Advanced RNA targeting (ARNATAR)

Abstract

Disclosed herein are advanced RNA targeting (ARNATAR) oligomeric compounds, which are elaborately designed compounds, for the inhibition of gene expression by the RISC pathway. Such compounds are useful in methods for reducing the expression of certain genes, where many genes are associated with a variety of diseases and disorders.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This PCT application claims the benefit of priority to U.S. Provisional Application No. 63 / 433,706, filed December 19, 2022, and U.S. Provisional Application No. 63 / 472,780, filed June 13, 2023, the entire contents of each of which are incorporated herein by reference in their entirety.

[0003] Incorporation by Reference of Electronically Submitted Materials

[0004] Incorporated by reference in its entirety is the computer-readable nucleotide / amino acid sequence listing submitted concurrently and identified as follows: Text file named "SiRNA_sequence_listing", created on December 18, 2023.

[0005] This application quotes various publications throughout. All publications, gene transcript identifiers, patents and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication, gene transcript identifier, patent or patent application was specifically and individually indicated to be incorporated by reference. Technical Field

[0006] Certain embodiments relate to methods and compounds for regulating gene expression through advanced RNA targeting (ARNATAR).Such methods and compounds can be used to reduce the expression of certain genes, many of which are associated with various diseases and disorders. Background Art

[0007] More than 40 years ago, Stephenson and Zamecnik first proposed the use of therapeutic oligomeric compounds (Inhibition of Rous Sarcoma Viral RNA Translation by a Specific Oligodeoxyribonucleotide, PNAS, 1978, 75: 285-288). However, problems with delivery, stability, specificity, safety, and efficacy have hindered the therapeutic efficacy and use of oligomeric compounds as therapeutic agents. People have spent decades studying the mechanisms of oligomeric compounds' ability to inhibit gene expression, for example, by regulating transcription and translation to enhance the delivery, stability, specificity, safety, and efficacy of oligomeric compounds.

[0008] Fire et al. discovered sequence-specific gene silencing, or RNA interference (RNAi), in 1998 (Potent and Specific Genetic Interference by Double-Stranded RNA in Caenorhabditis elegans, Nature, 1998, 391: 806-811). RNAi inhibits gene expression through the RNA-induced silencing complex (RISC).

[0009] RISC comprises a complex of multiple proteins that interact with oligomeric compounds to inhibit gene expression. The oligomeric compound acts as a template for RISC, identifying complementary messenger RNA (mRNA) transcripts and targeting specific mRNA transcripts for cleavage. Target mRNA cleavage blocks the translation of the target mRNA and silences the target gene. Oligomeric compounds utilized by RISC include, but are not limited to, single-stranded oligomeric compounds (e.g., microRNA (miRNA)), certain oligonucleotides, and single-stranded siRNA (Lima et al., Single-stranded siRNAs activate RNAi in animals. Cell. 2012, 150(5):883-94), as well as double-stranded oligomeric compounds, such as short hairpin RNA (shRNA) and small interfering RNA (siRNA).

[0010] In 2001, Elbashir et al. showed that 21-nucleotide-long siRNA duplexes specifically inhibited the expression of endogenous and heterologous genes in mammalian cell lines and proposed the theory that siRNA could eventually be used as a gene-specific therapeutic agent (Duplexes of 21-Nucleotide RNAs Mediate RNA Interference in Cultured Mammalian Cells, Nature, 2001, 411: 494-498). Currently, five siRNA compounds have been approved for marketing by the U.S. Food and Drug Administration (FDA) (patisiran, givosiran, inclisiran, lumasiran, and vutrisiran), and several are in clinical trials (Moumné et al, Oligonucleotide Therapeutics: From Discovery and Development to Patentability, Pharmaceutics, 2022, 14(2): 260).

[0011] Onpattro TM ) became the first siRNA therapeutic drug approved by the FDA in 2018 (Hoy, Patisiran:First Global Approval, Drugs, 2018, 78:1625-1631). Patisiran is a partially modified siRNA targeting transthyretin (TTR) for the treatment of peripheral nerve disease (polyneuropathy) caused by hereditary transthyretin-mediated amyloidosis (hATTR), in which chemically modified nucleosides are dispersed along the 21-nucleotide-long sense and antisense strands that form the siRNA duplex. Later approved siRNAs (such as Givosiran) introduced additional modified nucleosides, modified internucleoside bonds, and N-acetylgalactosamine (GalNAc) conjugates to assist in cell delivery. (Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5:101). The latest siRNA approved by the FDA, Amvuttra TM ), which has the same target and indication as patisiran and is being developed by the same company (Alnylam Press Release in Businesswire, Alnylam Announces FDA Approval of Amvuttra TM (vutricilan), an RNAi therapeutic for the treatment of polyneuropathy associated with hereditary transthyretin-mediated amyloidosis in adults, June 2022). Vutricilan is a direct competitor to patisilan and is designed with a different sequence, chemical modification pattern, and delivery method to improve its therapeutic efficacy over patisilan.

[0012] From the discovery of RNAi in 1998, to the first regulatory approval of siRNA therapy in 2018, to the latest improvements in siRNA therapy, the field of therapeutic oligomeric compounds has made tremendous progress. However, the field continues to seek improvements to enhance the therapeutic efficacy and even surpass existing oligomeric compounds. The ideal oligomeric compound should: 1) be able to be delivered specifically to the target cell or organ; 2) once administered to the patient, be stable / durable (e.g., slow degradation and long half-life); 3) be specific for the target with no off-target effects; 4) be safe for the patient, not activate the immune system, and be non-toxic; and 5) be able to effectively and specifically cleave its target.

[0013] To generate better therapeutic drugs, we are still seeking improvements in the delivery, stability, specificity, safety and efficacy of oligomeric compounds.Disclosed herein are improved oligomeric compounds with advanced RNA targeting (ARNATAR) capabilities that enhance their gene silencing activity. Summary of the Invention

[0014] Several embodiments provided herein relate to discover some modification to oligomeric compounds, and these modifications can enhance their effectiveness in regulating gene expression.In several aspects, oligomeric compounds are single-stranded (e.g., single-stranded oligonucleotides, single-stranded RNA (ssRNA)) or double-stranded (e.g., shRNA and siRNA) and are modified. Single-stranded oligomeric compounds comprise sense strand or antisense strand. Double-stranded oligomeric compounds comprise sense strand and antisense strand. Antisense strand can be fully complementary or partially complementary to target nucleic acid.

[0015] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (I): 5'M-(Y)nZ-(Y)rDD 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides having the same modification or two adjacent unmodified nucleosides, n is 6-8, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides.

[0016] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IV): 5'LM-(D)v-(Y)s-(Z)t-(Y)uZN-(Z)r3'. D is a deoxyribonucleoside, N is a modified nucleoside or an unmodified nucleoside, M is a 2'-OMe modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, v is 0-1, s is 2-7, t is 0-2, u is 0-5, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides.

[0017] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (I) 5'M-(Y)nZ-(Y)rDD 3', and (b) an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IV): 5'LM-(D)v-(Y)s-(Z)t-(Y)uZN-(Z)r 3'. A duplex is formed by the sense strand and the antisense strand, wherein the length of the duplex region is 19 to 23 nucleotide pairs. D is a deoxyribonucleoside, N is a modified nucleoside or an unmodified nucleoside, M is a 2'-OMe modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, n is 6-8, r is 1-2, v is 0-1, s is 2-7, t is 0-2, u is 0-5, and a single modification type does not modify more than two consecutive nucleotides.

[0018] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (II): 5'YZ-(Y)q-FFNM-(Y)qM-(Y)vD-D3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides having the same modification or two adjacent unmodified nucleosides, q is 2-3, v is 0-1, and a single modification type does not modify more than two consecutive nucleotides.

[0019] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (V): 5'L-(Y)p-NM-(FMM)r-(Y)p-(Z)r3'. M is a 2'-OMe modified nucleoside, F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, p is 3-5, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides.

[0020] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (II): 5'YZ-(Y)q-FFNM-(Y)qM-(Y)vDD 3', and (b) an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (V): 5'L-(Y)p-NM-(FMM)r-(Y)p-(Z)r 3'. A duplex is formed by the sense strand and the antisense strand, wherein the length of the duplex region is 19 to 23 nucleotide pairs. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, q is 2-3, p is 3-5, r is 1-2, v is 0-1, and a single modification type does not modify more than two consecutive nucleotides. In certain embodiments, 5'(Y)p is YYY, and 3'(Y)p is YYYY.

[0021] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (III): 5'M*F*MMN*MN*MFFNMN*MN*MMFM*D*D 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, * is a phosphorothioate (PS) bond, and a single modification type does not modify more than two consecutive nucleotides.

[0022] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VI): 5'LM*N*MNMFNMFMMNMFMFMMN*M*M 3'. M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, * is a phosphorothioate (PS) bond, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides.

[0023] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (III): 5'M*F*MMN*MN*MFFNMN*MN*MMFM*D*D3', and (b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VI): 5'LM*N*MNMFNMFMMNMFMFMMN*M*M3'. A duplex is formed by the sense strand and the antisense strand, wherein the duplex region is 19 nucleotide pairs in length and each strand has a 2 nucleotide overhang at the 3' end. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, * is a phosphorothioate (PS) bond, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides.

[0024] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VII): 5'LM*D*MFMFNMFMMFMFMFMMN*M*M 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, * is a phosphorothioate (PS) bond, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides.

[0025] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (I): 5'M-(Y)nZ-(Y)rDD 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides having the same modification or two adjacent unmodified nucleosides, n is 6-8, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides.

[0026] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IX): 5'LM-(Y)pZ-(Y)p-(Z)r 3'. M is a 2'-OMe modified nucleoside, L is 5' phosphate, 5' vinylphosphonate or 5'OH, Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, p is 3-5, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides.

[0027] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (I) 5'M-(Y)nZ-(Y)rDD 3', and (b) an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IX): 5'LM-(Y)pZ-(Y)p-(Z)r 3'. A duplex is formed by the sense strand and the antisense strand, wherein the length of the duplex region is 19 to 23 nucleotide pairs. D is a deoxyribonucleoside, N is a modified nucleoside or an unmodified nucleoside, M is a 2'-OMe modified nucleoside, L is 5' phosphate, 5' vinylphosphonate or 5' OH, Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, n is 6-8, p is 3-5, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides.

[0028] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (X): 5'MFMMNMNMFFNMNMNMMNMDD 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, and a single modification type does not modify more than two consecutive nucleotides.

[0029] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VIII): 5'L-MNMNMFNMFMMNMFMFMMNMM 3'. M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides.

[0030] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (X): 5'MFMMNMNMFFNMNMNMMNMDD 3', and (b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VIII): 5'L-MNMNMFNMFMMNMFMFMMNMM 3'. A duplex is formed by the sense strand and the antisense strand, wherein the duplex region is 19 nucleotide pairs in length and each strand has a 2 nucleotide overhang at the 3' end. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides.

[0031] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (XI): 5'MFMMNMNMFFMMNMNMMFMDD3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, and a single modification type does not modify more than two consecutive nucleotides.

[0032] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (XII): 5'L-MDMFMFNMFMMFMFMFMMNMM 3'. M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides.

[0033] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (XI): 5'MFMMNMNMFFMMNMNMMFMDD 3', and (b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (XII): 5'L-MDMFMFNMFMMFMFMFMMNMM 3'. A duplex is formed by the sense strand and the antisense strand, wherein the duplex region is 19 nucleotide pairs in length and each strand has a 2 nucleotide overhang at the 3' end. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1: Table showing LMNA antisense strand sequences with various modifications.

[0035] Figure 2: Table showing LMNA sense strand sequences with various modifications.

[0036] Figure 3: Table showing the sequences of the antisense strand of ApoC3 with various modifications.

[0037] Figure 4: Table showing the sense chain sequences of ApoC3 with various modifications.

[0038] Figure 5: Table showing NCL antisense and sense strand sequences with various modifications.

[0039] Figure 6: Shows an assay in which siRNAs were incubated with human serum to determine their stability in serum. LMNA-si2, LMNA-si29, and LMNA-si33 were incubated in human serum for varying lengths of time and then run on a gel to visualize the amount of siRNA duplexes present after exposure to serum.

[0040] Figure 7: shows a tritosome stability assay in which the stability of siRNAs was assessed. LMNA-si2, LMNA-si31, LMNA-si47, LMNA-si49, and LMNA-si51 were tested for varying lengths of time and then run on a gel to visualize the amount of siRNA duplexes present after exposure to the triosome.

[0041] Figure 8: Shows an assay in which siRNAs were incubated with human serum to determine their stability in serum. LMNA-si2, LMNA-si31, LMNA-si47, LMNA-si49, and LMNA-si51 were incubated in human serum for varying lengths of time and then run on a gel to visualize the amount of siRNA duplexes present after exposure to serum.

[0042] Figure 9: Shows selected ARNATAR designed siRNAs evaluated for onset of siRNA activity. ARNATAR designed siRNA compounds demonstrated faster onset of siRNA activity compared to the benchmark.

[0043] FIG10 : shows the melting temperature (Tm) of selected ARNATAR designed siRNAs.

[0044] Figure 11: Shows selected ARNATAR designed siRNAs evaluated for RISC loading. ARNATAR designed siRNAs showed faster association with Ago2.

[0045] Figure 12: Shows RNA knockdown data from in vivo studies in mice using selected ARNATAR designed siRNAs.

[0046] Figure 13: Shows safety data from an in vivo study in mice using selected ARNATAR designed siRNAs. Serum proteins ALB, ALT, and BUN were assessed.

[0047] Figure 14: Shows safety data from an in vivo study in mice using selected ARNATAR designed siRNAs. Liver and spleen weights were measured.

[0048] Figure 15: Shows safety data from an in vivo study in mice using selected ARNATAR designed siRNAs. Serum analytes were assessed.

[0049] Figure 16: In vivo mouse data showing the effects of siRNAs designed using selected ARNATARs on the immunogenicity markers NFkB, IL-6, and TNF.

[0050] Figure 17: Shows RNA knockdown at day 7 of an in vivo study in mice using selected ARNATAR designed siRNAs.

[0051] Figure 18: Shows day 7 data from an in vivo study in mice on the effects of selected ARNATAR designed siRNAs on the immunogenicity markers NFkB, IL-6 and TNF.

[0052] Figure 19: Shows that siRNAs using ARNATAR platform chemistry are stable in serum and trisomy assays.

[0053] FIG20 shows the in vitro inhibition of LMNA in HeLa cells by siRNAs designed from selected ARNATARs.

[0054] Figure 21: shows data from an in vitro study in HeLa cells on the effects of selected ARNATAR designed siRNAs on the immunogenicity marker NFkB.

[0055] FIG22 shows the in vitro inhibition of LMNA in HEK293 cells by siRNAs designed from selected ARNATARs.

[0056] Figure 23: Shows mRNA knockdown data using siRNAs designed from selected ARNATARs in an in vivo study in Balb / c mice.

[0057] Figure 24: Table showing the sequences of the antisense and sense strands of HAO1 with various modifications.

[0058] Figure 25: Graph showing in vitro inhibition of HAO1 RNA in Hep3B cells by modified oligomeric compounds at 24 hours.

[0059] Figure 26: Graph showing in vitro inhibition of LMNA RNA in HeLa cells by modified oligomeric compounds at 72 hours and 96 hours.

[0060] Figure 27: shows in vivo inhibition data of LMNA RNA in mouse liver after 3 days, 1 week or 2 weeks of treatment with modified oligomeric compounds.

[0061] Figure 28: Graph showing in vitro inhibition of LMNA RNA in HeLa cells by modified oligomeric compounds at 20 hours.

[0062] Figure 29: Graph showing in vitro inhibition of LMNA RNA in HeLa cells by modified oligomeric compounds at 16 hours, 24 hours and 48 hours.

[0063] Figure 30: Graph showing in vitro inhibition of LMNA RNA in Hepa1-6 cells by modified oligomeric compounds at 16 hours and 48 hours.

[0064] Figure 31: Graph showing in vitro inhibition of LMNA RNA in HeLa cells by modified oligomeric compounds at 20 hours.

[0065] Figure 32: shows in vivo data of LMNA siRNA activity in mouse liver 10 and 25 days after treatment with modified oligomeric compounds.

[0066] Figure 33: Graph showing in vitro inhibition of ARNATAR motif siRNA compared to third party motifs applied to siRNA targeting LMNA, NCL and ApoC3.

[0067] Figure 34: Graph showing in vitro inhibition of LMNA RNA in HeLa cells by modified oligomeric compounds at 16 hours and 36 hours.

[0068] Figure 35: Graph showing in vitro inhibition of NCL RNA in HeLa cells by modified oligomeric compounds at 36 hours.

[0069] Figure 36: Table showing the sequences of the AGT antisense strand with various modifications.

[0070] Figure 37: Table showing AGT sense strand sequences with various modifications.

[0071] Figure 38: Graph showing in vitro inhibition of AGT RNA in Hep3B cells by transfection at 36 hours or in human primary hepatocytes (HPH) by free uptake at 48 hours by modified oligomeric compounds. The x-axis is siRNA concentration in nM for Hep3B cells and μM for HPH cells. The y-axis is the percentage of AGT mRNA after treatment with different siRNA concentrations.

[0072] Figure 39: Graph showing in vitro inhibition of AGT RNA in Hep3B cells by transfection at 20 hours. The x-axis is siRNA concentration in nM.

[0073] Figure 40: Graph showing in vitro inhibition of AGT in human primary hepatocytes (HPH) by free uptake of modified oligomeric compounds at 42 hours. The x-axis is siRNA concentration in μM. The y-axis is the percentage of AGT mRNA after treatment with different concentrations of siRNA. DETAILED DESCRIPTION

[0074] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and do not limit the invention as claimed. In this document, unless otherwise expressly stated, the use of the singular includes the plural. As used herein, the use of "or" means "and / or" unless otherwise stated. In addition, the use of the term "including" and other forms (such as "includes" and "included") is not limiting. In addition, unless otherwise expressly stated, terms such as "element" or "component" cover elements and components comprising one unit and elements and components comprising more than one subunit.

[0075] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, and monographs, are hereby expressly incorporated by reference into the document sections discussed herein, and are incorporated in their entirety.

[0076] definition

[0077] Unless specific definition is provided, the term and procedure and technology relevant to analytical chemistry as herein described, synthetic organic chemistry and medicine and medicinal chemistry are all well known in the art and commonly used.Standard techniques can be used for chemical synthesis and chemical analysis.Where permitted, all patents, applications, disclosed applications and other publications, GENBANK accession numbers and other data cited in the relevant sequence information that can be obtained by database (such as U.S. National Center for Biotechnology Information (NCBI)) and the disclosure of this paper in full are incorporated into the file section discussed herein by reference, and are incorporated into in full with it.

[0078] Unless otherwise stated, the following terms have the following meanings:

[0079] "2'-O-methoxyethyl" (also 2'-MOE and 2'-O(CH2)2-OCH3) refers to a furanose ring whose 2' position is modified with an O-methoxy-ethyl group. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0080] "2'-MOE nucleosides" (also 2'-O-methoxyethyl nucleosides) means nucleosides comprising a 2'-MOE modified sugar moiety. "2'-MOE nucleotides" (also 2'-O-methoxyethyl nucleotides) means nucleotides comprising a 2'-MOE modified sugar moiety.

[0081] "2'-O-methyl" (also 2'-OCH3 and 2'-OMe) refers to a furanose sugar whose 2' position is modified with an O-methyl group. A 2'-O-methyl modified sugar is a modified sugar.

[0082] "2'-OMe nucleosides" (also 2'-O-methyl nucleosides) means nucleosides comprising a 2'-OMe modified sugar moiety. "2'-OMe nucleotides" (also 2'-O-methyl nucleotides) means nucleotides comprising a 2'-OMe modified sugar moiety.

[0083] "2'-substituted nucleosides" means nucleosides that contain a substituent other than H or OH at the 2' position of the furanose ring. In certain embodiments, 2'-substituted nucleosides include nucleosides with fluorine (2'-F), O-methyl (2'-OMe), O-methoxyethyl (2'-MOE) or bicyclic sugar modifications.

[0084] "5-methylcytosine" means cytosine modified with a methyl group attached to position 5. 5-Methylcytosine is a modified nucleobase.

[0085] "About" means within ±7% of a value. For example, if it is stated that "the compound affects at least about 70% inhibition of mRNA," it implies that mRNA levels are inhibited in the range of 63% to 77%.

[0086] "Animal" refers to human and non-human animals, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including but not limited to monkeys and chimpanzees.

[0087] "Antibody" refers to a molecule characterized by reacting specifically with an antigen in some manner, wherein the antibody and antigen are defined relative to each other. Antibody can refer to a complete antibody molecule or any fragment or region thereof, such as a heavy chain, light chain, F chain, or ab Area and F c district.

[0088] "Antisense oligonucleotide" or "ASO" means a single-stranded oligonucleotide having a nucleobase sequence that allows hybridization to a corresponding region or segment of a target nucleic acid. In certain embodiments, the antisense oligonucleotide comprises one or more ribonucleosides (RNA nucleosides) and / or deoxyribonucleosides (DNA nucleosides).

[0089] "Base complementarity" refers to the ability of a nucleobase of an oligonucleotide to base pair (i.e., hybridize) with a corresponding nucleobase in a target nucleic acid, and is mediated by Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between the corresponding nucleobases. Base complementarity also refers to canonical base pairing (e.g., A:U, A:T, or C:G) or atypical base pairing (e.g., A:G, A:U, G:U, I:U, I:A, or I:C).

[0090] "Bicyclic sugar" means a furanose ring modified by bridging two non-geminal carbon atoms. Bicyclic sugars are modified sugars.

[0091] "Cap structure" or "terminal cap moiety" means a chemical modification incorporated at either terminus of an oligomeric compound.

[0092] "Chemical modification" means modifying the molecular structure or elements of a natural molecule. For example, an siRNA compound is composed of linked ribonucleosides (sometimes referred to herein as RNA), and therefore, replacing ribonucleosides with deoxyribonucleosides (sometimes referred to herein as DNA nucleosides) is considered a chemical modification of the siRNA compound.

[0093] A "chemically distinct region" refers to a region of an oligomeric compound that is chemically distinct from another region of the same oligomeric compound. For example, a region having 2'-OMe nucleotides is chemically distinct from a region having no 2'-OMe modified nucleotides.

[0094] "Chimeric oligomeric compound" means an oligomeric compound having at least two chemically distinct regions, each position having multiple subunits. For example, as disclosed herein, an siRNA can comprise a peripheral region and a central region. The peripheral region comprises motifs having various modified or unmodified nucleobases to confer increased stability, specificity, safety, and efficacy, while the central region comprises various modified or unmodified nucleobases to serve as a substrate for RISC-mediated degradation.

