Biocontrol fungus z9 for preventing and treating hippophae rhamnoides wilt and application thereof

By developing a biocontrol agent from Bacillus polymyxa Z9, the problem of insufficient biological control of sea buckthorn wilt was solved, achieving effective control of sea buckthorn wilt, reducing the use of chemical pesticides, and improving environmental quality.

CN120699847BActive Publication Date: 2026-04-07SHENYANG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511049329.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-29
Publication Date
2026-04-07
Estimated Expiration
2045-07-29

AI Technical Summary

Technical Problem

There is a lack of effective biological control methods to prevent and control seabuckthorn wilt disease in the current technology. The use of chemical pesticides has led to environmental pollution and increased resistance of pathogens, and there is a shortage of biological control resources.

Method used

A polymyxa bacillus Z9 strain was developed and prepared as a biocontrol agent. It was applied through root irrigation to control sea buckthorn wilt disease. The rapid reproduction rate of this strain and its inhibitory effect on a variety of pathogens can reduce the use of chemical agents.

Benefits of technology

This invention provides a biocontrol strain that is safe for humans and animals, enriches biological control resources, reduces the use of chemical agents, improves the ecological environment, significantly inhibits various plant diseases such as sea buckthorn wilt, and improves control effectiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120699847B_ABST
    Figure CN120699847B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of microbial technology, specifically relating to a biocontrol bacterium Z9 for controlling sea buckthorn wilt and its application. The *Bacillus polymyxa* described in this invention can control sea buckthorn wilt, achieving an inhibition rate of over 60% against its pathogen, *Fusarium cladosporium*, and demonstrating a disease control effect exceeding 60%. Pot and field experiments have confirmed that *Bacillus polymyxa* Z9 can effectively inhibit the growth of the sea buckthorn wilt pathogen and enhance the biocontrol efficacy against the disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a biocontrol bacterium Z9 for preventing and controlling sea buckthorn wilt disease and its application. Background Technology

[0002] Sea buckthorn ( Sea buckthorn Sea buckthorn (L.) is a perennial deciduous shrub, known as the "King of Vitamin C," possessing abundant nutritional and economic value. It also plays a vital role in soil and water conservation, windbreak and sand fixation, and is significant for ecological environment management. In recent years, wilt disease has severely impacted sea buckthorn yields, causing substantial economic losses to agricultural production.

[0003] Sea buckthorn wilt is caused by Fusarium cladosporum (… Fusarium sporotrichioides This disease is caused by various factors. Fusarium wilt can occur throughout the entire growth and development period, mainly affecting branches and leaves, causing some branches to wither, leaves to turn yellow, and in the middle and late stages of the disease, the leaves at the bottom of the branches to wither and fall off, the vascular bundle tissue to discolor, and in severe cases, the entire plant to die.

[0004] Currently, chemical pesticides are commonly used to control Fusarium wilt. However, these pesticides negatively impact human health and damage the ecological environment, and long-term use can also increase the resistance of pathogens. With the vigorous development of green agriculture, biological control of Fusarium wilt has attracted much attention. Researchers have discovered that bacteria and fungi can effectively prevent plant wilt. Among them, Bacillus is the most commonly used and studied genus in biological control. It is characterized by its rapid reproduction rate and its inhibitory effect on various pathogenic fungi. However, the effective biological control methods for Fusarium wilt in sea buckthorn are still underdeveloped, and resources for effectively utilizing biological control to manage this disease remain limited. Summary of the Invention

[0005] To address the above problems, this invention provides a biocontrol bacterium Z9 for preventing and controlling sea buckthorn wilt disease and its application.

[0006] A biocontrol bacterium, namely *Bacillus polymyxa* Z9, was deposited on May 22, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34639, and classified as follows: Paenibacillus polymyxa .

[0007] A biocontrol agent is obtained by inoculating the biocontrol bacteria of claim 1 into a bacterial culture medium and then fermenting it.

[0008] The preparation method of the biocontrol agent involves inoculating the seed liquid of Bacillus polymyxa Z9 into LB liquid medium at an inoculation amount of 1% to 3% by volume, fermenting at 25℃ to 30℃ for 20 to 30 hours, and diluting the fermentation liquid by 100 times to obtain the biocontrol agent.

[0009] The application of the biocontrol bacteria or the biocontrol agent in the prevention and control of plant diseases.

