that the level of Rab27b in visceral adipose tissue was significantly increased in HFpEF mice without shRab27b delivery; Rab27b protein and mRNA were successfully knocked down in the AAVrec2-shRab27b#1 and #3 treatment groups ( Figure 3 BC). Then the exosome production per unit mass of visceral tissue was detected ( Figure 3 D) and circulating exosome concentrations ( Figure 3 E) We observed that knockdown of Rab27b in visceral adipose tissue decreased the secretion of exosomes into the blood.

[0072] HFpEF phenotype assessment

[0073] 1. Echocardiographic cardiac function evaluation

[0074] Transthoracic echocardiography was performed on mice using a VisualSonics Vevo 2100 system equipped with an MS400 transducer (Visual sonic). Ejection fraction (LVEF) and other systolic function indices were obtained at the mid-ventricular level using short-axis M-mode scanning. Pulsed wave and tissue Doppler imaging were used on the apical four-chamber view at the level of the mitral valve to measure the early diastolic peak velocity E' at the root of the mitral annulus, the late diastolic peak velocity A' at the root of the mitral annulus, the peak Doppler blood flow velocity E-peak in early diastole, and the peak Doppler blood flow velocity A-peak in late diastole across the mitral valve. Diastolic function was evaluated using E / E' and E / A. Anesthesia was performed with 1.5% isoflurane, and the heart rate was adjusted to maintain the heart rate within the range of 400-500 beats / min. The results are shown in Figure 2. Figure 3 As shown in F.

[0075] 2. Exercise endurance test

[0076] After acclimating to treadmill exercise for 3 days, the mice were run on a 10° uphill treadmill at a warm-up speed of 4 m / min for 5 minutes, after which the speed was increased to 9 m / min for 2 minutes. The speed was then increased by 2 m / min every 2 minutes until the mice could not resume running within 10 seconds of direct contact with the electrical stimulation grid. The running time was measured and the running distance was calculated. Figure 3 As shown in H.

[0077] 3. Lung wet weight / dry weight

[0078] C57 mice were anesthetized with an intraperitoneal injection of 2% tribromoethanol (10 mL / kg body weight). The hilar vessels were ligated, the lungs were removed, and the lungs were wiped dry and weighed as the wet weight. The lung dry weight was weighed after the lungs were dried until the weight did not change (approximately 72 hours). The lung wet weight / dry weight ratio was calculated. Figure 3 As shown in G.

[0079] 4. Heart weight / tibia length

[0080] After the mice were anesthetized and killed, PBS was injected into the left ventricle to perfuse the heart. The heart was then removed, dried, and weighed. The tibia of the mouse was also taken and measured with a vernier caliper. The heart weight / tibia length ratio was calculated. Figure 3 As shown in I.

[0081] 5. Assessment of heart and myocardial cell size (H&E staining, WGA staining)

[0082] After the mice were anesthetized and killed, the hearts were perfused and removed, fixed in 4% paraformaldehyde for 36-48 hours, and then dehydrated with alcohol: 70% ethanol, 80% ethanol, 90% ethanol, 95% ethanol I, 95% ethanol II for 30 minutes each, 100% ethanol for 18 minutes, xylene I and xylene II for 8 minutes each, and paraffin at 65-70°C for 60 minutes. Paraffin embedding and sectioning were performed on a Leica embedding machine and a manual rotary microtome, respectively. For WGA staining, the sections were baked at 60°C for 60 minutes, dewaxed in xylene, eluted with alcohol gradients from high to low, rinsed with clean water, and antigens were repaired under high pressure with a citrate solution of pH 6.0. The sections were blocked with goat serum at room temperature for 1 hour, and WGA staining solution (0.1%) dissolved in HBSS was added dropwise and incubated at room temperature in the dark for 30 minutes. After washing with PBS, the sections were sealed with an anti-fluorescence quenching sealing agent containing DAPI. The results are shown in the figure below. Figure 3 As shown in J.

[0083] 6. Biochemical indicators of heart failure

[0084] Myocardial RNA was extracted using TRIzol reagent (Cat. No. 15596026CN, Invitrogen), and the levels of Nppa and Nppb were detected by quantitative PCR. The steps were as follows: According to the instructions, use GoScript TM Reverse Transcription System Technical Manual (Cat. No.: A5001, Brand: Promage) was used to reverse transcribe RNA into cDNA; qPCR SYBR Green Master Mix (Cat. No. 11201ES03, Yisheng Biotechnology) and gene-specific primers were used to detect the relative expression levels of the target genes. Gapdh was used as an internal reference for both Nppa and Nppb. The primer sequences were obtained from the public database primerbank (https: / / pga.mgh.harvard.edu / primerbank / ). Figure 3 As shown in K.