[0095] "Complementarity" refers to the capacity for pairing between the nucleobases of a first nucleic acid and a second nucleic acid.

[0096] “Adherence” refers to an individual’s adherence to recommended therapy.

[0097] “Comprise,” “comprises,” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

[0098] "Consecutive nucleobases" means nucleobases that are immediately adjacent to each other.

[0099] "Deoxyribonucleoside" means a nucleoside with a hydrogen at the 2' position of the sugar portion of the nucleoside. Deoxyribonucleosides are sometimes referred to herein as DNA nucleosides, "D" or "d". Deoxyribonucleosides can be modified with any of a variety of substituents and can be linked by covalent bonds other than naturally occurring phosphodiesters (e.g., phosphorothioates).

[0100] "Deoxyribonucleotide" means a nucleotide with a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides are sometimes referred to herein as DNA nucleotides, "D" or "d". Deoxyribonucleotides can be modified with any of a variety of substituents and can be linked by covalent bonds other than naturally occurring phosphodiesters (e.g., phosphorothioates).

[0101] "Designing" or "design" refers to the process of designing an oligomeric compound that specifically hybridizes to a target nucleic acid molecule.

[0102] "Efficacy" means the ability to produce a desired effect.

[0103] "Expression" includes all functions that convert the coded information of a gene into structures that exist and function in the cell. Such structures include, but are not limited to, the products of transcription and translation.

[0104] "Fully complementary" or "100% complementary" means that for every nucleobase of a first nucleic acid there is a complementary nucleobase in a second nucleic acid. In certain embodiments, the first nucleic acid is an oligomeric compound and the target nucleic acid is a second nucleic acid.

[0105] "Fully modified motif" refers to an oligomeric compound comprising a sequence of contiguous nucleosides wherein substantially every nucleoside has a chemical modification.

[0106] "Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include but are not limited to oligomeric compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include but are not limited to siRNA and nucleic acid targets.

[0107] "Immediately adjacent" means that there are no intervening elements between the immediately adjacent elements.

[0108] "Subject" means a human or non-human animal selected for treatment or therapy.

[0109] "Induce", "inhibit", "enhance", "promote", "increase", "decrease", etc. usually indicate the quantitative difference between two states.

[0110] "Inhibit expression or activity" means to reduce or block expression or activity, and does not necessarily mean to completely eliminate expression or activity.

[0111] "Internucleoside bond" refers to a chemical bond between nucleosides, whereby the 3' position of a nucleoside is linked to the 5' position of the following nucleoside via an internucleoside bond.

[0112] "Linked nucleosides" means adjacent nucleosides (e.g., A, G, C, T, or U) linked together by an internucleoside bond. Examples of linked nucleosides include deoxyribonucleosides (sometimes referred to herein as DNA nucleosides) or ribonucleosides (sometimes referred to herein as RNA nucleosides).

[0113] "Mismatch" or "non-complementary nucleobase" refers to a situation where a nucleobase of a first nucleic acid cannot pair with the corresponding nucleobase of a second or target nucleic acid by Watson-Crick base pairing (e.g., A:T, A:U, or C:G).

[0114] "Modified internucleoside linkage" refers to a substitution or any alteration of a naturally occurring internucleoside linkage (ie, a phosphodiester internucleoside linkage).

[0115] "Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. "Unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0116] "Modified nucleosides" means nucleosides independently having modified sugar moieties and / or modified nucleobases. As used herein, where the oligomeric compound is based on RNA, substitution of ribonucleosides with deoxyribonucleosides (sometimes referred to herein as DNA nucleosides) is considered a modification of the oligomeric compound. Additionally, where the oligomeric compound is based on DNA, substitution of deoxyribonucleosides with ribonucleosides (sometimes referred to herein as RNA nucleosides) is considered a modification of the oligomeric compound.

[0117] "Modified nucleotides" means nucleotides independently having modified sugar moieties, modified internucleoside linkages, substitutions of deoxyribonucleosides (sometimes referred to herein as DNA nucleosides) for ribonucleosides (sometimes referred to herein as RNA nucleosides), and / or modified nucleobases.

[0118] "Modified oligonucleotide" means an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, substitution of deoxyribonucleosides (sometimes referred to herein as DNA nucleosides) for ribonucleosides (sometimes referred to herein as RNA nucleosides), and / or modified nucleobase.

[0119] "Modified sugar" means the substitution and / or any alteration of a natural sugar moiety.

[0120] "Moiety" means one of the parts into which something is divided, i.e., a portion or component of something. For example, the sugar moiety of a nucleotide is the sugar component of the nucleotide.

[0121] "Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0122] "Motif" refers to the pattern of modifications in an oligomeric compound. For example, as disclosed herein, ARNATAR has designed oligomeric compounds containing motifs with various modified nucleobases and internucleoside linkages to improve the delivery, stability, specificity, safety, and efficacy of the compounds. The motif is independent of the nucleobases contained and only recognizes the modification pattern.

[0123] "Natural sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

[0124] By "naturally occurring internucleoside linkage" is meant a 3' to 5' phosphodiester linkage.

[0125] "Non-complementary nucleobases" refers to a pair of nucleobases that do not hydrogen bond with each other or support hybridization.

[0126] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), messenger RNA (mRNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), and microRNA (miRNA).

[0127] "Nucleobase" means a heterocyclic moiety capable of base pairing with another nucleic acid.

[0128] "Nucleobase complementarity" refers to the ability of one nucleobase to pair with another nucleobase (also referred to as complementarity). If a base at a certain position in an oligomeric compound is able to form a hydrogen bond with a base at a certain position in a target nucleic acid, then the hydrogen bonding positions between the oligomeric compound and the target nucleic acid are considered to be complementary at that base pair. For example, in DNA, adenine (A) is complementary to thymine (T); in RNA, adenine (A) is complementary to uracil (U); and, in DNA and RNA, guanine (G) is complementary to cytosine (C). Base pairs or complementary nucleobases are typically typical Watson-Crick base pairs (C:G, A:U, A:T), but also include atypical base pairs, such as Hoogsteen base pairs (e.g., A:G or A:U), wobble base pairs (e.g., G:U, I:U, I:A or I:C, where I is hypoxanthine), etc. Nucleobase complementarity facilitates hybridization of the oligomeric compounds described herein to their target nucleic acids.

[0129] "Nucleobase sequence" means the order of consecutive nucleobases independent of any sugar, linkage and / or nucleobase modification.

[0130] "Nucleoside" means a nucleobase linked to a sugar.

[0131] " Nucleoside mimics " include those structures that are used to replace the sugar or sugar and base (and not necessarily replace the bond) on one or more positions of the oligomeric compound, such as the nucleoside mimics with morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclic or tricyclic sugar mimics (e.g., non-furanose units). Nucleotide mimics include the structure of nucleosides and bonds on one or more positions of the oligomeric compound (e.g., peptide nucleic acids or morpholinos (morpholinos connected by-N(H)-C(=O)-O- or other non-phosphodiester bonds)). Sugar substitutes overlap with slightly broader term nucleoside mimics, but are intended to represent the replacement of sugar units (furanose rings). The tetrahydropyran ring provided herein is an example of a sugar substitute, in which the furanose group has been replaced by a tetrahydropyran ring system. " Mimics " refers to a group that replaces a sugar, a core base and / or a bond between nucleosides. Typically, mimics are used to replace sugar or a sugar-nucleoside bond combination, and to keep the core base hybridized to a selected target.

[0132] "Nucleotide" means a nucleoside with a linking group (e.g., a phosphate (P) or phosphorothioate (PS) group) covalently linked to the sugar portion of the nucleoside. Nucleotides include ribonucleotides and deoxyribonucleotides. Ribonucleotides are the linked nucleotide units that form RNA. Deoxyribonucleotides are the linked nucleotide units that form DNA.

[0133] "Off-target effects" refer to undesirable or deleterious biological effects associated with regulating RNA or protein expression of genes other than the intended target nucleic acid.

[0134] "Oligomeric activity" refers to any detectable or measurable activity produced by the hybridization of an oligomeric compound to its target nucleic acid. In certain embodiments, the oligomeric activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by the target nucleic acid. The oligomeric activity can be modulated by an oligomeric compound (e.g., siRNA).

[0135] "Oligomeric compound" means a sequence of linked monomeric subunits capable of hybridizing to at least one region of a target nucleic acid via hydrogen bonding. The monomeric subunits may be modified nucleosides or unmodified nucleotides or nucleosides. The oligomeric compound serves as a template for RISC, recognizing complementary messenger RNA (mRNA) transcripts to target specific mRNA transcripts for cleavage. Cleavage of the target mRNA blocks the translation of the target mRNA and silences the target gene. Examples of oligomeric compounds include single-stranded and double-stranded compounds, for example, antisense oligonucleotides, ssRNA, siRNA, shRNA, and miRNA.

[0136] "Oligomerization inhibition" means that the level of a target nucleic acid is reduced in the presence of an oligomeric compound that is complementary to the target nucleic acid, compared to the level of the target nucleic acid in the absence of the oligomeric compound.

[0137] "Oligomerization mechanism" includes RISC or RNase H related mechanisms involving hybridization of an oligomeric compound to a target nucleic acid, wherein the outcome or effect of hybridization is target degradation and inhibition of gene expression.

[0138] As used herein, " oligonucleotide " means the polymer connecting nucleosides, each of which can be modified or unmodified, independent of one another. Oligonucleotide can have a linking group (e.g., phosphorothioate (phosphorothioate)=phosphorothioate (thiophosphate) group) in addition to a phosphate group as a linking portion between nucleosides. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA nucleosides) and / or deoxyribonucleosides (DNA nucleosides).

[0139] "Phosphorothioate linkage" or "PS" means a linkage between nucleosides in which the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate (=thiophosphate or also known as thiophosphate) linkage is a modified internucleoside linkage.

[0140] "Portion" means a defined number of consecutive (i.e., linked) nucleobases in a nucleic acid. In certain embodiments, a portion is a defined number of consecutive nucleobases in a target nucleic acid. In certain embodiments, a portion is a defined number of consecutive nucleobases in an oligomeric compound.

[0141] A "region" is defined as a portion of a target nucleic acid having at least one identifiable structure, function, or characteristic.

[0142] "RNA" or "ribonucleic acid" is composed of ribonucleotides or ribonucleotides (nitrogenous bases attached to the sugar ribose) linked by phosphodiester bonds, forming chains of varying lengths. The nitrogenous bases in RNA are adenine, guanine, cytosine, and uracil. The ribose sugar of RNA is a ring structure of five carbons and one oxygen.

[0143] "Ribonucleoside" means a nucleoside with a hydroxyl group at the 2' position of the sugar portion of the nucleoside. Ribonucleosides can be modified with any of a variety of substituents and can be linked by covalent bonds other than naturally occurring phosphodiesters (e.g., phosphorothioates). Herein, ribonucleosides are sometimes referred to as RNA nucleosides, "R" or "r."

[0144] "Ribonucleotide" means a nucleotide having a hydroxyl group at the 2' position of the sugar portion of the nucleotide. Ribonucleotides can be modified with any of a variety of substituents and can be linked by covalent bonds other than naturally occurring phosphodiesters (e.g., phosphorothioates). Ribonucleotides are sometimes referred to herein as RNA nucleotides, "R" or "r."

[0145] A "segment" is defined as a smaller region or sub-portion of a region within a target nucleic acid.

[0146] As used herein, a "site" is defined as a unique nucleobase position within a target nucleic acid.

[0147] "Specific hybridization" refers to a sufficient degree of complementarity between an oligomeric compound (e.g., siRNA) and a target nucleic acid to induce the desired effect, while exhibiting minimal or no effect on non-target nucleic acids under conditions where specific binding is desired (i.e., physiological conditions in the context of in vivo assays and therapeutic treatment).

[0148] "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a very small number of other sequences.

[0149] "Subject" means a human or non-human animal selected for treatment or therapy.

[0150] "Target" refers to a protein or nucleic acid sequence (eg, mRNA) whose regulation is desired.

[0151] "Target gene" refers to a gene encoding a target.

[0152] "Targeting" refers to the process of designing and selecting oligomeric compounds that specifically hybridize to a target nucleic acid and induce a desired effect.

[0153] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all mean a nucleic acid capable of being targeted by an oligomeric compound.

[0154] "Target region" means a portion of a target nucleic acid to which one or more oligomeric compounds are targeted.

[0155] "Target segment" means the nucleotide sequence of the target nucleic acid to which the oligomeric compound is targeted. "5' target site" refers to the 5'-most nucleotide of the target segment. "3' target site" refers to the 3'-most nucleotide of the target segment. In embodiments, the target segment is a portion of at least 12 nucleobases (i.e., at least 12 contiguous nucleobases) within the target region to which the oligomeric compound is targeted.

[0156] "Therapeutic efficacy" refers to the effectiveness of a therapeutic compound (eg, an oligomeric compound). Therapeutic efficacy can be enhanced by improving the delivery, stability, specificity, safety, and efficacy of the therapeutic compound.

[0157] By "unmodified" RNA nucleobase is meant the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). By "unmodified" DNA nucleobase is meant the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T) and cytosine (C). In certain embodiments, when a DNA nucleobase replaces an RNA nucleobase, the unmodified RNA nucleobase is considered to be modified. In certain embodiments, when an RNA nucleobase replaces a DNA nucleobase, the unmodified DNA nucleobase is considered to be modified.

[0158] "Unmodified nucleoside" means a nucleoside composed of common and naturally occurring nucleobases and sugar moieties. For example, if an unmodified nucleoside is used in an RNA sequence, it is an RNA nucleoside, however, in such an RNA sequence, any other nucleoside (e.g., a DNA nucleoside, 2'-OMe, or 2'-F) is considered a modified nucleoside.

[0159] "Unmodified nucleotide" means a nucleotide composed of common and naturally occurring nucleobases, sugar moieties, and internucleotide linkages. For example, if an unmodified nucleotide is used in an RNA sequence, it is an RNA nucleotide; however, in such an RNA sequence, any other nucleotide (e.g., a DNA nucleotide, 2'-OMe, or 2'-F) is considered a modified nucleotide.

[0160] Disclosed herein are improved oligomeric compounds with advanced RNA targeting (ARNATAR) designs that enhance their gene silencing activity. Several embodiments provided herein relate to the discovery of certain modification motifs of oligomeric compounds that can enhance their effectiveness in regulating gene expression by improving the delivery, stability, specificity, safety, and efficacy of the oligomeric compounds.

[0161] In several aspects, the oligomeric compound is single-stranded (e.g., a single-stranded oligonucleotide, microRNA (miRNA) or single-stranded RNA (ssRNA)) or double-stranded (e.g., shRNA or siRNA) and is modified. A single-stranded oligomeric compound comprises a sense strand or an antisense strand. A double-stranded oligomeric compound comprises a sense strand and an antisense strand. The antisense strand can be fully complementary or partially complementary to the target nucleic acid.

[0162] The following embodiments describe oligomeric compounds comprising linked nucleotides comprising modified nucleosides and optionally unmodified nucleosides, wherein adjacent nucleosides are linked by naturally occurring phosphodiester bonds or by non-naturally occurring bonds, such as phosphorothioate diester bonds (also referred to as "phosphorothioate internucleotide (PS) bonds"). In some embodiments, where the oligomeric compound is based on RNA (e.g., miRNA, ssRNA, shRNA, and / or siRNA), the sequence is considered to be RNA, and the unmodified nucleosides are ribonucleosides. Modified nucleosides may comprise modified bases and / or modified sugars (e.g., sugars preferably modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0163] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 19 to 23 connected nucleotides, wherein the sense strand sequence is represented by formula (I): 5'M-(Y)nZ-(Y)rDD 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, n is 6-8, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides. Preferably, -DD is a TT or TA overhang. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In a further embodiment, the sense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side, or both sides. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In embodiments, the oligomeric compound comprising formula (I) is ssRNA or siRNA. The modified nucleoside can include a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0164] In one embodiment, the oligomeric compound capable of inhibiting expression of a target nucleic acid comprises an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IV): 5'LM-(D)v-(Y)s-(Z)t-(Y)uZN-(Z)r3'. D is a deoxyribonucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA, or LNA), M is a 2'-OMe modified nucleoside, L is 5' phosphate, 5' vinylphosphonate, or 5'OH, Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides having the same modification or two adjacent unmodified nucleosides, v is 0-1, s is 2-7, t is 0-2, u is 0-5, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides. Preferably, 3'Z is a UU or TT overhang. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In further embodiments, the antisense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side, or both sides. The PS bond modification can be located between positions 1-2, 2-3, 19-20, and / or 20-21, calculated from the 5' end of the antisense strand. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In embodiments, the oligomeric compound comprising formula (IV) is ssRNA or siRNA. The modified nucleosides can include modified bases and / or modified sugars (preferably sugars modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered modified nucleosides.

[0165] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (I) 5'M-(Y)nZ-(Y)rDD 3', and (b) an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IV): 5'LM-(D)v-(Y)s-(Z)t-(Y)uZN-(Z)r 3'. A duplex is formed by the sense strand and the antisense strand, wherein the length of the duplex region is 19 to 23 nucleotide pairs. D is a deoxyribonucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), M is a 2'-OMe modified nucleoside, L is 5' phosphate, 5' vinylphosphonate or 5'OH, Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, n is 6-8, r is 1-2, v is 0-1, s is 2-7, t is 0-2, u is 0-5, and a single modification type does not modify more than two consecutive nucleotides. In a further embodiment, the 3'Z in the antisense strand is a UU or TT overhang, and the -DD in the sense strand is a TT or TA overhang. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between the two nucleosides. In a further embodiment, the chain comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) at the 5' side, the 3' side, or both sides. The PS bond modification on the antisense strand can be located between the 1st-2nd, 2nd-3rd, and 19th-20th and / or 20th-21st positions, counting from the 5' end of the antisense strand. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In an embodiment, the oligomeric compound comprising formula (I) and formula (IV) is siRNA. Modified nucleosides can include modified bases and / or modified sugars (preferably modified sugars at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0166] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (II): 5'YZ-(Y)q-FFNM-(Y)qM-(Y)vD-D3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, q is 2-3, v is 0-1, and a single modification type does not modify more than two consecutive nucleotides. Preferably, -DD is a TT or TA overhang. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between the two nucleosides. In a further embodiment, the positive strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) at the 5' side, the 3' side, or both sides. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In an embodiment, the oligomeric compound comprising formula (II) is ssRNA or siRNA. In certain embodiments, FFNM is FFMM or FFRM, wherein R is a ribonucleoside. Modified nucleosides can include modified bases and / or modified sugars (preferably sugars modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0167] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (V): 5'L-(Y)p-NM-(FMM)r-(Y)p-(Z)r3'. M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, L is 5' phosphate, 5' vinylphosphonate or 5' OH, Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides having the same modification or two adjacent unmodified nucleosides, p is 3-5, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides. Preferably, 3'Z is a UU or TT overhang. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In further embodiments, the antisense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) at the 5' side, the 3' side, or both sides. The PS bond modification can be located between positions 1-2, 2-3, 19-20, and / or 20-21, starting from the 5' end of the antisense strand. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In embodiments, the oligomeric compound comprising formula (V) is ssRNA or siRNA. The modified nucleoside can include modified bases and / or modified sugars (preferably sugars modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered modified nucleosides.

[0168] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (II): 5'YZ-(Y)q-FFNM-(Y)qM-(Y)vDD 3', and (b) an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (V): 5'L-(Y)p-NM-(FMM)r-(Y)p-(Z)r 3'. A duplex is formed by the sense strand and the antisense strand, wherein the length of the duplex region is 19 to 23 nucleotide pairs. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, L is a 5' phosphate, 5' vinylphosphonate or 5'OH, Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, q is 2-3, p is 3-5, r is 1-2, v is 0-1, and a single modification type does not modify more than two consecutive nucleotides. In further embodiments, the 3'Z in the antisense strand is a UU or TT overhang, and the -DD in the sense strand is a TT or TA overhang. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between the two nucleosides. In a further embodiment, the chain comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side, or both sides. The PS bond modification on the antisense strand can be located between the 1st-2nd, 2nd-3rd, 19th-20th, and / or the 20th-21st positions, counting from the 5' end of the antisense strand. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In an embodiment, the oligomeric compound comprising formula (II) and formula (V) is siRNA. In certain embodiments, the FFNM in formula (II) is FFMM or FFRM, wherein R is a ribonucleoside. The modified nucleoside can include a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered modified nucleosides.

[0169] In certain embodiments, the modification on the nucleotide comprises a modified sugar moiety. In certain embodiments, the modification on the nucleotide is selected from the group consisting of: deoxyribonucleosides (also referred to herein as DNA nucleosides) substituted ribonucleosides (also referred to herein as RNA nucleosides), LNA, 2'-OMe, 2'-F, 2'-MOE, UNA, pseudouridine, 2'-thiouridine, N6'-methyladenosine and 5'-methylcytidine, 5'-fluoro-2'-deoxyuridine, N-ethylpiperidine 5' triazole-modified adenosine, 5'-nitroindole, 2',4'-difluorotolyl ribonucleoside, N-ethylpiperidine 7'-EAA triazole-modified adenosine, 6'-phenylpyrrolocytosine, and combinations thereof. In certain embodiments, the "N" in the formula represents a modified nucleoside or an unmodified nucleoside, wherein the modification can be selected from the group consisting of: deoxyribonucleosides (also referred to herein as DNA nucleosides) substituted ribonucleosides (also referred to herein as RNA nucleosides), LNA, 2'-OMe, 2'-F, 2'-MOE, UNA, pseudouridine, 2'-thiouridine, N6'-methyladenosine and 5'-methylcytidine, 5'-fluoro-2'-deoxyuridine, N-ethylpiperidine 5'triazole-modified adenosine, 5'-nitroindole, 2',4'-difluorotolyl ribonucleoside, N-ethylpiperidine 7'-EAA triazole-modified adenosine, 6'-phenylpyrrolocytosine. The modification can also be selected from the base substitutions described below.

[0170] In certain embodiments, the FFNM motif occurs at or near the cleavage site of the sense strand and / or the (FMM)r motif occurs at or near the cleavage site of the antisense strand, wherein N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA, or LNA), F is 2'-fluoro, M is 2'-OMe, and r is 1 to 2. In certain embodiments, FFNM is FFMM or FFRM, wherein R is a ribonucleoside.