[0010] Preferably, the plant disease is sea buckthorn wilt.

[0011] The application of the biocontrol bacteria or the biocontrol agent in inhibiting plant pathogens.

[0012] Preferably, the pathogen is at least one of the following: sea buckthorn wilt pathogen, tobacco black shank pathogen, corn leaf spot pathogen, pyrophyllosis fungus, and cucumber-specific pathogen of Fusarium oxysporum.

[0013] A method for controlling sea buckthorn wilt involves applying the biocontrol agent to the roots of the plant for root irrigation to control sea buckthorn wilt.

[0014] Preferably, the sea buckthorn wilt disease is caused by infection with Fusarium cladosporum.

[0015] Compared with the prior art, the advantages of the present invention are:

[0016] This invention develops a biocontrol strain, Bacillus polymyxa Z9, which is safe for humans and animals and has good application prospects, enriching biological control resources. By using biocontrol agents to control diseases, the amount of chemical agents used in production is reduced, while improving the ecological environment and reducing the amount of chemical agents residues in agricultural products. Attached Figure Description

[0017] Figure 1 Morphological identification of Bacillus polymyxa PQ8366281 in this invention.

[0018] Figure 2 This is the phylogenetic tree of Bacillus polymyxa PQ8366281 in this invention.

[0019] Figure 3 The invention describes the inhibitory effect of Bacillus polymyxa PQ8366281 bacterial suspension on the growth of Fusarium cladosporidis. In this paper, A is the blank control and B is Z9 (i.e., Bacillus polymyxa PQ8366281).

[0020] Figure 4 This invention describes the inhibitory effect of *Bacillus polymyxa* PQ8366281 on the growth of different fungi, where a, b, c, d, and e represent the inhibitory effects of *Bacillus polymyxa* PQ8366281 on the growth of *Hippophae rhamnoides* wilt pathogen (…). Fusarium proliferated Tobacco black shank pathogen ( Phytophthora parasitica var. Nicotiana ), corn leaf spot pathogen ( Bipolaris maydis ), Pythium spp. ( Pythium), Fusarium oxysporum cucumber-specific pathogen ( Fusarium oxysporum f. sp. cucumber Growth inhibition.

[0021] Figure 5 This invention describes the inhibitory effect of volatile products of *Bacillus polymyxa* PQ8366281 on the growth of different fungi, where a, b, c, d, and e represent the inhibitory effects of *Bacillus polymyxa* PQ8366281 on the growth of *Hippophae rhamnoides* wilt pathogen (…). Fusarium proliferatum Tobacco black shank pathogen ( Phytophthora parasitica var. Nicotiana ), corn leaf spot pathogen ( Bipolaris maydis ), Pythium spp. ( Pythium ), Fusarium oxysporum cucumber-specific pathogen ( Fusarium oxysporum f. sp. cucumber ).

[0022] Figure 6 The extracellular enzyme activity of *Bacillus polymyxa* PQ8366281(Z9) in this invention was determined as follows: A: protease; B: chitinase; C: cellulase; D: amylase; E: Tween 60. Detailed Implementation

[0023] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0024] The composition of LB solid medium is: 10g tryptone, 5g yeast extract, 10g sodium chloride (NaCl), pH adjusted to 7.0, and 1L water.

[0025] The composition of LB liquid medium is: 20g agar, 10g tryptone, 5g yeast extract, 10g sodium chloride (NaCl), pH adjusted to 7.0, and 1L water.

[0026] I. Isolation and Identification of Strains

[0027] The bacterium was isolated from healthy soil near the diseased plant. The specific method was as follows: 3g of soil was mixed with 50mL of sterile water under sterile conditions, placed in a shaker, and shaken for 30 minutes. The soil sample was then diluted to 10... -2 ~10 -4Four gradients were used to obtain soil suspensions. It should be noted that 1g-5g of soil can be mixed with 50mL of sterile water under aseptic conditions. 60μL of the soil suspension was evenly spread onto LB agar plates, with each gradient repeated three times. The plates were dried in a laminar flow hood and incubated upside down in a 25℃ incubator. Single colonies were picked up with a sterile toothpick and transferred to fresh LB agar plates. Fusarium cladosporidis was used as a target bacterium for preliminary screening using the plate confrontation method. One bacterium, PQ8366281, showed antagonistic activity against Fusarium cladosporidis and will be identified as a potential biocontrol bacterium. PQ8366281 is abbreviated as Z9.