[0085] Seven weeks after AAVrec2 injection, the HFpEF phenotype was assessed and it was observed that knockdown of Rab27b in visceral adipose tissue abrogated cardiac diastolic function ( Figure 3 F), pulmonary congestion ( Figure 3 G), exercise tolerance ( Figure 3 H), myocardial hypertrophy ( Figure 3 IJ), heart failure index ( Figure 3 K) showed significant improvement and alleviated the symptoms of HFpEF.

[0086] (IV) Exploring the association between Rab27b and miR-295-3p in visceral adipose tissue

[0087] The effect of knocking down Rab27b in visceral adipose tissue using AAVrec2 on the relative expression level of circulating exosomal miR-295-3p. The relative expression level of miR-295-3p was detected by fluorescence quantitative PCR. The specific steps are shown in Example 1. Figure 4 As shown in Figure A, in the absence of shRab27b delivery, circulating exosomal miR-295-3p was significantly increased in HFpEF mice; however, miR-295-3p levels were significantly decreased in mice with VAT Rab27b knockdown. Because VAT Rab27b knockdown reversed the elevated miR-295-3p levels in HFpEF mice, this finding suggests that direct intervention targeting miR-295-3p could serve as an alternative downstream intervention strategy for VAT Rab27b knockdown. Therefore, a miR-295-3p antagonist was injected into the tail vein of HFpEF mice as an alternative therapeutic approach.

[0088] Example 3

[0089] Evaluating the therapeutic effect of miR-295-3p antagonist on HFpEF

[0090] Aiming at the sequence of mmu-miR-295-3p (AAAGUGCUACUACUUUUGAGUCU, Accession: MIMAT0000373; SEQID NO: 13), a short nucleotide sequence (antagonist) that can antagonize its action was designed: AGACUCAAAAGUAGUAGCACUUU; SEQ ID NO: 14. The negative control sequence NC: CAGUACUUUUGUGUAGUACAA; SEQ ID NO: 15 was used as a control. The antagonist was synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd., with cholesterol modification at the 3' end, two sulfide backbone modifications at the 5' end, four sulfide backbone modifications at the 3' end, and full-chain methoxy modification. The antagonist has a higher affinity with the cell membrane and is particularly suitable for interference experiments in animals. It has higher stability and inhibitory effect in vivo, and the inhibition lasts for a long time (at least one week, and the interference effect can last for up to 5-6 weeks).

[0091] The control group and HFpEF group mice in Example 1 were injected with the corresponding tail vein (miR-295-3p antagonist NC, miR-295-3p antagonist) (50 μg / g body weight each time), once a week for 7 consecutive weeks (7 times in total), and the mice were evaluated at week 12 (i.e., mice were 18 weeks old) ( Figure 4 B).

[0092] The experimental procedures for HFpEF phenotype assessment are detailed in Example 2.

[0093] At 7 weeks after the injection of miR-295-3p antagonist, the HFpEF phenotype was evaluated and it was observed that the cardiac diastolic function of mice ( Figure 4 C) Pulmonary congestion ( Figure 4 D) exercise tolerance ( Figure 4 E), myocardial hypertrophy ( Figure 4 FG), heart failure index ( Figure 4 H) showed significant improvement, alleviating HFpEF symptoms.

[0094] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention.

Claims

1. Use of a preparation for inhibiting Rab27b gene expression and / or a preparation for inhibiting miR-295-3p expression in the preparation of a medicament for preventing and / or treating heart failure with preserved ejection fraction.

2. The use according to claim 1, wherein The preparation for inhibiting the expression of the Rab27b gene is a recombinant vector specifically targeting the Rab27b gene.

3. The use according to claim 2, wherein: The recombinant vectors include gene silencing tools and viral vectors.

4. The use according to claim 3, wherein: The gene silencing tool is selected from at least one of shRNA, siRNA, antisense RNA and CRISPR gene editing system, preferably, selected from shRNA.

5. The use according to claim 4, wherein: The coding sequence of the shRNA comprises at least one sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO:

7.

6. The use according to claim 3, wherein: The viral vector is selected from at least one of lentivirus, adeno-associated virus (AAV) and adenovirus, preferably adeno-associated virus (AAV).

7. The use according to claim 5, wherein: The shRNA is located between the U6 promoter and gRNA v2.0 in the adeno-associated virus vector.

8. The use according to claim 1, wherein: The preparation for inhibiting miR-295-3p expression is a miR-295-3p antagonist.

9. The use according to claim 8, wherein: The miR-295-3p antagonist is a nucleic acid fragment with a sequence as shown in SEQ ID NO:

14.

10. The use according to any one of claims 1 to 9, wherein: The dosage form of the drug is at least one of injection, oral solution, tablet, granule, capsule and pill; Alternatively, the drug further comprises a pharmaceutically acceptable excipient, wherein the excipient is at least one of an excipient, a filler, a binder, a wetting agent, a sustained-release agent, an absorption enhancer, a surfactant and a lubricant.

Images