[0171] In one embodiment, the oligomeric compound capable of inhibiting the expression of the target nucleic acid comprises a sense strand having 21 connected nucleotides, wherein the sense strand sequence is represented by formula (III): 5'M*F*MMN*MN*MFFNMN*MN*MMFM*D*D 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, * is a phosphorothioate (PS) bond, and a single modification type does not modify more than two consecutive nucleotides. In an embodiment, the oligomeric compound comprising formula (III) is ssRNA or siRNA. In certain embodiments, FFNM is FFMM or FFRM, wherein R is a ribonucleoside. Modified nucleosides may include modified bases and / or modified sugars (preferably sugars modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0172] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VI): 5'LM*N*MNMFNMFMMNMFMFMMN*M*M 3'. M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA, or LNA), F is a 2'-F modified nucleoside, * is a phosphorothioate (PS) bond, L is a 5' phosphate, a 5' vinylphosphonate, or a 5'OH, and a single modification type does not modify more than two consecutive nucleotides. In an embodiment, the oligomeric compound comprising formula (VI) is ssRNA or siRNA. In certain embodiments, FNM is FMM. Modified nucleosides may include modified bases and / or modified sugars (preferably sugars modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered modified nucleosides.

[0173] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (III): 5'M*F*MMN*MN*MFFNMN*MN*MMFM*D*D3', and (b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VI): 5'LM*N*MNMFNMFMMNMFMFMMN*M*M3'. A duplex is formed by the sense strand and the antisense strand, wherein the duplex region is 19 nucleotide pairs in length and each strand has a 2 nucleotide overhang at the 3' end. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, * is a phosphorothioate (PS) bond, L is a 5' phosphate, 5' vinylphosphonate or 5'OH, and a single modification type does not modify more than two consecutive nucleotides. In an embodiment, the oligomeric compound comprising formula (III) and formula (VI) is siRNA. In certain embodiments, the FFNM in formula (III) is FFMM or FFRM, wherein R is a ribonucleoside. In certain embodiments, the FNM in formula (VI) is FMM. Modified nucleosides can include modified bases and / or modified sugars (preferably sugars modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0174] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VII): 5'LM*D*MFMFNMFMMFMFMFMMN*M*M 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA, or LNA), F is a 2'-F modified nucleoside, * is a phosphorothioate (PS) bond, L is 5'OH, 5' vinylphosphonate, or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides. In an embodiment, the oligomeric compound comprising formula (VII) is ssRNA or siRNA. In certain embodiments, FNM is FMM. The modified nucleoside may comprise a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered modified nucleosides.

[0175] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (III): 5'M*F*MMN*MN*MFFNMN*MN*MMFM*D*D3', and (b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VII): 5'LM*D*MFMFNMFMMFMFMFMMN*M*M3'. A duplex is formed by the sense strand and the antisense strand, wherein the duplex region is 19 nucleotide pairs in length and each strand has a 2 nucleotide overhang at the 3' end. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, * is a phosphorothioate (PS) bond, L is a 5' phosphate, 5' vinylphosphonate or 5'OH, and a single modification type does not modify more than two consecutive nucleotides. In an embodiment, the oligomeric compound comprising formula (III) and formula (VII) is siRNA. In certain embodiments, the FFNM in formula (III) is FFMM or FFRM, wherein R is a ribonucleoside. In certain embodiments, the FNM in formula (VII) is FMM. Modified nucleosides can include modified bases and / or modified sugars (preferably sugars modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0176] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 19 to 23 connected nucleotides, wherein the sense strand sequence is represented by formula (I): 5'M-(Y)nZ-(Y)rDD 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, n is 6-8, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides. Preferably, -DD is a TT or TA overhang. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In a further embodiment, the sense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side, or both sides. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In embodiments, the oligomeric compound comprising formula (I) is ssRNA or siRNA. The modified nucleoside can include a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0177] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IX): 5'LM-(Y)pZ-(Y)p-(Z)r 3'. M is a 2'-OMe modified nucleoside, L is a 5' phosphate, a 5' vinylphosphonate, or a 5'OH, Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, p is 3-5, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides. Preferably, 3'Z is a UU or TT overhang. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In further embodiments, the antisense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS key can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side or both sides. The PS key modification can be located between the 1st-2nd, 2nd-3rd, 19th-20th and / or 20th-21st positions from the 5' end of the antisense strand. The PS key can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In an embodiment, the oligomeric compound comprising formula (IX) is ssRNA or siRNA. The modified nucleoside can include a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleoside (D) is also considered to be a modified nucleoside.

[0178] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (I): 5'M-(Y)nZ-(Y)rDD 3', and (b) an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IX): 5'LM-(Y)pZ-(Y)p-(Z)r 3'. A duplex is formed by the sense strand and the antisense strand, wherein the length of the duplex region is 19 to 23 nucleotide pairs. D is a deoxyribonucleoside, N is a modified nucleoside or an unmodified nucleoside, M is a 2'-OMe modified nucleoside, L is 5' phosphate, 5' vinylphosphonate or 5'OH, Y is two adjacent nucleosides with different modifications or a modified nucleoside adjacent to an unmodified nucleoside, Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides, n is 6-8, p is 3-5, r is 1-2, and a single modification type does not modify more than two consecutive nucleotides. In a further embodiment, the 3'Z in the antisense strand is a UU or TT overhang, and the -DD in the sense strand is a TT or TA overhang. In certain embodiments, the sense strand comprises one or more phosphorothioate nucleotides (PS) bonds between the two nucleosides. In a further embodiment, the chain comprises phosphorothioate nucleotides (PS) bonds adjacent to deoxyribonucleosides (D) or ribonucleosides (R). The PS key can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) at the 5' side, the 3' side or both sides. The PS key modification on the antisense strand can be located between the 1st-2nd, 2nd-3rd and 19th-20th and / or 20th-21st positions from the 5' end of the antisense strand. The PS key can also be adjacent to 2 nucleosides at the 5' end of the chain and / or adjacent to 2 nucleosides at the 3' end of the chain. In an embodiment, the oligomeric compound comprising formula (I) and formula (IX) is siRNA. The modified nucleoside can include a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleoside (D) is also considered to be a modified nucleoside.

[0179] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 21 connected nucleotides, wherein the sense strand sequence is represented by formula (X): 5'MFMMNMNMFFNMNMNMMNMDD 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, and a single modification type does not modify more than two consecutive nucleotides. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In a further embodiment, the sense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side, or both sides. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In an embodiment, the oligomeric compound comprising formula (X) is ssRNA or siRNA. The modified nucleoside can include a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0180] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 21 connected nucleotides, wherein the antisense strand sequence is represented by formula (VIII): 5'L-MNMNMFNMFMMNMFMFMMNMM 3'. M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides. In certain embodiments, the positive strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In a further embodiment, the antisense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side or both sides. The PS bond modification may be located between positions 1-2, 2-3, 19-20, and / or 20-21, from the 5' end of the antisense strand. The PS bond may also be adjacent to two nucleosides at the 5' end of the strand and / or adjacent to two nucleosides at the 3' end of the strand. In an embodiment, the oligomeric compound comprising formula (VIII) is ssRNA or siRNA. The modified nucleosides may include modified bases and / or modified sugars (preferably 2' modified sugars). In RNA oligomeric compounds, deoxyribonucleosides (D) are also considered modified nucleosides.

[0181] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (X): 5'MFMMNMNMFFNMNMNMMNMDD 3', and (b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VIII): 5'L-MNMNMFNMFMMNMFMFMMNMM 3'. A duplex is formed by the sense strand and the antisense strand, wherein the duplex region is 19 nucleotide pairs in length and each strand has a 2 nucleotide overhang at the 3' end. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In further embodiments, the strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) at the 5' side, the 3' side, or both sides. The PS bond modification on the antisense strand can be located between the 1st-2nd, 2nd-3rd, and 19th-20th and / or 20th-21st positions, counting from the 5' end of the antisense strand. The PS bond can also be adjacent to the 2 nucleosides at the 5' end of the strand and / or adjacent to the 2 nucleosides at the 3' end of the strand. In embodiments, the oligomeric compound comprising formula (X) and formula (VIII) is siRNA. The modified nucleoside can comprise a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered modified nucleosides.

[0182] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises a sense strand having 21 connected nucleotides, wherein the sense strand sequence is represented by formula (XI): 5'MFMMNMNMFFMMNMNMMFMDD 3'. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, and a single modification type does not modify more than two consecutive nucleotides. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In a further embodiment, the sense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side, or both sides. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In embodiments, the oligomeric compound comprising formula (XI) is ssRNA or siRNA. The modified nucleoside can include a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0183] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises an antisense strand having 21 connected nucleotides, wherein the antisense strand sequence is represented by formula (XII): 5'L-MDMFMFNMFMMFMFMFMMNMM 3'. M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides. In certain embodiments, the positive strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In a further embodiment, the antisense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side or both sides. The PS key modification can be located between positions 1-2, 2-3, 19-20, and / or 20-21, from the 5' end of the antisense strand. The PS key can also be adjacent to two nucleosides at the 5' end of the strand and / or adjacent to two nucleosides at the 3' end of the strand. In an embodiment, the oligomeric compound comprising formula (XII) is ssRNA or siRNA. The modified nucleoside can include a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In RNA-based oligomeric compounds, deoxyribonucleosides (D) are also considered to be modified nucleosides.

[0184] In one embodiment, the oligomeric compound capable of inhibiting the expression of a target nucleic acid comprises: (a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (XI): 5'MFMMNMNMFFMMNMNMMFMDD 3', and (b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (XII): 5'L-MDMFMFNMFMMFMFMFMMNMM 3'. A duplex is formed by the sense strand and the antisense strand, wherein the duplex region is 19 nucleotide pairs in length and each strand has a 2 nucleotide overhang at the 3' end. D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside (e.g., M, F, R, D, UNA or LNA), F is a 2'-F modified nucleoside, L is 5'OH, 5' vinylphosphonate or 5' phosphate (p), and a single modification type does not modify more than two consecutive nucleotides. In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In further embodiments, the strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) at the 5' side, the 3' side, or both sides. The PS bond modification on the antisense strand can be located between the 1st-2nd, 2nd-3rd, and 19th-20th and / or 20th-21st positions, counting from the 5' end of the antisense strand. The PS bond can also be adjacent to the 2 nucleosides at the 5' end of the strand and / or adjacent to the 2 nucleosides at the 3' end of the strand. In embodiments, the oligomeric compound comprising formula (XI) and formula (XII) is siRNA. The modified nucleoside can comprise a modified base and / or a modified sugar (preferably a sugar modified at the 2' position). In the oligomeric compound based on RNA, deoxyribonucleoside (D) is also considered as the nucleoside of modification. Oligomeric compound can be transported into target cell by a variety of ways. In certain embodiments, oligomeric compound enters cell by viral delivery vector, based on lipid delivery, based on polymer delivery and / or based on conjugate delivery.

[0185] In certain embodiments, the oligomeric compound described herein further comprises a conjugate. The conjugate can be selected from cholesterol, lipids, carbohydrates, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin and dye. In a preferred embodiment, the conjugate is N-acetylgalactosamine (GalNAc). In an embodiment, the conjugate can be attached to the 3' end of the sense strand. In a preferred embodiment, the conjugated oligomeric compound is a siRNA-GalNAc conjugate.

[0186] In certain embodiments, the oligomeric compounds described herein inhibit expression of a target nucleic acid by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%.

[0187] In certain embodiments, pharmaceutical compositions comprise an oligomeric compound described herein, alone or in combination with a pharmaceutically acceptable carrier or excipient.

[0188] Certain embodiments provide a method for inhibiting target nucleic acid expression in a subject, the method comprising administering to the subject an amount of an oligomeric compound as described herein sufficient to inhibit target nucleic acid expression. The oligomeric compound can be administered to the subject subcutaneously or intravenously.

[0189] Oligomeric compounds

[0190] The oligomeric compounds of the present invention include, but are not limited to, single-stranded oligomeric compounds, such as microRNA (miRNA), single-stranded RNA (ssRNA), and antisense oligonucleotides (ASOs); and double-stranded oligomeric compounds, such as short hairpin RNA (shRNA) and small interfering RNA (siRNA). The oligomeric compound can be "antisense" to the target nucleic acid or contain the "antisense strand" of the target nucleic acid, indicating that it can hybridize with the target nucleic acid through hydrogen bonds.

[0191] In certain embodiments, the oligomeric compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of the target nucleic acid to which it is targeted. For example, in certain such embodiments, the siRNA comprises an antisense strand that has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of the target nucleic acid to which it is targeted.

[0192] In certain embodiments, the oligomeric compound is 12-30 subunits in length. In certain embodiments, the oligomeric compound is 18 to 30 subunits in length. In certain embodiments, the oligomeric compound is 12 to 22 subunits in length. In certain embodiments, the oligomeric compound is 14 to 30 subunits in length. In certain embodiments, the oligomeric compound is 14 to 21 subunits in length. In certain embodiments, the oligomeric compound is 15 to 30 subunits in length. In certain embodiments, the oligomeric compound is 15 to 21 subunits in length. In certain embodiments, the oligomeric compound is 16 to 30 subunits in length. In certain embodiments, the oligomeric compound is 16 to 21 subunits in length. In certain embodiments, the oligomeric compound is 17 to 30 subunits in length. In certain embodiments, the oligomeric compound is 17 to 21 subunits in length. In certain embodiments, the oligomeric compound is 18 to 30 subunits in length. In certain embodiments, the oligomeric compound is 18 to 21 subunits in length. In certain embodiments, the oligomeric compound is 20 to 30 subunits in length. In certain embodiments, the oligomeric compound is 15 subunits in length. In certain embodiments, the oligomeric compound is 16 subunits in length. In certain embodiments, the oligomeric compound is 17 subunits in length. In certain embodiments, the oligomeric compound is 18 subunits in length. In certain embodiments, the oligomeric compound is 20 subunits in length. In certain embodiments, the oligomeric compound is 21 subunits in length. In certain embodiments, the oligomeric compound is 22 subunits in length. In certain embodiments, the oligomeric compound is 23 subunits in length. In certain embodiments, the oligomeric compound is 25 subunits in length. In certain embodiments, the oligomeric compound is 25 subunits in length. In other embodiments, the oligomeric compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits.In certain such embodiments, the oligomeric compound is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits, or a range defined by any two of the above values. In some embodiments, the oligomeric compound is an siRNA.

[0193] It is possible to increase or decrease the length of an oligomeric compound (e.g., siRNA) and / or introduce base mismatches without eliminating activity (U.S. Patent No. 7,772,203, incorporated herein by reference). For example, it is possible to introduce atypical base pairings (e.g., A:G, A:C, G:U, I:U, I:A, or I:C) into an oligomeric compound without eliminating activity. In certain embodiments, an oligomeric compound designed to have one or more atypical base pairings (i.e., mismatches) enhances the activity of the oligomeric compound.

[0194] The oligomeric compound may comprise mismatches to the target, mismatches between oligomeric strands within the duplex, or a combination thereof. Mismatches may occur throughout the siRNA, for example, in overhang regions or duplex regions.

[0195] Oligomeric compound motif

[0196] A motif refers to a modification pattern of an oligomeric compound. Various motifs have been described in the art and are incorporated herein by reference (e.g., U.S. Patent 11,203,755; U.S. Patent 10,870,849; European Patent 1,532,248; U.S. Patent 11,406,716; U.S. Patent 10,668,170; U.S. Patent 9,796,974; U.S. Patent 8,754,201; U.S. Patent 10,837,013; U.S. Patent 7,732,593; U.S. Patent 7,015,315; U.S. Patent 7,750,144; U.S. Patent 8,420,799; U.S. Patent 8,809,516; U.S. Patent 8,796,43 6; U.S. Patent 8,859,749; U.S. Patent 9,708,615; U.S. Patent 10,233,448; U.S. Patent 10,273,477; U.S. Patent 10,612,024; U.S. Patent 10,612,027; U.S. Patent 10,669,544; U.S. Patent 11,401,517; U.S. Patent 9,260,471; U.S. Patent 9,970,005; U.S. Patent 11,193,126; U.S. Patent 8,604,183; U.S. Patent 9,150,605; U.S. Patent 9,708,610; USSN 2020 / 0031862; and USSN 2016 / 0272970). However, it will be clear to those skilled in the art that novel and improved motifs (also referred to herein as chemical modification patterns) are within the scope of the present invention.

[0197] In certain embodiments, the oligomeric compounds disclosed herein have chemically modified subunits arranged in motifs or patterns (i.e., chemically modified motifs / patterns) to impart beneficial properties to the oligomeric compounds, including but not limited to: enhanced inhibitory activity to improve efficacy; enhanced binding affinity to increase specificity for target nucleic acids, thereby limiting off-target effects and improving safety; or enhanced resistance to in vivo nuclease degradation, thereby improving stability and durability. In certain embodiments, the oligomeric compound is a chimera, wherein the peripheral core bases of the oligomeric compound comprise motifs with various modified core bases or unmodified core bases, thereby imparting increased stability, specificity, safety, and efficacy, while the central region of the compound comprises various modified core bases or unmodified core bases to serve as substrates for RISC-mediated degradation. Each different region may comprise uniform sugar groups, modified sugar moieties, or alternating sugar moieties. Each region may comprise different patterns of phosphate and phosphorothioate bonds.

[0198] In certain embodiments, a nucleic acid-targeting oligomeric compound comprises a sense strand having a motif described by one of the following formulae:

[0199] Formula (I): 5'M-(Y)nZ-(Y)rDD 3',

[0200] Formula (II): 5'YZ-(Y)q-FFNM-(Y)qM-(Y)vDD 3',

[0201] Formula (III): 5'M*F*MMN*MN*MFFNMN*MN*MMFM*D*D 3',

[0202] Formula (X): 5'MFMMNMNMFFNMNMNMMNMDD 3', or

[0203] Formula (XI): 5'MFMMNMNMFFMMNMNMMFMDD 3',

[0204] in

[0205] Each D is a deoxyribonucleoside (D is a modification of R),

[0206] Each R is a ribonucleoside,

[0207] each N is a modified nucleoside or an unmodified nucleoside (e.g., D, R, M, F, UNA modified, or LNA modified),

[0208] Each M is a 2'-OMe modified nucleoside,

[0209] Each F is a 2'-F modified nucleoside,

[0210] Each * is a phosphorothioate (PS) bond,

[0211] each Y is two adjacent nucleosides having different modifications (e.g., MD, DM, DF, FD, MF, or FM) or a modified nucleoside (e.g., DR, RD, MR, or RM) adjacent to an unmodified nucleoside,

[0212] Each Z is two adjacent unmodified nucleosides or two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides (eg, MM, DD, RR, or FF),

[0213] Each n is 6-8,

[0214] Each q is 2-3,

[0215] Each r is 1-2,

[0216] Each v is 0-1, and

[0217] Wherein a single modification type does not modify more than two consecutive nucleotides. In certain embodiments, FFNM is FFRM or FFMM.

[0218] In certain embodiments, a nucleic acid-targeting oligomeric compound comprises an antisense strand having a motif described by one of the following formulae:

[0219] Formula (IV): 5'-LM-(D)v-(Y)s-(Z)t-(Y)uZN-(Z)r 3',

[0220] Formula (V): 5'L-(Y)p-NM-(FMM)r-(Y)p-(Z)r 3',

[0221] Formula (VI): 5'LM*N*MNMFNMFMMNMFMMMN*M*M 3',

[0222] Formula (VII): 5'LM*D*MFMFNMFMMFMFFMMN*M*M 3',

[0223] Formula (VIII): 5'L-MNMNMFNMFMMNMFMFMM 3',

[0224] Formula (IX): 5'LM-(Y)pZ-(Y)p-(Z)r 3', or

[0225] Formula (XII): 5'L-MDMFMFNMFMMFMFMMMNMM 3',

[0226] in

[0227] Each D is a deoxyribonucleoside (D is a modification of R),

[0228] Each R is a ribonucleoside,

[0229] each N is a modified nucleoside or an unmodified nucleoside (e.g., D, R, M, F, UNA modified, or LNA modified),

[0230] Each M is a 2'-OMe modified nucleoside,

[0231] Each F is a 2'-F modified nucleoside,

[0232] Each L is 5' phosphate, 5' vinylphosphonate or 5' OH

[0233] Each * is a phosphorothioate (PS) bond,

[0234] each Y is two adjacent nucleosides having different modifications (e.g., MD, DM, DF, FD, MF, or FM) or a modified nucleoside (e.g., DR, RD, MR, or RM) adjacent to an unmodified nucleoside,

[0235] Each Z is two adjacent unmodified nucleosides or two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides (eg, MM, DD, RR, or FF),

[0236] Each (5p) is a 5'-phosphate,

[0237] Each n is 6-8,

[0238] Each p is 3-5,

[0239] Each r is 1-2,

[0240] Each v is 0-1,

[0241] Each s is 2-7,

[0242] Each t is 0-2,

[0243] and

[0244] wherein a single modification type does not modify more than two consecutive nucleotides. In certain embodiments, the FNM is FMM.

[0245] In certain embodiments, an oligomeric compound targeting an mRNA nucleic acid comprises an siRNA duplex having any of the following motifs:

[0246] Duplex I having a sense strand of formula (I) and an antisense strand of formula (IV);

[0247] duplex II having a sense strand of formula (II) and an antisense strand of formula (V);

[0248] duplex III having a sense strand of formula (III) and an antisense strand of formula (VI);

[0249] duplex IV having a sense strand of formula (III) and an antisense strand of formula (VII);

[0250] a duplex V having a sense strand of formula (I) and an antisense strand of formula (IX);

[0251] duplex VI having a sense strand of formula (X) and an antisense strand of formula (VIII);

[0252] duplex VII having a sense strand of formula (XI) and an antisense strand of formula (XII);

[0253] duplex VIII having a sense strand of formula (X) and an antisense strand of formula (XII); or

[0254] duplex IX having a sense strand of formula (XI) and an antisense strand of formula (VIII);

[0255] wherein the duplex region is 19 to 23 nucleotide pairs in length, and

[0256] A single modification type does not modify more than two consecutive nucleotides.

[0257] Target mRNA and related gene expression

[0258] Several embodiments relate to methods of regulating gene expression by inhibition with oligomeric compounds.

[0259] In certain embodiments, a method for inhibiting laminin (LMNA) gene expression in a cell comprises administering to the cell an oligomeric compound that targets an mRNA transcript of LMNA. In embodiments, the oligomeric compound is designed to target a 19-nucleotide LMNA sequence conserved between humans and mice (SEQ ID NO: 1).