[0028] Based on the morphological, physiological and biochemical characteristics and 16S sequence analysis of the genus *Bacillus*, it was ultimately identified as *Polymyxobacterium*. Paenibacillus polymyxa The results of the identification are as follows:

[0029] 1. Morphological characteristics of colonies

[0030] The strain grew on LB medium, and the colonies were white, moist, smooth, and viscous, indicating that it was a Gram-positive bacterium (see [link to LB medium]). Figure 1 ).

[0031] 2. Physiological and biochemical characteristics

[0032] The physiological and biochemical characteristics of Bacillus polymyxa PQ8366281 are shown in Table 1.

[0033] Table 1. Physiological and biochemical characteristics of Bacillus polymyxa PQ8366281

[0034]

[0035] Note: + indicates a positive reaction; - indicates a negative reaction.

[0036] 3. Colony molecular identification

[0037] Methods: DNA was extracted and PCR amplification was performed using universal primers 27F (5'AGAGTTTGATCCTGGCTCAG3', SEQ ID NO. 2) and 1492R (5'GGTTACCTTGTTACGACTT3', SEQ ID NO. 3). The PCR system (50 μL) consisted of: 10 pmol primers, 0.2 mM dNTPs, 1.5 mM MgCl2, 2.5 U Taq DNA polymerase (TaKaRa), 1× PCR buffer (TaKaRa), and 25 ng genomic DNA template. The PCR reaction conditions were: 94℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 58℃ annealing for 45 s, 72℃ extension for 90 s, and 30 cycles followed by a final extension at 72℃ for 10 min. The PCR products were separated and purified by 1% agarose gel electrophoresis and analyzed using an ABI 3730 DNA sequencer from Sangon Biotech Co., Ltd.

[0038]

[0039] Sequencing results were subjected to joint cluster analysis using MEGA 7.0 software (see [link to analysis]). Figure 2 The phylogenetic tree was constructed using the neighbor-joining method, with the bootstrap repeat count set to 1000. Based on morphological characteristics, this bacterium PQ8366281 was identified as *Bacillus polymyxa* (…). Paenibacillus polymyxa ), denoted as Polymyxin Bacillus Z9.

[0040] II. Antibacterial Activity Assay

[0041] 1. Selection of pathogens

[0042] The pathogens include Fusarium moniliformes (… Fusarium proliferatum Fusarium pseudobranchii ( Fusarium sporotrichoid Tobacco black shank pathogen ( Phytophthora parasitica var. Nicotiana ), corn leaf spot pathogen ( Bipolaris maydis ), Pythium spp. ( Pythium ), Fusarium oxysporum cucumber-specific pathogen ( Fusarium oxysporum f. sp. cucumber All were provided and preserved by Shenyang Agricultural University.

[0043] 2. Antibacterial test

[0044] A 5 mm diameter Fusarium tumefaciens mycelium disc was placed at the center of a blank PDA medium. Polymyxa Z9 was then applied to the disc 2 cm above and below it, forming a streak. The blank LB medium served as a control. The medium was incubated at 28°C for 5 days. The diameter of the Fusarium tumefaciens was then measured, and the inhibition rate was calculated. Each treatment was repeated three times, and the average value was taken.

[0045] Inhibition rate of pathogenic fungi = [(Diameter of growth of control pathogens - diameter of growth of treated pathogens) / diameter of growth of control pathogens] × 100%.

[0046] Result: As Figure 3 As shown, *Bacillus polymyxa* Z9 versus *Fusarium cladosporidis* (… F.sporotrichioides It has a significant inhibitory effect, with an antibacterial rate of 63.72%.

[0047] 3. Inhibitory effect of Bacillus polymyxa Z9 bacterial suspension on pathogens

[0048] A fungal mycelium with a diameter of 5 mm was inoculated in the center of a PDA plate. The treatment group was marked with Z9 fermentation stock solution 2 cm above / below the mycelium, and the control group was marked with blank LB.