[0260] In certain embodiments, a method of inhibiting apolipoprotein C3 (ApoC3) gene expression in a cell comprises administering to the cell an oligomeric compound that targets an mRNA transcript of ApoC3. In embodiments, the oligomeric compound is designed to target a 19-nucleotide long ApoC3 sequence (SEQ ID NO: 177) that is conserved between humans and mice.

[0261] In certain embodiments, a method of inhibiting nucleolin (NCL) gene expression in a cell comprises administering to the cell an oligomeric compound that targets an mRNA transcript of NCL. In embodiments, the oligomeric compound is designed to target a 19-nucleotide-long NCL sequence conserved between humans and mice (SEQ ID NO: 98).

[0262] hybridization

[0263] In some embodiments, hybridization occurs between an oligomeric compound disclosed herein and an mRNA.The most common hybridization mechanism involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of nucleic acid molecules.

[0264] In the Watson-Crick canonical base pairing, adenine (A) in DNA is complementary to thymine (T), adenine (A) in RNA is complementary to uracil (U), and guanine (G) in DNA and RNA is complementary to cytosine (C). Base pairs or complementary nucleobases are typically Watson-Crick base pairs (C:G, A:U, A:T), but non-canonical base pairs such as Hoogsteen base pairs (e.g., A:G or A:U), wobble base pairs (e.g., G:U, I:U, I:A, I:C, where I is hypoxanthine) and the like are also permitted during hybridization of the oligomeric compound to the target nucleic acid or target region. Wobble base pairs in RNAi agents have been previously described (see, e.g., U.S. Patent No. 7,732,593; U.S. Patent No. 7,750,144).

[0265] Nucleobase complementarity favors hybridization of the oligomeric compounds described herein to their target nucleic acids. The stronger the pairing (e.g., the more base pairs and / or the stronger the hydrogen bonds), the stronger the hybridization of the oligomeric compound to the target nucleic acid. Hybridization can occur under a variety of conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the oligomeric compound to be hybridized.

[0266] Methods for determining whether a sequence specifically hybridizes to a target nucleic acid are well known in the art. In certain embodiments, the oligomeric compounds provided herein specifically hybridize to a target mRNA with little or no off-target binding.

[0267] Complementarity

[0268] The oligomeric compound and target nucleic acid are complementary to each other when a sufficient number of nucleobases of the oligomeric compound can hybridize to corresponding nucleobases of the target nucleic acid, such that the desired effect occurs (eg, inhibition of the target nucleic acid, such as an mRNA nucleic acid).

[0269] As long as the oligomeric compound is still able to specifically hybridize with the target nucleic acid, non-complementary nucleobases between the oligomeric compound and the mRNA nucleic acid can be tolerated. In addition, the oligomeric compound can hybridize with one or more segments of the mRNA nucleic acid so that the middle or adjacent segments do not participate in hybridization events (e.g., loop structures, mispairings, or hairpin structures).

[0270] In certain embodiments, the oligomeric compound provided herein or its designated portion is complementary to an mRNA nucleic acid, a target region, a target segment or its designated portion, or at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary. The complementary percentage of the oligomeric compound and the target nucleic acid can be determined using conventional methods.

[0271] In some embodiments, oligomeric compounds are complementary to target regions in the presence of 18 complementary nucleobases in the antisense strand of the oligomeric compound. ... The percentage of homology, sequence identity or complementarity can be determined by, for example, NCBI Blast (Johnson et al., Nucleic Acids Res. 2008, 36 (Web Server issue): W5-W9).

[0272] In certain embodiments, the oligomeric compound provided herein or its specific portion is fully complementary to the target nucleic acid or its specific portion (i.e., 100% complementary). For example, the oligomeric compound can be fully complementary to an mRNA nucleic acid or its target region or target segment or target sequence. As used herein, "fully complementary" means that each core base of the oligomeric compound can accurately match with the corresponding core base of the target nucleic acid. For example, an oligomeric compound of 20 core bases is fully complementary to a target sequence of 400 core bases in length, as long as there are corresponding 20 core base portions in the target nucleic acid that are fully complementary to the oligomeric compound.

[0273] Fully complementary can also be used to refer to a specific portion of an oligomeric compound or nucleic acid target. For example, a 20-nucleobase portion of a 30-nucleobase oligomeric compound can be "fully complementary" to a target sequence that is 400 nucleobases in length. If the target sequence has a corresponding 20-nucleobase portion, each of which is complementary to the 20-nucleobase portion of the oligomeric compound, then the 20-nucleobase portion of the 30-nucleobase oligomer is fully complementary to the target sequence. At the same time, the entire 30-nucleobase oligomeric compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the oligomeric compound are also complementary to the target sequence.

[0274] The position of non-complementary core base can be located at the 5' end or the 3' end of oligomeric compound. Alternatively, non-complementary core base can be located at an internal position of oligomeric compound. When there are two or more non-complementary core bases, they can be continuous (i.e. connected) or discontinuous.

[0275] In certain embodiments, an oligomeric compound that is 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleobases in length or at most comprises no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (e.g., an mRNA nucleic acid or a specific portion thereof).

[0276] In certain embodiments, an oligomeric compound that is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length or at most comprises no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (e.g., an mRNA nucleic acid), or a designated portion thereof.

[0277] Oligomeric compounds provided herein also include compounds complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a continuous (i.e., connected) core base of a limited number within a region or segment of a target nucleic acid. "Portion" can also refer to a continuous core base of a limited number of oligomeric compounds. In certain embodiments, the oligomeric compound is partially complementary to at least 8 core bases of a target segment. In certain embodiments, the oligomeric compound is partially complementary to at least 9 core bases of a target segment. In certain embodiments, the oligomeric compound is partially complementary to at least 10 core bases of a target segment. In certain embodiments, the oligomeric compound is partially complementary to at least 11 core bases of a target segment. In certain embodiments, the oligomeric compound is partially complementary to at least 12 core bases of a target segment. In certain embodiments, the oligomeric compound is partially complementary to at least 13 core bases of a target segment. In certain embodiments, the oligomeric compound is partially complementary to at least 14 core bases of a target segment. In certain embodiments, the oligomeric compound is partially complementary to at least 15 core bases of a target segment. Also contemplated are oligomeric compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobase portion of a target segment, or a range defined by any two of these values.

[0278] Identity

[0279] Oligomeric compounds provided herein can also have a determined percentage identity with a specific nucleotide sequence, SEQ ID NO, or a compound represented by a specific ARNATAR number, or a portion thereof. As used herein, if an oligomeric compound has identical core base pairing abilities, it is identical to a sequence disclosed herein. For example, if in a disclosed DNA sequence, an RNA containing uracil instead of thymidine will be considered identical to the DNA sequence because both uracil and thymidine pair with adenine. Shortened and lengthened versions of the oligomeric compounds described herein and compounds with different bases relative to the oligomeric compounds provided herein are also contemplated. Different bases can be adjacent to each other or dispersed throughout the oligomeric compound. The percentage identity of the oligomeric compound is calculated based on the number of bases with identical base pairing relative to the compared sequence.

[0280] In certain embodiments, a portion of an oligomeric compound is compared to an equal length portion of a target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion of an oligomeric compound is compared to an equal length portion of a target nucleic acid.

[0281] Chemical modification

[0282] Nucleoside is base-sugar combination.The core base (also referred to as base) part of nucleoside is normally heterocyclic base part.Nucleotide is the nucleoside that further comprises the covalent bond (for example, phosphate group or chemical modification key as described below) with the sugar part of nucleoside.Oligonucleotide is formed by adjacent nucleotides being covalently linked to each other, thereby forming linear polymeric oligonucleotide.In oligonucleotide structure, linking group is commonly referred to as the internucleoside bond that forms oligonucleotide.Oligomer compound is by one (for example, ssRNA, antisense oligonucleotide or miRNA) or more oligonucleotide (for example, siRNA or shRNA) composition.

[0283] Modifications to the oligomeric compound encompass substitutions or changes to core bases, internucleoside linkages, or sugar moieties. Modified oligomeric compounds are generally more preferred than native or unmodified forms because the modified oligomeric compounds have desired properties, e.g., enhanced delivery (e.g., increased cellular uptake), enhanced specificity or affinity for nucleic acid targets, enhanced stability in the presence of nucleases, enhanced safety (e.g., fewer side effects after compound administration to a subject), or enhanced efficacy (e.g., inhibitory activity).

[0284] Nucleobase modification

[0285] Nucleobases are heterocyclic moieties that are capable of pairing with the nucleobases of another nucleic acid. Modifications to nucleobases are advantageous for oligomeric compounds for a variety of reasons, including but not limited to increasing the stability of the oligomeric compound, increasing specificity, reducing the immunogenicity of the oligomeric compound, increasing the affinity of the oligomeric compound, increasing the potency of the oligomeric compound, and other desirable characteristics.

[0286] Examples of nucleobase modifications and their advantages are well known in the art (Friedrich and Aigner, Therapeutic siRNA: State-of-the-Art and Future Perspectives, 2022, BioDrugs, 36(5): 549-571; Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5: 101). Nucleobase modifications can include replacing a nucleobase with a nucleobase analog, or modifying a portion of a nucleobase. Examples of nucleobase modifications include, but are not limited to, pseudouridine, 2'-thiouridine, N6'-methyladenosine, 5'-methylcytidine, 5'-fluoro-2'-deoxyuridine, N-ethylpiperidine 5' triazole-modified adenosine, 5'-nitroindole, 2',4'-difluorotolyl ribonucleoside, N-ethylpiperidine 7'-EAA triazole-modified adenosine, 6'-phenylpyrrolocytosine, and the like.

[0287] In certain embodiments, the oligomeric compound targeting mRNA nucleic acid comprises one or more modified nucleobases. In certain embodiments, the modified nucleobase is, for example, a deoxyribonucleotide substituted for a ribonucleotide. In certain embodiments, the modified nucleobase can be a thymine substituted for a uracil. In certain embodiments, the multiple nucleobases of the oligomeric compound are modified. In certain embodiments, each nucleobase of the oligomeric compound is modified.

[0288] Internucleoside bond modification

[0289] The naturally occurring internucleoside bond of RNA and DNA is 3' to 5' phosphodiester bond.For the nucleoside comprising pentofuranosyl sugar, phosphate group can be connected to 2', 3' or 5' hydroxyl moiety of sugar.Compared with the oligomeric compound with naturally occurring internucleoside bond, usually select to have the oligomeric compound of (i.e. non-naturally occurring) internucleoside bond of one or more modifications, because it has desired characteristic, for example, the cellular uptake of enhancing, the affinity to target nucleic acid, the toxicity of reduction, the stability of increase and durability, the degradability of reduction and other desired characteristics. Modified internucleoside bonds and their advantages are well known in the art (Friedrich and Aigner, Therapeutic siRNA: State-of-the-Art and Future Perspectives, 2022, BioDrugs, 36(5): 549-571; Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5: 101).

[0290] The oligomeric compound of the internucleoside bond with modification includes the internucleoside bond retaining the phosphorus atom and the internucleoside bond without the phosphorus atom.Representative phosphorus-containing internucleoside bond includes but is not limited to phosphodiester, phosphotriester, methylphosphonate (for example, 5'-methylphosphonate (5'-MP)), phosphoramidate, phosphorothioate (for example, phosphorodithioate Rp isomer (PS, Rp), phosphorodithioate Rp isomer (PS, Sp) or 5'-phosphorothioate (5'-PS)), methoxypropylphosphonate, (S)-5'-C-methyl phosphate, peptide nucleic acid (PNA) and 5'-(E)-vinylphosphonate.

[0291] In certain embodiments, the oligomeric compound of the targeting mRNA nucleic acid comprises one or more modified internucleoside bonds. In certain embodiments, the modified internucleoside bond is a phosphorothioate (PS) bond. In certain embodiments, the one or more internucleoside bonds of the oligomeric compound are phosphorothioate internucleoside bonds. In certain embodiments, the PS bond is adjacent to a deoxyribonucleoside (sometimes referred to herein as a DNA nucleoside, i.e., "D" or "d") or a ribonucleoside (sometimes referred to herein as an RNA nucleoside, i.e., "R" or "r"). In certain embodiments, each internucleoside bond of the oligomeric compound is a phosphorothioate internucleoside bond.

[0292] Sugar modification

[0293] Oligomeric compounds provided herein can contain one or more nucleosides in which sugar groups have been modified. Such sugar-modified nucleosides can impart desired properties to the oligomeric compounds, such as increased stability, increased durability (e.g., increased half-life), increased binding affinity, reduced off-target effects, reduced immunogenicity, reduced toxicity, increased efficacy, or some other beneficial biological properties. Sugar modifications and their advantages are known in the art (Friedrich and Aigner, 2022, BioDrugs, 36(5):549-571; Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5:101; Chiu and Rana, 2003, RNA, 9:1034-1048; Choung et al., Biochem Biophys Res Commun, 2006, 342:919–927; Amarzguioui et al., 2003, Nucleic Acids Res, 31(2):589-595; Braasch et al., 2003, Biochemistry, 42(26):7967–7975; Czauderna et al., 2003, Nucleic Acids Res, 31(11):2705-2716; Allerson et al., 2005, J Med Chem, 48:901-904; Layzer et al., 2004, RNA, 10:766–771; Ui-Tei, et al., 2008, Nucleic Acids Res, 36(7):2136-51; Bramsen and Kjems, 2012, Frontiers in Genetics, 3(154):1-22; Bramsen et al., 2010, Nucleic Acids Res, 38(17):5761-5773; Muhonen et al., 2007, Chem & Biodiversity, 4:858-873; Viel et al., 2008, Oligonucleotides, 18:201-212; which are incorporated herein by reference).

[0294] In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring portion. Examples of chemically modified ribofuranose rings can include, but are not limited to, the addition of substituent groups (e.g., 5' sugar modifications or 2' sugar modifications); bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNAs); replacement of the ribose ring oxygen atom with S, N(R), or C(R1)(R)2 (R=H, C1-C12 alkyl, or protecting groups); nucleoside mimetics; and combinations thereof.

[0295] A 2'-modified sugar refers to a furanose modified at the 2' position. A 2'-modified nucleoside refers to a nucleoside comprising a sugar modified at the 2' position of the furanose ring. In certain embodiments, such modifications include substituents selected from the group consisting of halides, including but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted sulfanyl, substituted and unsubstituted aminoalkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, the 2' modification is selected from the group consisting of substituents including but not limited to O[(CH2) n O] m CH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, OCH2C(=O)N(H)CH3 and O(CH2) n ON[(CH2) n CH3]2, wherein n and m are 1 to about 10. Other 2'-substituent groups may also be selected from: C1-C 12 Alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkylaryl, aminoalkylamino, polyalkylamino, substituted silicon, RNA cleavage group, reporter group, intercalator, group that improves pharmacokinetic properties, group that improves the pharmacodynamic properties of oligomeric compounds, and other substituents with similar properties.

[0296] Further examples of nucleosides with modified sugar moieties include, but are not limited to, nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 2'-F-5'-methyl, 4'-S, 2'-deoxy-2'-fluoro (2'-F), 2'-OCH3 (2'-O-methyl, 2'-OMe), 2'-O(CH2)2OCH3 (2'-O-methoxyethyl, 2'-O-MOE, 2'-MOE), 2'-O-methyl-4-pyridine, phosphorodiamidate morpholine (PMO), tricyclic DNA (tcDNA), 2'-arabino-fluoro, 2'-O-benzyl, glycol nucleic acid (GNA), and unlocked nucleic acid (UNA) substituent groups. The 2' position substituent can also be selected from allyl, amino, azido, thio, O-allyl, O-C1-C 10 alkyl, OCF3, O(CH2)2SCH3, O(CH2)2-ON(Rm)(Rn) and O-CH2-C(=O)-N(Rm)(Rn), wherein each Rm and Rn is independently H or substituted or unsubstituted C1-C 10 Alkyl. 2'-OMe or 2'-OCH3 or 2'-O-methyl each refers to a nucleoside comprising a sugar comprising an -OCH3 group at the 2' position of the sugar ring. 2'-F refers to a sugar comprising a fluorine group at the 2' position. 2'-O-methoxyethyl or 2'-O-MOE or 2'-MOE each refers to a nucleoside comprising a sugar comprising an -O(CH2)2OCH3 group at the 2' position of the sugar ring.

[0297] BNA refers to a modified nucleoside comprising a bicyclic sugar moiety, wherein the bridge connecting the two carbon atoms of the sugar ring connects 2' carbon and another carbon of the sugar ring. Examples of bicyclic nucleosides include, but are not limited to, nucleosides comprising a bridge between 4' and 2' ribose ring atoms, such as in locked nucleic acids (LNA). In certain embodiments, provided herein are oligomeric compounds including one or more bicyclic nucleosides, wherein the bridge comprises 4' to 2' bicyclic nucleosides. Campbell and Wengel (Chem Soc Rev, 2011, 40 (12): 5680-9) describe LNA and UNA, and are incorporated herein by reference.

[0298] In certain embodiments, the oligomeric compound comprises one or more nucleotides having a modified sugar moiety. In certain embodiments, the modified sugar moiety has a 2'-OMe modification. In certain embodiments, the modified sugar moiety has a 2'-F modification. In certain embodiments, the 2'-OMe and / or 2'-F modified nucleotides are arranged in a motif. In certain embodiments, the motif is selected from any one of formulas (I)-(VII).

[0299] Oligomeric compound delivery systems

[0300] Oligomeric compounds need to enter target cells to exert their activity. A variety of methods have been used to deliver oligomeric compounds into target cells, including viral delivery vectors, lipid-based delivery, polymer-based delivery, and conjugate-based delivery (Paunovska et al., Drug Delivery Systems for RNA Therapeutics, 2022, Nature Reviews Genetics, 23(5): 265-280; Chen et al., 2022, Molecular Therapy, Nucleic Acids, 29: 150-160).

[0301] Lipid-based particles can form specific structures, such as micelles, liposomes, and lipid nanoparticles (LPNs), to carry oligomeric compounds into cells. In order to form these particles, LPNs can include one or more of the following: cationic lipids or ionizable lipids (e.g., DLin-MC3-DMA, SM-102, or ALC-0315), cholesterol, auxiliary lipids, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), poly (ethylene glycol) (PEG) modified lipids (e.g., PEG-2000-C-DMG, PEG-2000-DMG, or ALC-0159), C12-200, cKK-E12, etc. Different lipid combinations can be formulated to affect the delivery of oligomeric compounds to different types of cells. In one example, therapeutic siRNA patisilan is formulated in cationic ionizable lipids DLin-MC3-DMA, cholesterol, polar phospholipids DSPC, and PEG-2000-C-DMG to be delivered to hepatocytes.

[0302] Polymer-based particles are also used for oligomeric compound delivery systems. Such polymers include poly (lactic acid-co-glycolic acid) (PLGA), polyethyleneimine (PEI), poly (l-lysine) (PLL), poly (β-amino ester) (PBAE), dendrimers (e.g., poly (amidoamine) (PAMAM) or PLL)) and other polymers or their modified polymers. Polymer compositions can vary according to the desired characteristics of the oligomeric compound being delivered.

[0303] Oligomeric compounds disclosed herein can be covalently linked to one or more moieties or conjugates to enhance the activity, cellular distribution or cellular uptake of the resulting compound. Conjugated groups can include cholesterol, lipids, carbohydrates, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, dye, tocopherol (Nishina et al., 2008, Molecular Therapy, 16 (4): 734-740) etc. Conjugate-based delivery can actively deliver oligomeric compounds to specific cell types.

[0304] In an example, N-acetylgalactosamine (GalNAc) is conjugated to an oligomeric compound and delivered to hepatocytes. Various GalNAc conjugates are found in a variety of publications, including the following, all of which are incorporated herein by reference: Sharma et al., 2018, Bioconjugate Chem, 29: 2478-2488; Nair et al., J. Am. Chem. Soc. 2014, 136(49): 16958-16961; Keam, 2022, Drugs, 82: 1419-1425; US Patent 10,087,208; Prakash et al., 2014, Nucleic Acids Res, 42(13): 8796-807; Debacker et al., 2020, Molecular Therapy, 28(8):1759-1771; U.S. Patent 11,110,174; U.S. Patent 9,796,756; U.S. Patent 9,181,549; U.S. Patent 10,344,275; U.S. Patent 10,570,169; U.S. Patent 9,506,030; and U.S. Patent 7,582,744.

[0305] In a further example, the following GalNAc is conjugated to the 3' end of an oligonucleotide comprising the sense strand of an ARNATAR designed siRNA.

[0306]

[0307] Oligomeric compound synthesis

[0308] siRNAs are designed, synthesized, and prepared using methods known in the art.

[0309] Using standard phosphoramidite chemistry, the MerMade TMOligonucleotides were synthesized on a 48x synthesizer (BioAutomation, LGC, Biosearch Technologies, Hoddesdon, UK), which can produce up to 48 oligonucleotides at a 1 μMole or 5 μMole scale per run. The solid support is a controlled pore glass The PCR products were loaded with 3'-GalNAc conjugates (AM Chemicals, Vista, CA, USA; Primetech ALC, Minsk, Belarus; Gene Link, Elmsford, NY, USA; or any GalNAc conjugate disclosed herein) or a universal solid support (AM Chemicals, Vista, CA, USA). Ancillary synthesis reagents and standard 2'-cyanoethyl phosphoramidite monomers (2'-fluoro nucleosides, 2'-O-methyl nucleosides, RNA nucleosides, DNA nucleosides) were obtained from different sources (Hongene Biotech, Shanghai, China; Sigma-Aldrich, St. Louis, MO, USA; Glen Research, Sterling, VA, USA; ThermoFisher Scientific, Waltham, MA, USA; LGC Biosearch Technologies, Hoddesdon, UK). Phosphoramidite mixtures were prepared in anhydrous acetonitrile or 30% DMF:acetonitrile and coupled using 0.25 M 4,5-dicyanoimidazole (DCI) (Sigma-Aldrich, St. Louis, MO, USA) with coupling times ranging from 120 to 360 seconds. Standard phosphodiester bonds were achieved using a 0.02 M mixture of iodine in tetrahydrofuran (THF), pyridine, and water. Phosphorothioate bonds were generated using 0.05 M sulfurization reagent II (3-((dimethylamino-methylene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT) (40:60, pyridine / acetonitrile) (LGCBiosearch Technologies, Hoddesdon, UK) with an oxidation time of 6 minutes. All sequences were synthesized without the dimethoxytrityl (DMT) protecting group.

[0310] After solid-phase synthesis, the oligonucleotides were cleaved from the solid support and incubated in ammonium hydroxide at 55°C for 6 hours to deprotect the base-labile groups. The ammonium hydroxide was removed using a centrifugal vacuum concentrator and dried at room temperature. For sequences containing natural ribonucleotides (2'-OH) protected with tert-butyldimethylsilyl (TBDMS), a second deprotection was performed using triethylamine:trihydrofluoric acid (TEA:3HF). 100 μL of DMSO and 125 μL of TEA:3HF were added to each TBDMS-protected oligonucleotide and incubated at 65°C for 2.5 hours. Following incubation, 25 μL of 3 M sodium acetate was added to the solution, followed by precipitation in butanol at -20°C for 30 minutes. The turbid solution was centrifuged to form a cake, and the supernatant was carefully removed with a pipette. A standard precipitation procedure was then completed using 75% ethanol:water, followed by 100% ethanol, as the supernatant. The oligonucleotide cake was dried in a centrifugal vacuum concentrator for 30 minutes.

[0311] After precipitation with 3 M sodium acetate, the product was desalted without HPLC purification and then purified on G25 Oligonucleotides were purified by anion exchange chromatography on a Gilson GX271 preparative HPLC system (Middleton, WI, USA) using BioWorks Q40 resin (Uppsala, Sweden). Final desalting was performed on a G25 column. All oligonucleotides were analyzed for purity by ion-pair reversed-phase HPLC on an Agilent 1200 analytical HPLC (Santa Clara, CA, USA), intact mass analysis by negative ion mass spectrometry on an Agilent 6130 single quadrupole mass spectrometer (Santa Clara, CA, USA), and purified by a Tecan HPLC column. A260 quantification was performed by UV / Vis analysis on an M Plex microplate reader (Zurich, Switzerland).

[0312] Double-stranded oligomeric compound duplex formation

[0313] Typically, for double-stranded oligomeric compounds (e.g., siRNA compounds), the sense and antisense oligonucleotides are annealed together to form a duplex. 50-300 μM duplex formation can be achieved by heating the sample in 1x phosphate-buffered saline at 94°C for 4 min in a block heater, then removing the heating block containing the sample from the block heater and allowing it to gradually cool to room temperature over the course of 1 hour.

[0314] Compositions and methods for formulating pharmaceutical compositions

[0315] The oligomeric compounds of the present invention, such as the siRNA compounds described herein, can be combined with pharmaceutically acceptable active or inert substances (such as diluents, excipients or carriers) to prepare pharmaceutical compositions or formulations.

[0316] The method of formulating the compositions and pharmaceutical compositions depends on various criteria including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0317] In certain embodiments, pharmaceutical carrier or excipient is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert solvent for delivering one or more nucleic acid compounds to an animal. Excipient can be liquid or solid and can be selected according to the planned mode of administration so as to provide desired volume, consistency, etc. when combined with nucleic acid and other components of a given pharmaceutical composition. Typical pharmaceutical carriers include but are not limited to adhesives (e.g., pregelatinized corn starch, polyvinyl pyrrolidone and / or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate and / or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, stearic acid metal salts, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate and / or sodium acetate, etc.); disintegrants (e.g., starch and / or sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[0318] Pharmaceutically acceptable organic or inorganic excipients that do not react adversely with nucleic acid compounds and are suitable for parenteral or non-parenteral administration can also be used to prepare the compositions of the present invention. Suitable pharmaceutically acceptable carriers include but are not limited to water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinyl pyrrolidone, etc. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS). PBS is a diluent suitable for parenteral delivery compositions. Therefore, in one embodiment, the method described herein employs a pharmaceutical composition comprising an oligomeric compound and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the oligomeric compound is siRNA.

[0319] Pharmaceutical compositions comprising oligomeric compounds (e.g., siRNA) may comprise any pharmaceutically acceptable salt, ester, or salt of such ester, or any other dsRNA that, upon administration to an animal (including a human), is capable of providing (directly or indirectly) its biologically active metabolite or residue. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of oligomeric compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0320] In certain embodiments, pharmaceutical compositions are prepared for administration by injection (e.g., intravenous, subcutaneous, and / or intramuscular, etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution (e.g., water or a physiologically compatible buffer, such as Hanks solution, Ringer solution, or physiological saline buffer (e.g., PBS)). In certain embodiments, other ingredients (e.g., ingredients that aid in dissolution or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Some pharmaceutical compositions for injection exist in unit dosage form, such as ampoules or multidose containers.

[0321] dose

[0322] For the purposes of this disclosure, the amount or dosage of the active agent (oligomeric compound of the present invention) administered should be sufficient, for example, to inhibit the expression of the target nucleic acid in the animal. In animals (e.g., humans), the dosage will be determined by the efficacy of the specific active agent and the condition of the animal and the weight of the animal to be treated.

[0323] A variety of assays are known in the art for determining the dosage to be administered.

[0324] The dosage of the active agent of the present disclosure will also be determined by the presence, nature, and extent of any adverse side effects that may accompany the administration of the particular active agent of the present disclosure. Generally, the attending physician will consider a variety of factors, such as age, weight, general health, diet, sex, the active agent of the present disclosure to be administered, the route of administration, and the severity of the condition being treated, to determine the dosage of the active agent of the present disclosure for treating each individual patient.

[0325] Drug administration

[0326] In certain embodiments, pharmaceutical composition is used according to dosage regimen (for example, dosage, administration frequency and duration), wherein dosage regimen can be selected to realize desired effect.Desired effect can be, for example, reduce target nucleic acid or prevent, reduce, improve or slow down the progress of the disease, disease and / or the patient's condition or its symptom relevant to target nucleic acid.In certain embodiments, the variable of adjustment dosage regimen is to produce the pharmaceutical composition concentration desired in experimenter. " pharmaceutical composition concentration " used about dosage regimen can refer to oligomeric compound or the active ingredient of pharmaceutical composition.For example, in certain embodiments, adjustment dosage and administration frequency are to provide the tissue concentration or the plasma concentration of the pharmaceutical composition of the amount that is enough to realize desired effect.

[0327] Dosing depends on the severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure or alleviation of the disease state is achieved. Dosing also depends on drug efficacy and metabolism. In certain embodiments, the dosage is 0.01 μg to 50 mg per kg body weight, 0.01 μg to 100 mg per kg body weight, or administered in the range of 0.001 mg to 1000 mg, and can be administered once or more daily, weekly, monthly, quarterly or annually, or even once every 2 to 20 years. Following successful treatment, it may be desirable to allow the patient to receive maintenance therapy to prevent recurrence of the disease state, wherein the oligomeric compound is administered at a maintenance dose in the range of 0.01 μg to 100 mg per kg body weight, once or more daily, once or more weekly, once or more monthly, quarterly, once or more annually, to once every 20 years, or in the range of 0.001 mg to 1000 mg. In certain embodiments, it may be desirable to administer the oligomeric compound at most once daily, weekly, monthly, quarterly, annually, every two years, every three years, every four years, every five years, every ten years to every twenty years.

[0328] In certain embodiments, the dosage range is between any of 1 mg-1500 mg, 100 mg-1400 mg, 100 mg-1300 mg, 100 mg-1200 mg, 100 mg-1100 mg, 100 mg-1000 mg, 100 mg-900 mg, 200 mg-800 mg, 300 mg-700 mg, 400 mg-600 mg, 100 mg-400 mg, 200 mg-500 mg, 300 mg-600 mg, and 400 mg-700 mg. In certain embodiments, the dosage is about 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1050 mg, 1100 mg, 1150 mg, 1200 mg, 1250 mg, 1300 mg, 1350 mg, 1400 mg, 1450 mg, or 1500 mg.

[0329] In certain embodiments, the dsRNA is administered at a dosage of about 150 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, or 900 mg twice a year. In certain embodiments, the dsRNA is administered at a dosage of about 150 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, or 900 mg quarterly.

[0330] Application

[0331] The oligomeric compounds (eg, siRNA) or pharmaceutical compositions of the present invention can be administered in a variety of ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be oral, by inhalation, or parenteral.

[0332] In certain embodiments, the compounds and compositions described herein are administered parenterally. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial administration, for example, intrathecal or intraventricular administration. In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or brief or intermittent. In certain embodiments, the infused agent is delivered by a pump.

[0333] In certain embodiments, parenteral administration is by injection. Injection can be performed using a syringe or pump. In certain embodiments, the injection is a bolus. In certain embodiments, the injection is administered directly into a tissue or organ.

[0334] In certain embodiments, formulations for parenteral, intrathecal, or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other suitable additives, such as, but not limited to, penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers or excipients.

[0335] In certain embodiments, the preparation for oral administration of a compound or composition may include, but is not limited to, a pharmaceutical carrier, an adjuvant, a powder or granule, a microparticle, a nanoparticle, a suspension or solution in water or a non-aqueous medium, a capsule, a gel capsule, a sachet, a tablet or a small tablet. Thickeners, flavorings, diluents, emulsifiers, dispersion aids or adhesives may be desired. In certain embodiments, oral formulations are preparations in which the compound provided herein is administered in combination with one or more penetration enhancers, surfactants and chelating agents.

[0336] In vitro assays of siRNA

[0337] Described herein are methods for treating cells with siRNA that can be appropriately modified for treatment with other oligomeric compounds.

[0338] When cells reach approximately 60-80% confluence in culture, cells can be treated with siRNA.

[0339] A reagent commonly used to introduce siRNA into cultured cells includes the cationic lipid transfection reagent Lipofectamine TM RNAiMAX (Invitrogen, Waltham, MA). siRNA can be expressed with Lipofectamine in OPTI-MEM 1 (ThermoFisher Scientific, Waltham, MA). TM RNAiMAX mix to achieve the desired final siRNA concentration, and Lipofectamine TM RNAiMAX concentrations can range from 0.001 nM to 300 nM siRNA. Transfection procedures were performed according to the manufacturer's recommended protocol.

[0340] Another technique for introducing siRNA into cultured cells is electroporation.

[0341] siRNA conjugated to GalNAc can be introduced into cells by incubating the siRNA with the cells without the need for a transfection reagent, referred to herein as "free uptake." siRNA-GalNAc conjugates are transported into asialoglycoprotein receptor (ASGR)-positive cells (e.g., hepatocytes) by endocytosis.

[0342] Cells are treated with siRNA by conventional methods. Cells can be harvested 4-144 hours after siRNA treatment, and the mRNA (harvested at 4-144 hours) or protein levels (extracted at 24-96 hours) of the target nucleic acid are measured by methods known in the art and methods described herein. Typically, the process is repeated multiple times, and the data are presented as the mean value plus standard deviation of the repeated treatments.

[0343] The concentration of siRNA used varies with the cell line and target. Methods for determining the optimal siRNA concentration for a particular target in a particular cell line are well known in the art. Typically, cells are treated with siRNA in a dose-dependent manner to achieve the calculation of the half-maximal inhibitory concentration (IC50). TM When using RNAiMAX transfection, siRNA is typically used at concentrations ranging from 0.001 nM to 300 nM. When using electroporation or free uptake transfection, siRNA is used at higher concentrations ranging from 7.5 nM to 20,000 nM.

[0344] RNA isolation

[0345] RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. RNA isolation methods are well known in the art. RNA is prepared using methods well known in the art, for example, using TRIZOL reagent (Thermo Fisher Scientific, Waltham, MA), Qiagen RNeasy kit (Qiagen, Hilden, Germany) or AcroPrep Advance 96-well filter plates (Pall Corporation, Port Washington, New York) using Qiagen's RLT, RW1 and RPE buffers. RNA extraction procedures are performed according to the manufacturer's recommended protocols.

[0346] In vivo testing of oligomeric compounds

[0347] The oligomeric compound of the present invention (for example, siRNA) is tested in animals to assess its ability to suppress target nucleic acid expression and produce phenotypic changes (for example, changes in one or more markers affected by target nucleic acid). In addition, phenotypic changes can be the reduction of diseases, disorders, conditions or symptoms related to target nucleic acid. Tests can be carried out in normal animals or experimental disease models. In order to be applied to animals, oligomeric compounds are prepared in a pharmaceutically acceptable diluent (for example, phosphate buffered saline (PBS)). Administration includes parenteral administration routes, such as intraperitoneal, intravenous and subcutaneous. The calculation of dosage and dosing frequency depends on the following factors, such as route of administration and animal weight. In one embodiment, after being treated for a period of time with the oligomeric compound of the present invention, RNA encoding the target nucleic acid is separated from liver tissue, and the changes in target nucleic acid expression are measured. The changes in the protein levels of target nucleic acid expression can also be measured.

[0348] Kit of the present invention

[0349] According to another aspect of the present invention, a kit is provided. The kit of the present invention includes packaging comprising any composition of the present invention or the oligomeric compound of the present invention. In various aspects, the kit includes any composition of the present invention as a unit dose. For purposes herein, "unit dose" refers to a discrete amount dispersed in a suitable carrier.

[0350] The phrase "package" means any container containing the compositions described herein. In a preferred embodiment, the package can be a box or wrapping paper. Packaging materials used to package pharmaceutical products are well known to those skilled in the art. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes (including pre-filled syringes), bottles, and any packaging material suitable for the selected formulation and intended administration and treatment modality.

[0351] The kit may also contain items not included within the packaging but attached to the outside of the packaging, for example, a pipette.

[0352] The kit may optionally contain instructions for administering the compositions of the present invention to a subject suffering from a condition requiring treatment. The kit may also include instructions for the purposes of the components of the compositions herein approved by regulatory agencies (e.g., the U.S. Food and Drug Administration). The kit may optionally contain a label or product specification sheet of the compositions. Packaging and / or any product specification sheet itself may have obtained regulatory approval. The kit may include a composition (e.g., a buffer provided) in a solid or liquid form in the packaging. The kit may also include a buffer for preparing a solution implementing the method, and a pipette for transferring a liquid from one container to another container.

[0353] Kits may also optionally contain one or more other compositions for the combination therapies described herein. In certain embodiments, packaging is a container for any mode of administration (e.g., intravitreal delivery, intraocular delivery, intratumoral delivery, peritumoral delivery, peritoneal delivery, intrathecal delivery, intramuscular injection, subcutaneous injection, intravenous delivery, intraarterial delivery, intraventricular delivery, intrasternal delivery, intracranial delivery, or intradermal injection).

[0354] How to use

[0355] The present invention provides a method for inhibiting the expression of a target nucleic acid in a subject, comprising administering an effective amount of an oligomeric compound of the present invention or a pharmaceutical composition of the present invention to inhibit the expression of the target nucleic acid in the subject.

[0356] In some embodiments of the present disclosure, the subject is a mammal, including but not limited to rodents, such as mice and hamsters, and lagomorphs, such as rabbits, carnivores, including felines (cats) and canines (dogs), artiodactyls, including bovines (cows) and suids (pigs), or odd-toed ungulates, including equines (horses). In some aspects, the mammal is of the order Primates, Simians, or Anthropoids (monkeys), or of the order Anthropoids (humans and apes). In preferred aspects, the mammal is a human.

[0357] Specific implementation plan

[0358] Embodiment 1 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (I):

[0359] 5'M-(Y)nZ-(Y)rDD 3'

[0360] in:

[0361] D is a deoxyribonucleoside,

[0362] M is a 2'-OMe modified nucleoside,

[0363] Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside,

[0364] Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides,

[0365] n is 6-8,

[0366] r is 1-2, and

[0367] A single modification type does not modify more than two consecutive nucleotides.

[0368] The oligomeric compound of embodiment 1, wherein -DD is a TT or TA overhang.

[0369] The oligomeric compound of embodiment 1, wherein the modification to the nucleotide is selected from the group consisting of deoxyribonucleosides (DNA nucleosides) substituted ribonucleosides, locked nucleic acids (LNA), 2'-OMe, 2'-F, unlocked nucleic acids (UNA), and combinations thereof.

[0370] The oligomeric compound of embodiment 1, wherein the sense strand comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0371] The oligomeric compound of embodiment 1, wherein the sense strand comprises phosphorothioate internucleotide (PS) linkages adjacent to the two nucleosides at the 5' end of the strand and / or adjacent to the two nucleosides at the 3' end of the strand.

[0372] Embodiment 2 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IV):

[0373] 5'LM-(D)v-(Y)s-(Z)t-(Y)uZN-(Z)r 3'

[0374] in:

[0375] D is a deoxyribonucleoside,

[0376] N is a modified nucleoside or an unmodified nucleoside,

[0377] M is a 2'-OMe modified nucleoside,

[0378] L is 5' phosphate, 5' vinylphosphonate or 5' OH,

[0379] Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside,

[0380] Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides,

[0381] r is 1-2,

[0382] v is 0-1,

[0383] s is 2-7,

[0384] t is 0-2,

[0385] u is 0-5, and

[0386] A single modification type does not modify more than two consecutive nucleotides.

[0387] The oligomeric compound of embodiment 2, wherein 3'Z is a UU or TT overhang.

[0388] The oligomeric compound of embodiment 2, wherein the modification to the nucleotide is selected from the group consisting of deoxyribonucleosides (DNA nucleosides) substituted ribonucleosides, locked nucleic acids (LNA), 2'-OMe, 2'-F, unlocked nucleic acids (UNA), and combinations thereof.

[0389] The oligomeric compound of embodiment 2, wherein the antisense strand comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0390] The oligomeric compound of embodiment 2, wherein the antisense strand comprises phosphorothioate (PS) internucleotide linkage modifications between positions 1-2, 2-3, 19-20, and 20-21 from the 5' end of the antisense strand.

[0391] The oligomeric compound of embodiment 2, wherein the antisense strand comprises phosphorothioate internucleotide (PS) linkages adjacent to the two nucleosides at the 5' end of the strand and / or adjacent to the two nucleosides at the 3' end of the strand.

[0392] Embodiment 3 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising:

[0393] a) a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (I):

[0394] 5'M-(Y)nZ-(Y)rDD 3'

[0395] b) an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IV):

[0396] 5'LM-(D)v-(Y)s-(Z)t-(Y)uZN-(Z)r 3', and

[0397] c) a duplex formed by a sense strand and an antisense strand,

[0398] in

[0399] D is a deoxyribonucleoside,

[0400] N is a modified nucleoside or an unmodified nucleoside,

[0401] M is a 2'-OMe modified nucleoside,

[0402] L is 5' phosphate, 5' vinylphosphonate or 5' OH,

[0403] Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside,

[0404] Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides,

[0405] n is 6-8,

[0406] r is 1-2,

[0407] v is 0-1,

[0408] s is 2-7,

[0409] t is 0-2,

[0410] u is 0-5, and

[0411] wherein the duplex region is 19 to 23 nucleotide pairs in length, and

[0412] A single modification type does not modify more than two consecutive nucleotides.

[0413] The oligomeric compound of embodiment 3, wherein the 3'Z in the antisense strand is a UU or TT overhang.

[0414] The oligomeric compound of embodiment 3, wherein -DD in the sense strand is a TT or TA overhang.

[0415] The oligomeric compound of embodiment 3, wherein the modification to the nucleotide is selected from the group consisting of deoxyribonucleosides (DNA nucleosides) substituted ribonucleosides, locked nucleic acids (LNA), 2'-OMe, 2'-F and unlocked nucleic acids (UNA), or a combination thereof.

[0416] The oligomeric compound of embodiment 3, wherein each chain comprises at least one phosphorothioate internucleotide (PS). In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0417] The oligomeric compound of embodiment 3, wherein the antisense strand comprises phosphorothioate (PS) internucleotide linkage modifications between positions 1-2, 2-3, 19-20, and 20-21 from the 5' end of the antisense strand.

[0418] The oligomeric compound of embodiment 3, wherein the chain comprises phosphorothioate internucleotide (PS) linkages adjacent to the two nucleosides at the 5' end of the chain and / or adjacent to the two nucleosides at the 3' end of the chain.

[0419] Embodiment 4 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (II):

[0420] 5'YZ-(Y)q-FFNM-(Y)qM-(Y)vDD 3'

[0421] in:

[0422] D is a deoxyribonucleoside,

[0423] M is a 2'-OMe modified nucleoside,

[0424] N is a modified nucleoside or an unmodified nucleoside,

[0425] F is a 2'-F modified nucleoside,

[0426] Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside,

[0427] Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides,

[0428] q is 2-3,

[0429] v is 0-1, and

[0430] A single modification type does not modify more than two consecutive nucleotides.

[0431] The oligomeric compound of embodiment 4, wherein -DD is a TT or TA overhang.

[0432] The oligomeric compound of embodiment 4, wherein the modification to the nucleotide is selected from the group consisting of deoxyribonucleosides (DNA nucleosides) substituted ribonucleosides, locked nucleic acids (LNA), 2'-OMe, 2'-F, unlocked nucleic acids (UNA), and combinations thereof.

[0433] The oligomeric compound of embodiment 4, wherein the sense strand comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0434] The oligomeric compound of embodiment 4, wherein the sense strand comprises phosphorothioate internucleotide (PS) linkages adjacent to the two nucleosides at the 5' end of the strand and / or adjacent to the two nucleosides at the 3' end of the strand.

[0435] Embodiment 5 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (V):

[0436] 5'L-(Y)p-NM-(FMM)r-(Y)p-(Z)r 3'

[0437] in:

[0438] M is a 2'-OMe modified nucleoside,

[0439] F is a 2'-F modified nucleoside,

[0440] L is 5' phosphate, 5' vinylphosphonate or 5' OH,

[0441] Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside,

[0442] Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides,

[0443] p is 3-5,

[0444] r is 1-2, and

[0445] A single modification type does not modify more than two consecutive nucleotides.

[0446] The oligomeric compound of embodiment 5, wherein 3'Z is a UU or TT overhang.

[0447] The oligomeric compound of embodiment 5, wherein the modification to the nucleotide is selected from the group consisting of deoxyribonucleosides (DNA nucleosides) substituted ribonucleosides, locked nucleic acids (LNA), 2'-OMe, 2'-F, unlocked nucleic acids (UNA), and combinations thereof.

[0448] The oligomeric compound of embodiment 5, wherein the antisense strand comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0449] The oligomeric compound of embodiment 5, wherein the antisense strand comprises phosphorothioate (PS) internucleotide linkage modifications between positions 1-2, 2-3, 19-20, and 20-21 from the 5' end of the antisense strand.

[0450] The oligomeric compound of embodiment 5, wherein the antisense strand comprises phosphorothioate internucleotide (PS) linkages adjacent to the two nucleosides at the 5' end of the strand and / or adjacent to the two nucleosides at the 3' end of the strand.