[0049] Z9 fermentation broth preparation method: Single colonies of the isolated and screened Z9 original strain were picked from the plate using a toothpick and inoculated into a 50mL centrifuge tube containing 25mL of LB liquid medium for liquid fermentation to prepare the seed culture. The culture was then incubated at 28℃ and 200rpm for 24 hours using a constant temperature shaker to obtain the Z9 seed culture. Further purification and culture were performed by inoculating the obtained Z9 seed culture at a volume fraction of 2% into a 250mL Erlenmeyer flask containing 100mL of LB liquid medium and incubating at 28℃ and 200rpm for another 24 hours to obtain the Z9 fermentation broth. After dilution 100 times, the biocontrol agent was obtained. OD 600 It is approximately 0.3.

[0050] Result: As Figure 4 As shown, *Bacillus polymyxa* Z9 has a significant inhibitory effect on the growth of various pathogenic fungi, including *Fusarium solani* (…). F. proliferatum Tobacco black shank pathogen ( P. parasitica var. Nicotiana ), corn leaf spot pathogen ( B.maydis ), Pythium spp. ( Pythium ), Fusarium oxysporum cucumber-specific pathogen ( F.oxysporum f. sp cucumber The antibacterial rates of the samples reached 74.55%, 68.93%, 73.97%, 70.97%, and 71.29%, respectively, demonstrating significant antibacterial effects.

[0051] 4. The inhibitory effect of volatile substances from Bacillus polymyxa Z9 on pathogens.

[0052] The preparation method for Z9 fermentation broth is the same as above.

[0053] 100 μL of *Bacillus polymyxa* Z9 fermentation broth was spread onto LB agar plates. PDA plates inoculated with the fungus were sealed together with the LB plates containing the fermentation broth; this was the treatment group. Blank LB plates were sealed together; this was the control group. The plates were incubated at 28℃ for 5 days. The diameter of the pathogen in each treatment was measured, and the inhibition rate was calculated. Each treatment was repeated three times, and the average value was taken. The pathogen inhibition rate was calculated.

[0054] Result: As Figure 5 As shown, the volatile substances produced by *Bacillus polymyxa* Z9 have an effect on *Fusarium* (a type of bacteria). F.proliferatum Tobacco black shank pathogen ( P. parasitica var. Nicotiana ), corn leaf spot pathogen ( B.maydis ), Pythium spp. ( Pythium ), Fusarium oxysporum cucumber-specific pathogen ( F.oxysporum f. sp . cucumberThe inhibition rate of the fungus ranged from 39.63% to 49.23%, with the highest inhibition rate against *Pythium spp.* (a fungus). Pythium The inhibitory effect was best at 49.23%, against the pathogen of tobacco black shank (Bacillus thuringiensis). P. parasitica var. Nicotiana The inhibition effect was the worst, at only 39.63%.

[0055] III. Preparation of Biocontrol Agents

[0056] (1) Take the preserved Bacillus polymyxa Z9 and culture it on LB solid medium to activate the strain and obtain the activated strain;

[0057] (2) The activated bacterial strain was inoculated into LB liquid medium and cultured in a constant temperature shaker at 28°C and 200r / min for 24h to obtain seed culture.

[0058] (3) To further purify the culture, the obtained Z9 seed liquid was inoculated into a new LB liquid medium at an inoculation rate of 2%, and fermented in a constant temperature shaker at 28°C and 200 r / min for 24 h. The fermentation broth was diluted 100 times to obtain the biocontrol agent (OD600 about 0.3).

[0059] IV. Extracellular enzyme activity assay

[0060] Experiment: The Z9 fermentation broth was prepared in the same manner as above. 10 μL of *Bacillus polymyxa* Z9 fermentation broth was inoculated onto a sterile filter paper disc in the center of an agar plate used for detecting protease, chitinase, cellulase, amylase, and lipase. After incubation at 28°C for 3 days, the presence or absence of a clear zone around the colonies was observed.

[0061] Result: As Figure 6 As shown, the Polymyxin Bacillus Z9 exhibits a clear zone in the center of the test plates for protease, cellulase, amylase, and lipase, indicating that strain Z9 can produce protease, cellulase, amylase, and lipase, but cannot produce chitinase.