[0451] Embodiment 6 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising:

[0452] a) a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (II):

[0453] 5'YZ-(Y)q-FFNM-(Y)qM-(Y)vDD 3'

[0454] b) an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (V):

[0455] 5'L-(Y)p-NM-(FMM)-(Y)p-(Z)r 3', and

[0456] c) a duplex formed by a sense strand and an antisense strand,

[0457] in

[0458] D is a deoxyribonucleoside,

[0459] M is a 2'-OMe modified nucleoside,

[0460] N is a modified nucleoside or an unmodified nucleoside,

[0461] F is a 2'-F modified nucleoside,

[0462] L is 5' phosphate, 5' vinylphosphonate or 5' OH,

[0463] Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside,

[0464] Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides,

[0465] q is 2-3,

[0466] p is 3-5,

[0467] r is 1-2,

[0468] v is 0-1,

[0469] wherein the duplex region is 19 to 23 nucleotide pairs in length, and

[0470] A single modification type does not modify more than two consecutive nucleotides.

[0471] The oligomeric compound of embodiment 6, wherein the 3'Z in the antisense strand is a UU or TT overhang.

[0472] The oligomeric compound of embodiment 6, wherein -DD in the sense strand is a TT or TA overhang.

[0473] The oligomeric compound of embodiment 6, wherein the modification to the nucleotide is selected from the group consisting of deoxyribonucleosides (DNA nucleosides) substituted ribonucleosides, locked nucleic acids (LNA), 2'-OMe, 2'-F, unlocked nucleic acids (UNA), and combinations thereof.

[0474] The oligomeric compound of embodiment 6, wherein each chain comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0475] The oligomeric compound of embodiment 6, wherein the antisense strand comprises phosphorothioate (PS) internucleotide linkage modifications between positions 1-2, 2-3, and 20-21 from the 5' end of the antisense strand.

[0476] The oligomeric compound of embodiment 6, wherein the chain comprises phosphorothioate internucleotide (PS) linkages adjacent to the two nucleosides at the 5' end of the chain and / or adjacent to the two nucleosides at the 3' end of the chain.

[0477] Embodiment 7 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IX):

[0478] 5'LM-(Y)pZ-(Y)p-(Z)r 3'

[0479] in:

[0480] M is a 2'-OMe modified nucleoside,

[0481] L is 5' phosphate, 5' vinylphosphonate or 5' OH,

[0482] Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside,

[0483] Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides,

[0484] n is 6-8,

[0485] r is 1-2, and

[0486] A single modification type does not modify more than two consecutive nucleotides.

[0487] The oligomeric compound of embodiment 7, wherein 3'Z is a UU or TT overhang.

[0488] The oligomeric compound of embodiment 7, wherein the modification to the nucleotide is selected from the group consisting of deoxyribonucleosides (DNA nucleosides) substituted ribonucleosides, locked nucleic acids (LNA), 2'-OMe, 2'-F, unlocked nucleic acids (UNA), and combinations thereof.

[0489] The oligomeric compound of embodiment 7, wherein the antisense strand comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0490] The oligomeric compound of embodiment 7, wherein the antisense strand comprises phosphorothioate (PS) internucleotide linkage modifications between positions 1-2, 2-3, 19-20, and 20-21 from the 5' end of the antisense strand.

[0491] The oligomeric compound of embodiment 7, wherein the antisense strand comprises phosphorothioate internucleotide (PS) linkages adjacent to the two nucleosides at the 5' end of the strand and / or adjacent to the two nucleosides at the 3' end of the strand.

[0492] Embodiment 8 of the present invention includes an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising:

[0493] a) a sense strand having 19 to 23 linked nucleotides, wherein the sense strand sequence is represented by formula (I):

[0494] 5'M-(Y)nZ-(Y)rDD 3'

[0495] b) an antisense strand having 19 to 23 linked nucleotides, wherein the antisense strand sequence is represented by formula (IX):

[0496] 5'LM-(Y)pZ-(Y)p-(Z)r 3', and

[0497] c) a duplex formed by a sense strand and an antisense strand,

[0498] in

[0499] D is a deoxyribonucleoside,

[0500] M is a 2'-OMe modified nucleoside,

[0501] L is 5' phosphate, 5' vinylphosphonate or 5' OH,

[0502] Y is two adjacent nucleosides having different modifications or a modified nucleoside adjacent to an unmodified nucleoside,

[0503] Z is two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides,

[0504] n is 6-8,

[0505] p is 3-5,

[0506] r is 1-2,

[0507] wherein the duplex region is 19 to 23 nucleotide pairs in length, and

[0508] A single modification type does not modify more than two consecutive nucleotides.

[0509] The oligomeric compound of embodiment 8, wherein the 3'Z in the antisense strand is a UU or TT overhang.

[0510] The oligomeric compound of embodiment 8, wherein -DD in the sense strand is a TT or TA overhang.

[0511] The oligomeric compound of embodiment 8, wherein the modification to the nucleotide is selected from the group consisting of deoxyribonucleosides (DNA nucleosides) substituted ribonucleosides, locked nucleic acids (LNA), 2'-OMe, 2'-F and unlocked nucleic acids (UNA), or a combination thereof.

[0512] The oligomeric compound of embodiment 8, wherein each chain comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0513] The oligomeric compound of embodiment 8, wherein the antisense strand comprises phosphorothioate (PS) internucleotide linkage modifications between positions 1-2, 2-3, 19-20, and 20-21 from the 5' end of the antisense strand.

[0514] The oligomeric compound of embodiment 8, wherein the chain comprises phosphorothioate internucleotide (PS) linkages adjacent to the two nucleosides at the 5' end of the chain and / or adjacent to the two nucleosides at the 3' end of the chain.

[0515] Embodiment 9 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (X):

[0516] 5'MFMMNMNMFFNMNMNMMNMDD 3',

[0517] in

[0518] D is a deoxyribonucleoside,

[0519] M is a 2'-OMe modified nucleoside,

[0520] N is a modified nucleoside or an unmodified nucleoside,

[0521] F is a 2'-F modified nucleoside, and

[0522] A single modification type does not modify more than two consecutive nucleotides.

[0523] The oligomeric compound of embodiment 9, wherein N can be ribonucleoside (R), deoxyribonucleoside (D), 2'-OMe, 2'-MOE, 2'-F, unlocked nucleic acid (UNA) or locked nucleic acid (LNA).

[0524] The oligomeric compound of embodiment 9, wherein each chain comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0525] Embodiment 10 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VIII):

[0526] 5'L-MNMNMFNMFMMNMFMFMM 3',

[0527] in

[0528] D is a deoxyribonucleoside,

[0529] M is a 2'-OMe modified nucleoside,

[0530] N is a modified nucleoside or an unmodified nucleoside,

[0531] F is a 2'-F modified nucleoside, and

[0532] L is 5' phosphate, 5' vinylphosphonate or 5' OH, and

[0533] A single modification type does not modify more than two consecutive nucleotides.

[0534] The oligomeric compound of embodiment 10, wherein N can be ribonucleoside (R), deoxyribonucleoside (D), 2'-OMe, 2'-MOE, 2'-F, unlocked nucleic acid (UNA) or locked nucleic acid (LNA).

[0535] The oligomeric compound of embodiment 10, wherein each chain comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0536] Embodiment 11 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising:

[0537] a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (X):

[0538] 5'MFMMNMNMFFNMNMNMMNMDD 3'

[0539] b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VIII):

[0540] 5'L-MNMNMFNMFMMNMFMFMM 3', and

[0541] c) a duplex formed by a sense strand and an antisense strand,

[0542] in

[0543] D is a deoxyribonucleoside,

[0544] M is a 2'-OMe modified nucleoside,

[0545] N is a modified nucleoside or an unmodified nucleoside,

[0546] F is a 2'-F modified nucleoside, and

[0547] L is 5' phosphate, 5' vinylphosphonate or 5' OH, and

[0548] The length of the duplex region is 19 nucleotide pairs.

[0549] wherein each strand has a 2 nucleotide overhang at the 3' end, and

[0550] A single modification type does not modify more than two consecutive nucleotides.

[0551] The oligomeric compound of embodiment 11, wherein N can be ribonucleoside (R), deoxyribonucleoside (D), 2'-OMe, 2'-MOE, 2'-F, unlocked nucleic acid (UNA) or locked nucleic acid (LNA).

[0552] The oligomeric compound of embodiment 11, wherein each chain comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0553] Embodiment 12 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising a sense strand having about 21 linked nucleotides, wherein the sense strand sequence is represented by formula (XI):

[0554] 5'MFMMNMNMFFMMNMNMMFMDD 3',

[0555] in

[0556] D is a deoxyribonucleoside,

[0557] M is a 2'-OMe modified nucleoside,

[0558] N is a modified nucleoside or an unmodified nucleoside,

[0559] F is a 2'-F modified nucleoside, and

[0560] A single modification type does not modify more than two consecutive nucleotides.

[0561] The oligomeric compound of embodiment 12, wherein N can be ribonucleoside (R), deoxyribonucleoside (D), 2'-OMe, 2'-MOE, 2'-F, unlocked nucleic acid (UNA) or locked nucleic acid (LNA).

[0562] The oligomeric compound of embodiment 12, wherein each chain comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0563] Embodiment 13 of the present invention comprises an oligomeric compound capable of inhibiting the expression of a target nucleic acid, comprising an antisense strand having about 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (XII):

[0564] 5'L-MDMFMFNMFMMFMFMMMNMM 3',

[0565] in

[0566] D is a deoxyribonucleoside,

[0567] M is a 2'-OMe modified nucleoside,

[0568] N is a modified nucleoside or an unmodified nucleoside,

[0569] F is a 2'-F modified nucleoside, and

[0570] L is 5' phosphate, 5' vinylphosphonate or 5' OH, and

[0571] A single modification type does not modify more than two consecutive nucleotides.

[0572] The oligomeric compound of embodiment 13, wherein N can be ribonucleoside (R), deoxyribonucleoside (D), 2'-OMe, 2'-MOE, 2'-F, unlocked nucleic acid (UNA) or locked nucleic acid (LNA).

[0573] The oligomeric compound of embodiment 13, wherein each chain comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0574] Embodiment 14 of the present invention comprises an oligomeric compound capable of inhibiting or suppressing the expression of a target nucleic acid, comprising:

[0575] a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (XI):

[0576] 5'MFMMNMNMFFMMNMNMMFMDD 3',

[0577] b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (XII):

[0578] 5'L-MDMFMFNMFMMFMFMMMNMM 3', and

[0579] c) a duplex formed by a sense strand and an antisense strand,

[0580] in

[0581] D is a deoxyribonucleoside,

[0582] M is a 2'-OMe modified nucleoside,

[0583] N is a modified nucleoside or an unmodified nucleoside,

[0584] F is a 2'-F modified nucleoside, and

[0585] L is 5' phosphate, 5' vinylphosphonate or 5' OH, and

[0586] The length of the duplex region is 19 nucleotide pairs.

[0587] wherein each strand has a 2 nucleotide overhang at the 3' end, and

[0588] A single modification type does not modify more than two consecutive nucleotides.

[0589] The oligomeric compound of embodiment 14, wherein N can be ribonucleoside (R), deoxyribonucleoside (D), 2'-OMe, 2'-MOE, 2'-F, unlocked nucleic acid (UNA) or locked nucleic acid (LNA).

[0590] The oligomeric compound of embodiment 14, wherein each chain comprises at least one phosphorothioate internucleotide (PS) bond. In addition, the phosphorothioate internucleotide (PS) bond is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

[0591] The oligomeric compound of any preceding embodiment, wherein the FFNM motif occurs at or near the cleavage site of the sense strand, optionally wherein FFNM is FFMM or FFRM, and wherein F is 2'-fluoro, N is a modified nucleoside or an unmodified nucleoside, R is a ribonucleoside and M is 2'-OMe.

[0592] The oligomeric compound of any preceding embodiment, wherein the FMM motif occurs at or near the cleavage site of the antisense strand, and wherein F is 2'-fluoro and M is 2'-OMe.

[0593] The oligomeric compound of any preceding embodiment, wherein the oligomeric compound is single-stranded or double-stranded.

[0594] The oligomeric compound of any preceding embodiment, wherein the single-stranded oligomeric compound is a single-stranded oligonucleotide, microRNA (miRNA), or single-stranded RNA (ssRNA).

[0595] The oligomeric compound of any preceding embodiment, wherein the double-stranded oligomeric compound is shRNA or siRNA.

[0596] The oligomeric compound of any of the foregoing embodiments further comprises a conjugate. The conjugate can be selected from cholesterol, lipids, carbohydrates, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, peptides and dyes. In a preferred embodiment, the conjugate is N-acetylgalactosamine (GalNAc). The conjugate can be attached to the 3' end of the sense strand of the oligomeric compound.

[0597] The oligomeric compound of any preceding embodiment, wherein the compound inhibits expression of the target nucleic acid by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

[0598] Embodiments of the present invention include pharmaceutical compositions comprising the oligomeric compound of any of the foregoing embodiments, alone or in combination with a pharmaceutically acceptable carrier or excipient.

[0599] Embodiments of the present invention include methods of inhibiting expression of a target nucleic acid in a subject, the method comprising the step of administering to the subject an amount of an oligomeric compound of any of the foregoing embodiments sufficient to inhibit expression of the target nucleic acid. The oligomeric compound can be administered to the subject subcutaneously or intravenously.

[0600] An embodiment of the present invention comprises a process for preparing the oligomeric compound of any one of the preceding claims, the process comprising the steps of:

[0601] a. Synthesis of sense-strand oligonucleotides on a solid support using phosphoramidite chemistry

[0602] b. synthesizing antisense oligonucleotides on a solid support using phosphoramidite chemistry; and

[0603] c. Annealing the two oligonucleotides synthesized in this way

[0604] Thus, an oligomeric compound is prepared.

[0605] Advantages of the present invention

[0606] The field of oligomeric therapeutic compounds is still maturing, and improvements in delivery, stability, specificity, safety, and potency are still being sought to enhance the therapeutic efficacy of oligomeric compounds. Three general aspects of oligomer design that require improvement (in no particular order) are: 1) the sequence of the oligomeric compound, 2) the chemical modification of the oligomeric compound, and 3) the mode of delivery of the oligomeric compound. The importance of these three aspects is reflected in the progress of oligomeric compounds, which led to the development of the most recent FDA-approved siRNA therapeutic, votrisiran. Alnylam, the developer of votrisiran, has three versions of its TTR-targeting siRNA (patisiran, revusiran, and votrisiran) in clinical trials.

[0607] The first siRNA developed to target TTR was Patisiran (also known as Onpattro TM ), some of which are chemically modified nucleosides scattered along the 21-nucleotide-long sense and antisense strands that form the siRNA duplex to stabilize the siRNA and increase the inhibitory potency against unmodified siRNAs with the same nucleotide sequence (Friedrich and Aigner, TherapeuticsiRNA: State-of-the-Art and Future Perspectives, 2022, BioDrugs, 36(5):549-571). Patisiran has been approved by the FDA as the first siRNA therapeutic drug of its kind.

[0608] The second siRNA developed targeting TTR is Revusiran. Although Revusiran also targets TTR, new sequences, additional modified nucleosides, modified internucleoside bonds, and N-acetylgalactosamine (GalNAc) conjugates are introduced into this siRNA. However, during the Phase 3 clinical trial, due to the imbalance in mortality among trial patients, Revusiran treatment was stopped early, and the trial was terminated (Judge et al., Phase 3 Multicenter Study of Revusiran in Patients with Hereditary Transthyretin-Mediated (hATTR) Amyloidosis with Cardiomyopathy (ENDEAVOUR), Cardiovascular Drugs and Therapy, 2020, 34: 357–370). Ultimately, the Revusiran program was terminated.

[0609] The third siRNA developed to target TTR is vutrsilan (also known as ALN-TTRSC02 and Amvuttra TM ) and combined the sequence of Amvuttra with additional chemical modifications and GalNAc conjugate delivery methods (Janas et al., Safety evaluation of 2'-deoxy-2'-fluoro nucleotides in GalNAc-siRNA conjugates, Nucleic Acids Research, 2019, 47(7): 3306–3320). Compared to patisilan, the chemical modification of votrisilan makes it sufficiently stable to allow for a more favorable dosing regimen and administration method: 25 mg of votrisilan is administered to patients by subcutaneous injection once every three months, compared to 0.3 mg / kg of patisilan administered to patients by intravenous infusion once every three weeks. Vuttrasilan received FDA approval after positive data from a Phase 3 clinical trial (HELIOS-A) showed that votrisilan significantly improved the signs and symptoms of polyneuropathy (Alnylam PressRelease in Businesswire, Alnylam Announces FDA Approval of Amvuttra TM (Vu Trisilan), RNAi therapeutics for the treatment of polyneuropathy associated with hereditary transthyretin-mediated amyloidosis in adults, June 2022).

[0610] Thus, the history of TTR siRNA development demonstrates the importance of the oligomeric compound sequence, the type of chemical modification, the pattern of chemical modification, and the delivery system of the oligomeric compound.

[0611] Disclosed herein are carefully designed chemical modification motifs for oligomeric compounds, Advanced RNA Targeting (ARNATAR). Without being bound by any particular theory, chemical modification motifs, regardless of sequence, improve the stability, specificity, safety, and efficacy of oligomeric compounds. The specific chemical modification motifs of the present invention are used in combination with target sequence selection and delivery methods to form effective oligomeric therapeutic compounds.

[0612] Without being bound by any particular theory, the ARNATAR designed oligomeric compounds disclosed herein optimize the properties of the chemically modified motifs, such as duplex annealing temperature, RISC loading speed, stability, specificity, safety, and efficacy.

[0613] In certain embodiments, ARNATAR-designed oligomeric compounds with lower annealing temperatures and faster RISC loading rates may result in faster-acting therapeutic compounds that are beneficial for acute conditions requiring rapid relief following administration.

[0614] In certain embodiments, the oligomeric compounds designed by ARNATAR result in more stable and longer-lasting therapeutic compounds, thereby providing longer-lasting benefits for acute and chronic conditions and / or reducing the frequency of dosing of the therapeutic compound.

[0615] In certain embodiments, ARNATAR-designed oligomeric compounds have enhanced binding, regardless of the sequence of the oligomeric compound based on the modified motif. This enhanced binding to the target nucleic acid allows for the production of therapeutic compounds with enhanced specificity and safety due to fewer off-target effects. In addition, the ARNATAR motif is designed to produce therapeutic compounds that are less toxic and safer.

[0616] In certain embodiments, the oligomeric compounds designed by ARNATAR are designed to be very potent inhibitors of target nucleic acids. This potency allows for the administration of less oligomeric compound to achieve therapeutic efficacy, resulting in less overall toxicity of any oligomeric compound after administration. Furthermore, less compound is required for therapeutic doses, reducing production costs.

[0617] In certain embodiments, the oligomeric compounds designed by ARNATAR are very potent inhibitors of target nucleic acids. High potency is achieved to reduce target nucleic acids in tissues other than the liver.

[0618] Therefore, there is a need for improved oligomeric compounds to treat diseases. ARNATAR oligomeric compounds are designed to increase speed, stability, specificity, safety and efficacy to produce improved therapeutic compounds.

[0619] Example

[0620] Non-Limiting Disclosure and Incorporation by Reference

[0621] Although certain compounds, compositions and methods described herein have been specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to limit them. Each reference cited in this application is incorporated herein by reference in its entirety.

[0622] When the following table shows an unmodified sequence ("Sequence") and a modified sequence ("Sequence+Chemistry") on the same line, the corresponding SEQ ID NO applies to the modified sequence. For example, SEQ ID NO: 16 in Table 3 represents the modified sequence mG*mC*mGmUmCmAfCmCfAfAfAmAmAmGmCmGmCmAmA*T*T.

[0623] Example 1: Design of LMNA siRNA with different sense strand modifications

[0624] Laminin (LMNA) was chosen as a target for testing various advanced RNA targeting (ARNATAR) designs. A region of laminin (LMNA) with conserved sequence between humans and mice was identified, and oligomeric compounds were targeted to a 19nt long sequence (SEQ ID NO: 1) in this homologous region.

[0625] Table 1: LMNA target sequences

[0626] name Justice or Antonym Sequence (5' to 3') SEQ ID NO: LMNA DNA target sequence justice GCGTCACCAAAAAGCGCAA 1 LMNA RNA target sequence justice GCGUCACCAAAAAGCGCAA 2

[0627] siRNAs are designed to target the LMNA mRNA target sequence (SEQ ID NO: 2) and contain two nucleotide overhangs at the 3' end of the chain: TT (SEQ ID NO: 3-4) or UU (SEQ ID NO: 5). All antisense strands have 5'-phosphates. Each nucleotide is preceded by a symbol indicating the type of chemical modification of the nucleotide (if any). If there is no modification symbol before the letter of the designated nucleotide, the nucleotide is a deoxyribonucleotide. The symbols for the chemical modifications of the chain are as follows:

[0628] (5p) = 5'-phosphate

[0629] r = ribonucleotide (e.g., rA represents adenosine)

[0630] d (or no symbol before the nucleotide) = a deoxyribonucleotide substituted with a ribonucleotide (e.g., dA or A represents 2'-deoxyadenosine)

[0631] f=2'-F (i.e., represents a 2'-fluoro modified nucleoside, for example, fA represents 2'-fluoroadenosine)

[0632] m=2'-OMe (i.e., represents a 2'-O-methyl modified nucleoside, for example, mA represents 2'-O-methyladenosine)

[0633] gna = glycol nucleic acid (e.g., gnaT represents 2,3-dihydroxypropylthymine)

[0634] p = phosphate

[0635] * = phosphorothioate (PS) linkage (i.e., indicates the presence of a 5'-phosphorothioate (= 5'-phosphorothioate) rather than a 5'-phosphate, e.g., *A indicates 2'-deoxyadenosine 5'-phosphorothioate, *rA indicates adenosine 5'-phosphorothioate, and *mA indicates 2'-O-methyladenosine 5'-phosphorothioate)

[0636] GA=GalNAc (GA1=GalNAc1, GA2=GalNAc2 and GA3=GalNAc3 are specific GalNAc conjugates described herein)

[0637] A list of LMNA siRNA sequences can be found in the table below or in Figures 1-2.

[0638] Cell cultures were grown to approximately 60-80% confluence, and then different doses of siRNA were transfected into the cells using RNAiMAX (InVitrogen, Waltham, MA) according to the manufacturer's recommended protocol, and the cells were further cultured for a period of time. siRNA activity was determined by measuring target mRNA levels by qRT-PCR using the LMNA primer probe set listed in Table 2. AgPath-ID TM One-step RT-PCR reagents were used to perform qRT-PCR in a QS3 real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA). The target RNA levels detected in the qRT-PCR assay were normalized to those detected with Ribogreen. TM Total RNA levels were measured by RT-PCR (ThermoFisher Scientific, Waltham, MA, USA) or GAPDH mRNA levels were detected in RNA sample aliquots using qRT-PCR.

[0639] Table 2: Human and mouse LMNA primer-probe sets

[0640] Primer name Primer sequence (5' to 3') SEQ ID NO: hsLMNA-S CGGGTGGATGCTGAGAAC 3 hsLMNA-A TGCTTCCCATTGTCAATCTCC 4 hsLMNA-P AGTGAGGAGCTGCGTGAGACCAA 5 msLMNA-S GGACCAGGTGGAACAGTATAAG 6 msLMNA-A TCAATGCGGATTCGAGACTG 7 msLMNA-P CAGCTTGGCGGAGTATGTCTTTTCTAGC 8

[0641] A. Minimal positive strand modification enhances siRNA activity

[0642] As shown in Table 3, LMNA-si1 is an siRNA with a TT overhang attached to an unmodified nucleotide sequence targeting LMNA. LMNA-si2 is a modified siRNA in which the chemical modification pattern reflects the chemical modification pattern of the FDA-approved siRNA Lumasilan, except that the sense strand of LMNA-si2 has an additional TT overhang connected by a PS bond and does not have a GalNAc conjugate, and the antisense strand is 21 nt with a TT overhang instead of 23 nt long. LMNA-si3 has a modified sense strand and an antisense strand, the antisense strand having a TT overhang attached to an unmodified ribonucleotide sequence. LMNA-si4 has a sense strand and a modified antisense strand, the sense strand having a TT overhang attached to an unmodified ribonucleotide sequence. In this example, all antisense strands have 5'-phosphates.

[0643] Table 3: LMNA oligomeric compounds

[0644]

[0645]

[0646] 0-10 nM final concentration of siRNA was transfected into HeLa cells (ATCC, Manassas, VA, USA) using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours. siRNA activity was determined by qRT-PCR using the LMNA primer probe set in Table 2, and the half-maximal inhibitory concentration (IC50) of siRNA targeting LMNA was calculated (Table 4).

[0647] Table 4: LMNA siRNA inhibition in HeLa cells after 24 hours

[0648] LMNA-si1 LMNA-si2 LMNA-si3 LMNA-si4 IC50(nM) 0.094 5.664 12.22 0.095 multiple 60.0 1.00 0.5 59.7

[0649] LMNA-si2 was used as a benchmark for activity. Results showed that LMNA-si1 and LMNA-si4, which had minimal modifications to the sense strand, exhibited higher potency than LMNA-si2 and LMNA-si3, suggesting that reducing modifications to the sense strand improves siRNA activity.

[0650] B. Add peripheral sense strand modifications to protect siRNA

[0651] The above-mentioned previous studies have shown that reducing the modification of the siRNA sense strand increases the siRNA activity 24 hours after transfection. However, siRNA needs to be metabolically stable to maintain longer-lasting activity in vivo. Some chemical modifications have been able to improve this stability without compromising activity (Choung et al., Biochem Biophys Res Commun, 2006, 342: 919–927). Therefore, the 3' and / or 5' ends of the LMNA-si4 sense strand were strategically modified with 2'-OMe to determine whether these modifications affect siRNA activity over time. In addition, the effects of mUmU or TT overhangs at the 3' end of the sense strand were also evaluated. In this example, all antisense strands have 5'-phosphates.

[0652] Table 5: LMNA oligomeric compounds with peripheral modifications of the sense strand

[0653]

[0654]

[0655] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 6).

[0656] Table 6: LMNA siRNA inhibition in HeLa cells after 24 hours

[0657] IC50(nM) multiple LMNA-si2 5.781 1.0 LMNA-si5 0.088 65.7 LMNA-si6 0.039 149.1 LMNA-si7 0.084 68.7 LMNA-si8 0.051 113.2 LMNA-si9 0.075 77.4 LMNA-si10 0.236 24.5 LMNA-si11 0.155 37.3 LMNA-si12 0.188 30.8 LMNA-si13 0.123 47 LMNA-si14 0.097 59.8 LMNA-si15 8.336 0.7

[0658] All siRNAs with modifications to the 3' and 5' sense strands were more active than LMNA-si2. However, adding more 2'-OMe beyond the 3' and 5' edges of the sense strand did not boost siRNA activity, as LMNA-si15 had most of its sense strand modified, making it the least active siRNA. 2'-OMe modification of the 5' end of the sense strand resulted in siRNAs more active than those with modifications to the 3' end (compare LMNA-si6 and LMNA-si7, LMNA-si9 and LMNA-si10). The absence of a PS bond at the 5' end of the sense strand resulted in siRNAs more active than those with three PS bonds added to the 5' end of the sense strand (compare LMNA-si12 and LMNA-si8). mUmU did not significantly differ in activity relative to the TT overhang.

[0659] Selected siRNAs were further tested in cell culture and in different cell types for longer periods of time: LMNA-si2, LMNA-si8, LMNA-si12, and LMNA-si14.

[0660] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours and 72 hours. siRNA was also transfected into HEK293 cells (ATCC, Manassas, VA, USA) using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours and 120 hours. siRNA activity was determined by qRT-PCR using the primer probe sets in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 7).

[0661] Table 7: LMNA siRNA inhibition in HeLa or HEK293 cells

[0662]

[0663] Tables 6-7 show that modifications in the sense strand of siRNA can increase siRNA activity in different cell types and over different time periods.

[0664] C. Additional Sense Strand Modification to Protect siRNA

[0665] The above previous studies have shown that peripheral modification of the siRNA sense strand improves siRNA activity. The sense strand of LMNA-si4 was additionally strategically modified with 2'-OMe to determine whether additional modifications affect siRNA activity over time (Table 8). The goal was to increase 2'-OMe modifications in the sense strand to improve stability without affecting potency. In this example, all antisense strands had 5'-phosphates.

[0666] Table 8: LMNA oligomeric compounds with additional 2'-OMe sense strand modifications

[0667]

[0668]

[0669] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours. 0-10 nM siRNA was transfected into HEK293 cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 48 hours. siRNA activity was determined by qRT-PCR using the primer probe sets in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 9).

[0670] Table 9: LMNA siRNA inhibition in HeLa or HEK293 cells

[0671]

[0672] The activity of a subset of siRNAs with stronger activity and more 2'-OMe-modified nucleotides in the sense strand was further tested: LMNA-si27 (sense strand ATXL052), LMNA-si28 (sense strand ATXL053).

[0673] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours or 72 hours. 0-10 nM siRNA was transfected into HEK293 cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 72 hours. siRNA activity was determined by qRT-PCR using the primer probe sets in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 10).

[0674] Table 10: LMNA siRNA inhibition in HeLa or HEK293 cells

[0675]

[0676] LMNA-si27 is more effective than LMNA-si28 due to the difference in the modification of the sense strand.

[0677] Example 2: Design of LMNA siRNA with different antisense strand modifications

[0678] In Example 1 above, the siRNA antisense strand remained unchanged, while the sense strand underwent various chemical modifications to identify motifs that would confer stability and potency to the siRNA. In this example, the siRNA sense strand remained unchanged, while the antisense strand underwent various modifications. The antisense strand modified from LMNA-si2 was used as a template from which individual nucleotides were modified. Nucleotide positions are counted from the 5' end of the strand; the 5'-most nucleotide is position 1.

[0679] Without being bound by any particular theory, it has been previously demonstrated that 2'-F modification can increase the melting temperature (Tm) of RNA duplexes more than 2'-OMe modification (B Bramsen and Kjems, 2012, Frontiers in Genetics, 3(154): 1-22), and that deoxyribonucleotides that further reduce Tm compared to 2'-OMe at certain positions can be tolerated by RISC (Ui-Tei, et al., Nucl Acids Res, 2008, 36(7): 2136-51). Therefore, we varied the amount of 2'-F modification and incorporated deoxyribonucleotides at certain positions and evaluated the effect of this modification pattern on siRNA activity.

[0680] As shown in Table 11, in some antisense strands: nucleotide 2 was modified from a ribonucleotide with a 2'-F modification to a deoxyribonucleotide; nucleotide 7 was modified from a ribonucleotide with a 2'-OMe modification to a deoxyribonucleotide; the 2'-F modification at nucleotide 8 was changed to a 2'-OMe modification; nucleotide 16 was modified from a ribonucleotide with a 2'-F modification to a deoxyribonucleotide; PS bonds were added to link deoxyribonucleotides to some adjacent ribonucleotides to determine whether the PS bond has a protective effect on the deoxyribonucleotide; and the TT overhang at the 3' end of the antisense strand was replaced by an mUmU overhang.

[0681] Table 11: LMNA oligomeric compounds with antisense strand modifications

[0682]

[0683] In two sets of experiments, 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours. siRNA activity was determined by qRT-PCR using the primer probe sets in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 12).

[0684] Table 12: LMNA siRNA inhibition in HeLa cells

[0685]

[0686]

[0687] Results after 24 hours showed that changing the nucleotide at position 7 to a deoxyribonucleotide increased the activity of LMNA-si18, LMNA-si19, LMNA-si20, LMNA-si21, and LMNA-si22. The activities of LMNA-si16, LMNA-si17, LMNA-si18, LMNA-si21, and LMNA-si22 showed that changes to the deoxyribonucleotide at position 2 or 16 were tolerated.

[0688] In two sets of experiments, 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 72 hours. siRNA activity was determined by qRT-PCR using the primer probe sets in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 13).

[0689] Table 13: LMNA siRNA inhibition in Hela cells

[0690]

[0691] At the 72 h time point, LMNA-si20 and LMNA-si21 showed optimal activity.

[0692] Example 3: Design of LMNA siRNA with different modifications of the sense and antisense strands

[0693] The modified sense and antisense strands disclosed in the previous examples were mixed and matched to form new siRNA compounds (Table 14), and their stability and activity were evaluated (Table 15).

[0694] Table 14: LMNA oligomeric compounds with double-stranded modifications

[0695]

[0696]

[0697] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours, 96 hours, or 144 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of the siRNA targeting LMNA was calculated (Table 15).

[0698] Table 15: LMNA siRNA inhibition in HeLa cells

[0699]

[0700] When used as a siRNA compound, the sense strand ATXL052 was more effective than ATXL053. The antisense strands ATXL045 and ATXL046 were more effective than ATXL043. LMNA-si31 and LMNA-si33 showed the best activity over time.

[0701] 0-10 nM siRNA was transfected into HEK293 cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 96 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 16).

[0702] Table 16: LMNA siRNA inhibition in HEK293 cells

[0703]

[0704] Similar to the results in HeLa cells, the positive chain ATXL052 had higher activity than ATXL053. The activities of LMNA-si31 and LMNA-si33 were higher than the others.

[0705] 0-10 nM siRNA was transfected into mouse HePa1-6 cells (ATCC, Manassas, VA, USA) using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours, 72 hours, or 120 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of the siRNA targeting LMNA was calculated (Table 17).

[0706] Table 17: LMNA siRNA inhibition in mouse HePa1-6 cells

[0707]

[0708] They found that in mouse cells, LMNA-si31 was more effective than other compounds, while LMNA-si29 and LMNA-si33 were more effective than the benchmark LMNA-si2.

[0709] Serum stability assay

[0710] LMNA-si2, LMNA-si29, and LMNA-si33 were exposed to human serum to test stability. siRNA was incubated with human serum (Sigma-Aldrich, St. Louis, MO, USA) at a concentration of 0.4 uM at 37°C for the desired time (0 h, 8 h, 16 h, and 24 h). Then, Blue Juice was added. TM Gel loading buffer (ThermoFisher Scientific, Waltham, MA, USA) was added and the siRNA mixture was loaded onto a 4-20% native TBE gel (ThermoFisher Scientific, Waltham, MA, USA). TM The cells were stained with PTFE Gold (ThermoFisher Scientific, Waltham, MA, USA) at room temperature for 10 min and imaged under UV light.

[0711] After 24 hours of serum treatment, the siRNA compounds were found to be stable (Figure 6).

[0712] Example 4: Design of ApoC3 siRNA with different sense and antisense strand modifications

[0713] Based on the previous studies of LMNA described above, some chemical modifications that confer high activity were evaluated in different targets to determine whether chemical modification motifs were also beneficial. ApoC3 was selected as the second test target, and siRNA was designed as shown in Table 18 and Figures 3-4 to target the 19nt long sequence of human ApoC3: CUCUGAGUUCUGGGAUUUG (SEQ ID NO: 177). The human ApoC3 primer probe set used for RT-PCR is shown in Table 19. ApoC3-si1 is a modified siRNA in which the chemical modification pattern reflects that of Lumasilan, except that the sense strand of ApoC3-si1 has an additional TT overhang connected by a PS bond and does not have a GalNAc conjugate, and the antisense strand is 21nt instead of 23nt. All antisense strands have 5'-phosphates. The activity of the modified siRNA has been tested in several cell lines.

[0714] Table 18: ApoC3 oligomeric compounds with double-stranded modifications

[0715]

[0716]

[0717] Table 19: ApoC3 primer probe set sequences

[0718] name sequence SEQ ID NO: ApoC3-F AGGGTTACATGAAGCACGC 9 ApoC3-R AGAGAACTTGTCCTTAACGGTG 10 ApoC3-P AGGGAACTGAAGCCATCGGTCAC 11

[0719] 0-10 nM siRNA was transfected into Hep3B cells (ATCC, Manassas, VA, USA) using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 20 hours, 60 hours, or 168 hours. siRNA activity was determined by measuring target mRNA levels by qRT-PCR using the primer probe sets in Table 19, and the IC50 of siRNA targeting ApoC3 was calculated (Table 20). AgPath-ID TM qRT-PCR was performed using a one-step RT-PCR reagent in a QS3 real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The target RNA levels detected in the qRT-PCR assay were normalized to those detected using Ribogreen. TM Total RNA levels were measured by RT-PCR (ThermoFisher Scientific, Waltham, MA, USA) or GAPDH mRNA levels were detected in RNA sample aliquots using qRT-PCR.

[0720] Table 20: ApoC3 siRNA inhibition in Hep3B cells

[0721]

[0722] 0-10 nM siRNA was transfected into HepG2 cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 or 72 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of siRNA targeting ApoC3 was calculated (Table 21).

[0723] Table 21: ApoC3 siRNA inhibition in HepG2 cells

[0724]

[0725] When novel chemical modification motifs originally designed with LMNA-targeting siRNAs were used to modify ApoC3-targeting siRNAs, enhanced activity was generally produced, regardless of the target or siRNA sequence.

[0726] Example 5: Design of additional LMNA siRNAs with different PS bonds and 2'-F in the sense and antisense strands

[0727] Based on the above studies on LMNA and ApoC3, which showed that some chemical modification patterns conferred high activity, additional chemical modification patterns were designed and evaluated for LMNA to determine if new motifs would also be beneficial. The ATXL046 motif served as the basis for adding or altering chemical modifications to the antisense strand. Some additional modifications that may be included in new LMNA siRNAs include replacing ribonucleotides with more deoxyribonucleotides, reducing PS bonds, reducing 2'F, and adding more 2'-OMe. The ATXL052 motif served as the basis for adding or altering chemical modifications to the sense strand. Some additional modifications include adding PS bonds to the non-cleavage site or adding PS bonds to all nucleotides. See Table 22 below. All antisense strands have 5'-phosphates.

[0728] Table 22: LMNA oligomeric compounds with double-stranded modifications

[0729]

[0730]

[0731] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 20 hours. 0-10 nM siRNA was transfected into HEK293 cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 48 hours. siRNA activity was determined by qRT-PCR using the primer probe sets in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 23).

[0732] Table 23: LMNA siRNA inhibition in HeLa or HEK293 cells

[0733]

[0734] The sense strand cleavage site is located between the central nucleotides of the sense strand. Adding a PS bond to the central nucleotides of the sense strand inhibited activity (LMNA-si41), while adding a PS bond outside the central cleavage site increased activity (LMNA-si40). Introducing two PS deoxyribonucleotides at positions 6 and 7 of the antisense strand had no beneficial effect on activity (see LMNA-si37). Selected siRNAs were further tested in another cell line for a longer period of time.

[0735] 0-10 nM siRNA was transfected into Hepa1-6 cells using RNAiMAX (Invitrogen, Waltham, MA) and the cells were further cultured for 24 or 72 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of the siRNA targeting LMNA was calculated (Table 24).

[0736] Table 24: LMNA siRNA inhibition in Hepa1-6 cells

[0737]

[0738] In Hepa1-6 cells, LMNA-si39 and LMNA-si31 had similar activities over time, but LMNA-si38 had poorer activity than LMNA-si31, and LMNA-si40 had slightly poorer activity.

[0739] Example 6: Additional modifications to increase the stability of the sense strand

[0740] Additional chemical modification patterns were designed for LMNA and evaluated to determine whether the new motifs were beneficial. The motif of ATXL046 is the basis for adding or changing the chemical modifications of the antisense strand. The new modification changes the number of PS bonds and adds 2'-F to the central nucleotide of the sense strand (Table 25). All antisense strands have 5'-phosphates.

[0741] Table 25: LMNA oligomeric compounds with double-stranded modifications

[0742]

[0743] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 26).

[0744] Table 26: LMNA siRNA inhibition in HeLa cells

[0745]

[0746]

[0747] 0-10 nM siRNA was transfected into HEK293 cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 48 hours and 120 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 27).

[0748] Table 27: LMNA siRNA inhibition in HEK293 cells

[0749]

[0750] All of the newly designed siRNAs in this example showed improved activity and longer duration compared to the benchmark siRNA LMNA-si2. LMNA-si39, LMNA-si47, LMNA-si49, and LMNA-si51 all had good activity and duration in different cell types. The activity of selected siRNA designs was re-evaluated over even longer time periods.

[0751] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for different periods of time. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of the siRNA targeting LMNA was calculated (Table 28).

[0752] Table 28: LMNA siRNA inhibition in HeLa cells

[0753]

[0754]

[0755] When evaluated at the longest time point of 168 hours, the results showed that LMNA-si47 and LMNA-si51 were the most active, while LMNA-si31 was also very active. The ARNATAR-designed compounds showed a faster onset of activity than the benchmark LMNA-si2 and maintained higher activity at later time points.

[0756] Stability assays were performed on LMNA-si31, LMNA-si47, LMNA-si49, and LMNA-si51. The first assay tested the stability of the compounds by mixing the siRNA with human serum and exposing them to human serum. The second assay tested the stability of the compounds by exposing them to rat trisomy 1 (Figs. 7-8). The test compounds were found to have comparable stability compared to the benchmark, LMNA-si2.

[0757] Serum stability assay

[0758] siRNA was incubated with human serum (Sigma-Aldrich, St. Louis, MO, USA) at a concentration of 0.4 μM at 37° C. for the desired time (0 h, 4 h, 8 h, and 24 h). TM Gel loading buffer (ThermoFisher Scientific, Waltham, MA, USA) was added and the siRNA mixture was loaded onto a 4-20% native TBE gel (ThermoFisher Scientific, Waltham, MA, USA). TM The cells were stained with PTFE Gold (ThermoFisher Scientific, Waltham, MA, USA) at room temperature for 10 min and imaged under UV light ( FIG8 ).

[0759] Trisomy stability assay

[0760] The trisomic stability assay described here is based on the assay of Weingartner et al. (Molecular Therapy, Nucleic Acids, 2020, 21: 242-250, which is incorporated herein by reference). siRNA was incubated in rat liver trisomic (R0610.LT; XenoTech, Kansas City, KS, USA) for 0 h, 4 h, 24 h, or 72 h. To simulate an acidified environment, trisomic lysates were mixed with a low pH buffer (1.5 M acetic acid, 1.5 M sodium acetate, pH 4.75) at a ratio of 10:1. 4 μL of these acidified trisomics were mixed with 1 μL of siRNA (10 μM) and incubated at 37 ° C for the specified time. Then, BlueJuice was added. TM Gel loading buffer (ThermoFisher Scientific, Waltham, MA, USA) was added and the siRNA mixture was loaded onto a 4-20% native TBE gel (ThermoFisher Scientific, Waltham, MA, USA). TM The cells were stained with PTEN® Gold (ThermoFisher Scientific, Waltham, MA, USA) for 10 min at room temperature and imaged under UV light ( FIG7 ).

[0761] Example 7: Design of NCL siRNA with different sense and antisense strand modifications

[0762] Based on the previous studies of LMNA and ApoC3 described above, some chemical modifications that confer high activity were evaluated in different targets to determine whether chemical modification motifs were also beneficial. NCL was selected as the third test target and siRNA was designed, as shown in Table 29 and Figure 5, to target the 19-nucleotide long sequence of human NCL: GGAUAGUUACUGACCGGGA (SEQ ID NO: 98). The primer probe set sequences are shown in Table 30. NCL-si6 is a modified siRNA in which the chemical modification pattern reflects the chemical modification pattern of Lumasilan, except that the sense strand of NCL-si6 has an additional TT overhang connected by a PS bond and does not have a GalNAc conjugate, and the antisense strand is 21nt instead of 23nt. The chemical modification pattern of NCL-si7 is based on the chemical modification pattern of the aforementioned LMNA-si47. The chemical modification pattern of NCL-si8 is based on the chemical modification pattern of the aforementioned LMNA-si51. The chemical modification pattern of NCL-si9 is based on the chemical modification pattern of the aforementioned LMNA-si42. The chemical modification pattern of NCL-si10 is based on that of LMNA-si46. All antisense strands have 5'-phosphates. The activity of the modified siRNAs was tested in HeLa cells.

[0763] Table 29: NCL oligomeric compounds with double-stranded modifications

[0764]

[0765] Table 30. Primer probe set sequences for human NCL mRNA

[0766] name sequence SEQ ID NO: hsNCL-F GCTTGGCTTCTTCTGGACTCA 12 hsNCL-R TCGCGAGCTTCACCATGA 13 hsNCL-P CGCCACTTGTCCGCTTCACACTCC 14

[0767] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours. siRNA activity was determined by measuring target mRNA levels by qRT-PCR using the primer probe sets in Table 30, and the IC50 of siRNA targeting NCL was calculated (Table 31). AgPath-ID TM One-step RT-PCR reagents were used to perform qRT-PCR in a QS3 real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA). The target RNA levels detected in the qRT-PCR assay were normalized to those detected with Ribogreen. TMTotal RNA levels were measured by RT-PCR (ThermoFisher Scientific, Waltham, MA, USA) or GAPDH mRNA levels were detected in RNA sample aliquots using qRT-PCR.

[0768] Table 31: NCL siRNA inhibition in HeLa cells

[0769]

[0770] When novel chemical modification motifs originally designed with LMNA-targeting siRNAs were used to modify NCL-targeting siRNAs, enhanced activity was generally produced, regardless of the target or siRNA sequence.