[0062] V. Evaluation of the Disease Control Efficacy of Biocontrol Agents

[0063] In a 2023 potted plant efficacy trial, sea buckthorn seedlings were soaked in a biocontrol agent for 3 days. The soaked seedlings were then planted in sterilized pots (2 kg) of nutrient soil, with 200 ml of biocontrol agent added to each pot. Two days later, damaged lateral roots were inserted around the base of the seedlings using a cutting tool. Each pot was then inoculated with 50 ml of *Fusarium cladosporium* spore suspension. Regular watering was maintained. A total of 12 seedlings were cultivated, with 2 seedlings per pot. After 12 weeks, the plants were used to evaluate the biocontrol potential of the biocontrol agent. In the control group, sea buckthorn seedlings were soaked in clean water for 3 days, and then potted with 200 ml of sterile water. Two days later, damaged lateral roots were inserted around the base of the seedlings. Each pot was then inoculated with 50 ml of *Fusarium cladosporium* spore suspension. Regular watering was maintained. A total of 12 seedlings were cultivated, with 2 seedlings per pot. After 12 weeks of treatment, the disease index of the control and biocontrol-treated groups was measured to assess the severity of wilt disease.

[0064] 2024 Small-Scale Efficacy Trial: Sea buckthorn seedlings were soaked in a biocontrol agent for 3 days. On May 15, 2024, the soaked seedlings were planted at a sea buckthorn cultivation base in Qingyang City, Gansu Province, where sea buckthorn wilt caused by Fusarium wilt had occurred for several consecutive years. Each plot was 20m × 20m, with three replicates. Approximately 500ml of biocontrol agent was applied to each seedling, twice during the growing season, with a 30-day interval. The plots were regularly irrigated using drip irrigation. On September 15, the disease index in the plots and the control group was investigated to calculate the control effect and evaluate the biocontrol potential of the biocontrol agent. The control group was also 20m × 20m, with three replicates. Sea buckthorn seedlings were soaked in clean water for 3 days, and approximately 500ml of water was applied to the roots of each seedling. Regular watering was also provided. The disease index was measured using a 5-point sampling method in each plot, with 25–35 seedlings in each plot having their disease index measured. The biocontrol effects of potted plants and community biological control were 66.1% and 67.8% for two consecutive years, respectively, both above 65%, and the effects were stable.

[0065] Table 2 Classification of Seabuckthorn Wilt Disease Severity

[0066]

[0067] Disease index (DI) = 100 × ∑ (number of diseased leaves at each level × representative value at each level) / (total number of leaves surveyed × highest representative value)

[0068] Table 3. Disease index and control effect of potted biocontrol fungi against sea buckthorn wilt in 2023

[0069]

[0070] Table 4. Disease index and control effect of biocontrol bacteria in 2024 for sea buckthorn wilt.

[0071]

[0072] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0073] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

[0074] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A biocontrol bacterium, characterized in that, The biocontrol bacterium is *Bacillus polymyxa* Z9, which was deposited on May 22, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34639, and classified as follows: Paenibacillus polymyxa .

2. A biocontrol agent comprising the biocontrol bacteria of claim 1, characterized in that, It is obtained by inoculating the biocontrol bacteria described in claim 1 into a bacterial culture medium and then fermenting it.

3. The method for preparing the biocontrol agent according to claim 2, characterized in that, The seed culture of Bacillus polymyxa Z9 was inoculated into the bacterial culture medium at a volume fraction of 1% to 3%, and fermented at 25℃ to 30℃ for 20 to 30 hours. The fermentation broth was then diluted 100 times to obtain the biocontrol agent.

4. The application of the biocontrol bacteria of claim 1 or the biocontrol agent of claim 2 in the control of plant diseases, characterized in that, The plant disease mentioned is sea buckthorn wilt.

5. The application of the biocontrol bacteria of claim 1 or the biocontrol agent of claim 2 in inhibiting plant pathogens, characterized in that, The pathogen is at least one of the following: sea buckthorn wilt pathogen, tobacco black shank pathogen, corn leaf spot pathogen, pyrophyllosis fungus, and cucumber-specific pathogen of Fusarium oxysporum.

6. A method for controlling sea buckthorn wilt disease, characterized in that, The biocontrol agent described in claim 2 is used for root irrigation of plants to prevent and control sea buckthorn wilt disease.

7. The method according to claim 6, characterized in that, The sea buckthorn wilt disease is caused by infection with Fusarium cladosporium.

Citation Information

Patent Citations

  • Active compounds combination containing fluopyram bacillus and biologically control agent

    CN104507314A

  • Paenibacillus polymyxa NSY50 with capabilities of promoting growth and preventing diseases

    CN105734000A