[0771] Example 8: Further characterization of ARNATAR designed modified oligomeric compounds in vitro

[0772] The previous studies described above evaluated the inhibitory activity of oligomeric compounds over time after transfection into cell lines. Oligomeric compounds may have different activities over time depending on the mode of trafficking into the cell, for example, transfection versus free uptake.

[0773] When transfected into cells, the oligomeric compounds are rapidly released into the cytoplasm and quickly begin to actively inhibit their targets. That is, the oligomeric compounds are released into the cytoplasm in a rapid burst, with early and strong activity, but the activity is short-lived.

[0774] When oligomeric compounds are transported into cells by free uptake (e.g., endocytosis via receptors such as the asialoglycoprotein receptor (ASGR)), these compounds are initially stored in endosomes / lysosomes and protected from nucleases and slowly released into the cytoplasm. This slow release of the compound initially results in a delayed onset and slower inhibitory activity, but the activity is prolonged and maintained.

[0775] When siRNA duplexes are released into the cytoplasm, they need to interact with RISC and undergo strand separation to allow the degradation of the target nucleic acid directed by the antisense strand. The efficiency of RISC loading and strand separation also affects siRNA activity and kinetics.

[0776] Additional properties of the potent oligomeric compounds selected from previous studies, such as melting temperature (Tm) and compound loading into the RISC system, were evaluated. LMNA-si2 was used as a benchmark for comparison.

[0777] A. ARNATAR motif shows faster onset of siRNA activity after transfection

[0778] The ARNATAR design siRNA evaluated in previous examples demonstrates that siRNA activity occurs faster. Without being bound by any particular theory, this faster occurrence may be due to RISC loading and chain separation faster than benchmark compounds. Selected oligomeric compounds are used to study to assess time-course, melting temperature (Tm) and RISC loading (Eamens et al., 2009, RNA, 15:2219-2235).

[0779] Selected siRNAs were transfected into HeLa cells at 0-10 nM for 2 or 4 hours, and LMNA mRNA levels were detected by qRT-PCR using the primer probe sets listed in Table 2. The percentage of LMNA-si2 mRNA levels relative to the level at time point 0 is shown in Table 32 and Figure 9.

[0780] Table 32: LMNA mRNA levels in cells treated with different siRNAs for different periods of time

[0781] time Ctrl LMNA-si2 LMNA-si31 LMNA-si47 LMNA-si49 LMNA-si51 0 106.90 100.00 100.42 100.48 99.25 92.98 2 hours 96.21 97.82 95.43 94.22 97.81 102.12 4 hours 116.49 109.93 35.12 21.43 22.89 27.72

[0782] ARNATAR designed siRNA showed a faster onset of triggered target reduction, as a significant reduction of target LMNA mRNA was observed 4 hours after transfection of ARNATAR designed siRNA, but not the reference siRNA (LMNA-si2).

[0783] Determination of melting temperature (Tm) by melting curve

[0784] The Tm of a double-stranded oligomer is the temperature at which half of the double strands dissociate and become single strands. Tm is a measure of double-strand stability. A lower Tm can facilitate faster dissociation between the sense and antisense strands and enable the antisense strand to interact more quickly with the target RNA.

[0785] 0.5 μl of 10 μM siRNA was incubated in 20 μl 1X TE buffer containing 1:1000 Ribogreen (Invitrogen, ThermoFisherScientific, Waltham, MA, USA). Three replicates of each sample were seeded in a 96-well qPCR plate and placed in The melting temperature (Tm) was obtained under the following conditions: 95°C, 15 sec; 40°C, 1 min; melting curve to 95°C, 15 sec / °C). QuantStudio was used. TM Design and Analysis Software v1.5.2 analyzed Tm, and the results are shown in Table 33 and Figure 10.

[0786] Table 33: Tm values ​​of selected siRNAs

[0787]

[0788]

[0789] Most of the siRNAs that showed increased activity had Tm lower than the reference siRNA si2.

[0790] Measuring siRNA loading into RISC

[0791] siRNA must be loaded into RISC and associated with Ago2 to degrade the target RNA. The measurement of RISC-loaded siRNA (antisense strand) in cells was based on the study of Castellanos-Rizaldos et al. (Nucleic Acid Therapeutics, 2020, 30(3): 133-142), using immunoprecipitation followed by stem-loop RT-qPCR of the final lysate of RISC-loaded siRNA.

[0792] i. Sample preparation

[0793] For each siRNA to be tested, 1.5 × 10 6 HeLa cells were harvested after 16 hours. The cells were harvested and the cell pellet was washed with 1XPBS and then washed with 5 μL RNAse Out TM The cells were resuspended in 500 μL of pre-chilled RIPA lysis and extraction buffer (ThermoFisher Scientific, Waltham, MA, USA) and a protease inhibitor cocktail (Roche, Sigma-Aldrich, St. Louis, MO, USA). The cell mixture was gently mixed by pipetting and incubated on ice for 30 min. The cell mixture was centrifuged to separate the precipitate, and 400 μL of the supernatant was poured into a clean tube. 10 μL (2.5%) of the supernatant was reserved for input, and the rest was stored at -80°C until needed.

[0794] ii. Ago2 bead coating preparation

[0795] 40 μL of magnetic beads were washed with 200 μL of RIPA lysis and extraction buffer. The washed beads were resuspended in 100 μL of RIPA lysis and extraction buffer and 10 μL (5 μg) of Ago2 antibody (ab57113, Abcam, Cambridge, UK) and incubated at 4°C for 2 hours.

[0796] iii. Ago2 immunoprecipitation

[0797] 200 μL of supernatant from the sample preparation was incubated with Ago2 antibody-precoated beads at 4°C with gentle rotation for 3 hours. The mixture was centrifuged, the supernatant removed, and the beads washed 7X with 500 μL of wash buffer (50 mM Tris·Cl, pH 7.5; 150 mM NaCl; 5 mM EDTA; 0.1% NP-40). 250 μL of PBS / Triton X100 buffer was added to the washed beads, and the mixture was incubated at 95°C for 10 minutes, vortexed, and then placed on ice for 10 minutes. The mixture was centrifuged at 16,000 g for 10 minutes at 4°C, and the supernatant was transferred to a clean tube and reserved for the next step.

[0798] iv. Prepare reverse transcription (RT) samples

[0799] 10 μL (2.5%) of the input supernatant was mixed with 250 μL of PBS / TritonX100 buffer, heated to 95°C for 10 min, vortexed, then placed on ice for 10 min, and then centrifuged at 4°C for 10 min. The supernatant was transferred to a clean tube. 20 μL of the supernatant of each sample was added to a 96-well plate and heated at 95°C for 10 min in a PCR instrument to denature the duplex, and then kept at 4°C for 5 min. To prepare a control, 250 μL of PBST buffer (0.25% TritonX100 in 1XPBS buffer) was added to the untreated beads.

[0800] v.Reverse transcription (RT)

[0801] For each RT reaction, 5 μL of the prepared sample was heated to 90°C for 3 min to unwind the sense and antisense strands, and then the sample was immediately frozen to maintain strand separation. The hsLMNA-A primer was used for the antisense strand reaction, and the hsLMNA-S primer was used for the sense strand reaction. RT was performed using a reverse transcription kit (ThermoFisher Scientific, Waltham, MA, USA) according to the manufacturer's recommended protocol. For the control, 5 μL of 0.2 μM siRNA was used as the RNA template in the RT reaction to establish a standard curve.

[0802] vi. qPCR quantification

[0803] Dilute the cDNA from the RT reaction 1:3 with DEPC water. Also dilute the control RT reaction 1:3, then serially dilute 1:10, and then dilute 5X. The cDNA concentrations in the control reaction serial dilutions are: 16.66 nM, 1.666 nM, 0.1666 nM, 0.01666 nM, 0.001666 nM, and 0 nM.

[0804] Mix 4 μL of diluted RT cDNA template with 5 μL of 2X TaqMan TM Universal Master Mix II (without UNG) (ThermoFisher Scientific, Waltham, MA, USA) was mixed with 0.5 μL of DDW. Primers hsLMNA-S or hsLMNA-A were used as appropriate. PCR was performed under the following conditions: 95°C for 3 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 20 sec each.

[0805] In summary, siRNAs associated with Ago2 were isolated by immunoprecipitation from HELA cells transfected with 2 nM of each siRNA at two different time points using an Ago2 antibody. The isolated siRNAs and total cell siRNAs were quantified using a ThermoFisher (Waltham, MA, USA) kit and its proprietary stem-loop primer probe set. The recovery of antisense siRNAs associated with Ago2 relative to the level of total cell antisense siRNAs was calculated and normalized to the recovery of miRNA-16 detected by qRT-PCR using a stem-loop primer probe set specific for human miRNA-16 (ThermoFisher Scientific, Waltham, MA, USA). The calculated recovery rates are shown in Table 34.

[0806] Table 34: Relative levels of antisense siRNA associated with Ago2 in cells transfected with siRNA at different times

[0807] LMNA-si2 LMNA-si31 LMNA-si47 LMNA-si49 LMNA-si51 48 hours 1.5 2.66 4.12 2.3 3.31 52 hours 1.19 3.60 4.47 2.62 2.64

[0808] This study showed that ARNATAR motif siRNA was more efficiently loaded into RISC than LMNA-si2 reference siRNA (Table 34 and Figure 11).

[0809] B. ARNATAR motifs show better activity when freely taken up into cells in vitro

[0810] LMNA research

[0811] Selected LMNA siRNAs were conjugated with different types of N-acetylgalactosamine (GalNAc) (Table 35) to allow for free uptake of the compound by cells. GalNAc was attached to the sense strand of the siRNA.

[0812] Table 35: LMNA oligomeric compounds with double-stranded modifications

[0813] siRNA name sequence and chemistry GalNAc LMNA-si52 LMNA-si2 GalNAc 1 LMNA-si55 LMNA-si47 GalNAc 2 LMNA-si64 LMNA-si42 GalNAc 2

[0814] LMNA-si52 was designed as another benchmark for comparing ARNATAR designed compounds. It has the same sequence and chemistry as LMNA-si2 described in Example 1, but is conjugated with GalNAc, which is used by Alnylam in its siRNA compounds (Nair et al., J. Am. Chem. Soc. 2014, 136(49):16958-16961, incorporated herein by reference): also known as GalNAc 1 or GA1.

[0815] LMNA-si55 and LMNA-si64 use the sequence and chemistry of LMNA-si47 and LMNA-si42, respectively, and were shown in previous examples to have a potent and stable chemical modification motif that was conjugated to GalNAc from AM Chemicals (U.S. Patent 10,087,208, incorporated herein by reference): also known as GalNAc 2, GalNAc(AM), or GA2.

[0816] GalNAc-conjugated siRNA was directly added to primary hepatocytes in vitro at final concentrations of 6.4 nM, 32 nM, and 160 nM, and the cells were further cultured for 48 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of the siRNA targeting LMNA was calculated (Table 36).

[0817] Table 36: LMNA siRNA inhibition in primary hepatocytes

[0818]

[0819] After free uptake into cells, LMNA-si55 and LMNA-si64 showed >10-fold improvement in activity compared to the benchmark LMNA-si52.

[0820] ApoC3 research

[0821] Selected ApoC3 siRNAs were conjugated with N-acetylgalactosamine (GalNAc) (Table 37) to allow for free uptake of the compound into cells. GalNAc was attached to the sense strand of the siRNA.

[0822] Table 37: ApoC3 oligomeric compounds with double-stranded modifications

[0823] siRNA name Chemical modification GalNAc ApoC3-si10 LMNA-si2 motif GalNAc 2 ApoC3-si11 LMNA-si47 motif GalNAc 2 ApoC3-si12 LMNA-si42 motif GalNAc 2 ApoC3-si13 LMNA-si52 motif with 2 fewer PS bonds GalNAc 2 ApoC3-si14 LMNA-si46 motif without 3'PS bond GalNAc 2

[0824] The chemical modifications in Table 37 describe modification patterns independent of the nucleoside sequence. For example, ApoC3-si10, which has the LMNA-si2 motif, has the same chemical modification pattern as LMNA-si2, but a different nucleoside sequence. The complete sequence and chemical properties of ApoC3 siRNA are shown in Figures 3-4.

[0825] 0-4 μM GalNAc-conjugated siRNA was directly added to primary hepatocytes in vitro and the cells were further cultured for 48 hours and 72 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 19, and the IC50 of siRNA targeting ApoC3 was calculated (Table 38).

[0826] Table 38: IC50 of Apoc3 siRNA in primary hepatocytes with free uptake

[0827] ApoC3-10 (reference) ApoC3-11 ApoC3-12 ApoC3-13 ApoC3-14 IC50(nM) NA 4.243 2.616 3.007 0.179

[0828] Example 9: Characterization of ARNATAR-designed modified oligomeric compounds in vivo for 72 hours

[0829] The inhibitory potency and other properties of LMNA-si55, LMNA-si64, and the benchmark LMNA-si52 had been previously evaluated in vitro. In this study, the oligomeric compounds were tested in mice to determine whether the in vitro results correlated with the in vivo results.

[0830] Three Balb / C male mice aged 7 to 8 weeks were subcutaneously injected with 0.6 mg / kg, 3 mg / kg, or 15 mg / kg of LMNA-si52, LMNA-si55, or LMNA-si64, respectively. For LMNA-si55, due to material limitations, the high dose was 12 mg / kg instead of 15 mg / kg. Phosphate-buffered saline (PBS) was injected as a control. 72 hours after dosing, the mice were sacrificed and their organs were harvested for analysis (Tables 39-40 and Figure 12).

[0831] A. Inhibitory efficacy

[0832] Table 39: LMNA siRNA inhibition in mouse liver at 72 hours

[0833]

[0834] Table 40: LMNA siRNA inhibition in mouse liver

[0835]

[0836] LMNA-si55 and LMNA-si64 were more potent than the benchmark LMNA-si52 and inhibited LMNA mRNA in a dose-dependent manner.

[0837] B. Security

[0838] As shown in the table below, various organs were assessed for signs of stress or damage. Blood chemistries were measured by the ACP Diagnostic Services Laboratory at the University of California, San Diego. Markers assessed included: serum albumin (ALB), alanine aminotransferase (also known as alanine aminotransferase or ALT), blood urea nitrogen (BUN), total bilirubin (TBIL), liver weight, spleen weight, and other analytes (Figures 13-15). If ALB levels are low, it may be a marker for liver disease, kidney disease, or other diseases. ALT is an enzyme found primarily in the liver. High levels of ALT may indicate the presence of liver disease, such as acute hepatitis. BUN is a waste product produced by the liver's breakdown of proteins and is excreted by the kidneys. High BUN levels are a marker for kidney or liver dysfunction. TBIL measures the amount of bilirubin in the blood. High levels of TBIL may indicate liver disease, bile duct obstruction, or other medical problems. The body and organ weights (e.g., liver and spleen) of the mice were measured to ensure that the mice were not feeling generally unwell and had stopped eating.

[0839] Overall, all assessed markers were within tolerable parameters following administration of oligomeric compounds compared to PBS controls (Figures 13-15).

[0840] C. Immunogenicity

[0841] Immunogenetic signature analysis was performed on liver samples from the same animals described above. mRNA levels of several immune response markers were examined using qRT-PCR using mouse NfkB, IL6, and TNF-specific primer and probe sets (ThermoFisher Scientific, Waltham, MA, USA), as shown in Table 41, and the results are shown in Table 42 and Figure 16. Primer and probe sets were from ThermoFisher Scientific (Waltham, MA, USA).

[0842] Table 41: Primer-probe sets

[0843] Primer / probe name sequence SEQ ID NO hsNFkB-F AAACACTGTGAGGATGGGATC 99 hsNFkB-R TCTGTCATTCGTGCTTCCAG 100 hsNFkB-P TGTCACATGAAGTATACCCAGGTTTGCG 101 msNfkB-F GTGTCAGAGCCCTTGTAACTG 102 msNfkB-R ACATTTGCCCAGTTCCGTAG 103 msNfkB-P TCGTCTGCCATGGTGAAGATGCG 104 msIL6-F AAACCGCTATGAAGTTCCTCTC 105 msIL6-R GTGGTATCCTCTGTGAAGTCTC 106 msIL6-P TTGTCACCAGCATCAGTCCCAAGAA 107 msTNF-F AGACCCTCACACTCAGATCA 108 msTNF-R TGTCTTTGAGATCCATGCCG 109 msTNF-P CCTGTAGCCCACGTCGTAGCAAA 110

[0844] Table 42. mRNA levels in liver samples from animals treated with siRNA for 72 hours

[0845]

[0846] Overall, all assessed markers were within tolerable levels 72 hours after administration of the oligomeric compounds compared to the PBS control ( FIG. 16 ).

[0847] Example 10: Characterization of ARNATAR-designed modified oligomeric compounds in vivo for 7 days

[0848] LMNA-si52, LMNA-si55, or LMNA-si64 were evaluated in mice over a longer period of time.

[0849] Three male Balb / C mice aged 7 to 8 weeks were subcutaneously injected with 4 mg / kg or 12 mg / kg of LMNA-si52, LMNA-si55, or LMNA-si64. Phosphate-buffered saline (PBS) served as a control. Seven days after administration, the mice were sacrificed and their organs were harvested for analysis (Tables 43-44 and Figures 17-18).

[0850] Table 43: LMNA siRNA % Inhibition in Mouse Liver at Day 7

[0851] deal with dose %LMNA mRNA PBS -- 100.0 LMNA-si52 12 mg / kg 33.5 LMNA-si52 4 mg / kg 60.13 LMNA-si55 12 mg / kg 26.93 LMNA-si55 4 mg / kg 39.1 LMNA-si64 12 mg / kg 20.98 LMNA-si64 4 mg / kg 35.83

[0852] LMNA-si55 and LMNA-si64 knocked down LMNA mRNA levels in a dose-dependent manner on day 7 after administration to mice. At equivalent dose levels, LMNA-si55 and LMNA-si64 knocked down LMNA more than LMNA-si52 (Table 43 and Figure 17).

[0853] Immunogenicity was assessed in mice following administration of LMNA-si52, LMNA-si55, and LMNA-si64. Overall, there were no significant changes in immune markers in siRNA-treated mice at day 7 (Table 44 and Figure 18).

[0854] Table 44: mRNA levels of selected immune response markers in liver samples

[0855]

[0856] Example 11: Improvement of additional modifications of chemical modification motifs

[0857] Additional chemical modification patterns were designed for LMNA and evaluated to determine if the new motifs were beneficial. The motif of LMNA-si47 was the basis for adding or changing the chemical modifications of the antisense strands (Table 45). All antisense strands had 5'-phosphates.

[0858] Table 45: LMNA oligomeric compounds with double-stranded modifications

[0859]

[0860]

[0861] 0-10 nM siRNA was transfected into HeLa or Hepa1-6 cells using RNAiMAX (Invitrogen, Waltham, MA) and the cells were further cultured for 24 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 46).

[0862] Table 46: LMNA siRNA inhibition in HeLa or Hepa1-6 cells

[0863]

[0864] The newly designed motif of LMNA-si67 showed slightly better activity than that of LMNA-si47.

[0865] Example 12: Additional modifications to alter the chemical modification of oligomeric compounds

[0866] Additional chemical modification patterns were designed for LMNA and evaluated to determine if new motifs were beneficial. The motif of LMNA-si68 served as the basis for varying the chemical modifications of the oligomeric compounds to determine if different 2'-F / 2'-OMe modification combinations were beneficial for siRNA activity (Table 47). All antisense strands had 5'-phosphates.

[0867] Table 47: LMNA oligomeric compounds with double-stranded modifications

[0868]

[0869]

[0870] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours, 72 hours, and 96 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of the siRNA targeting LMNA was calculated (Table 48).

[0871] Table 48: LMNA siRNA inhibition in HeLa cells

[0872]

[0873] The results showed that LMNA-si78 had the highest activity at the earliest time point of 30 hours, while LMNA-si71, LMNA-si74 and LMNA-si79 also had good activity in the early stage. At the longest time point of 96 hours, LMNA-si47, LMNA-si71, LMNA-si77 and LMNA-si78 had the highest activity. The compound designed by ARNATAR showed faster onset of activity and higher activity levels at later time points than the benchmark LMNA-si2 (Figure 20). The results show that changing the 2'-OMe / 2'-F modification site determined here is tolerable for siRNA activity.

[0874] 72 hours after transfection, human NFkB mRNA levels in HeLa cells were assessed by qRT-PCR using TaqMan primer probe sets (Table 41). The results showed that the new ARNATAR siRNA design had comparable immunogenicity to the benchmark LMNA-si2 when measured by NFkB (Figure 21).

[0875] Stability assays were performed on LMNA-si2, LMNA-si74, LMNA-si75, and LMNA-si78. The first test exposed the compounds to human serum to test their stability. The second test exposed the compounds to triboviruses to test their stability. Compared to the benchmark LMNA-si2, these three compounds had comparable stability in serum and triboviruses (Figure 19).

[0876] Example 13: Additional modification of replacing RNA bases with DNA bases in the sense strand

[0877] Additional chemical modification patterns were designed for LMNA siRNA and evaluated to determine if the new motifs were beneficial. The motif of LMNA-si78 was the basis for modifying the sense strand by replacing RNA with DNA nucleotides (Table 49). All antisense strands had 5'-phosphates.

[0878] Table 49: LMNA oligomeric compounds with double-stranded modifications

[0879]

[0880] 0-10 nM siRNA was transfected into HEK293 cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 30 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 of siRNA targeting LMNA was calculated (Table 50).

[0881] Table 50: LMNA siRNA inhibition in HEK293 cells

[0882]

[0883] The results showed that the ARNATAR designed compounds were more potent than the benchmark LMNA-si2 (Table 50 and Figure 22).

[0884] NFkB mRNA levels were assessed in HEK293 cells by RT-qPCR 48 hours after transfection.The results showed that the immunogenicity of several new ARNATAR siRNA designs was at least as good as or lower than that of the benchmark LMNA-si2 when measured by NFkB (Figure 22).

[0885] Example 14: In vivo studies characterizing ARNATAR designed oligomeric compounds

[0886] Selected LMNA siRNAs were conjugated with different types of N-acetylgalactosamine (GalNAc) (Table 51) to allow for free uptake of the compounds into cells.

[0887] Table 51: LMNA oligomeric compounds with double-stranded modifications

[0888] siRNA name sequence and chemistry GalNAc LMNA-si52 LMNA-si2 GalNAc 1 LMNA-si57 LMNA-si2 GalNAc 2 LMNA-si92 LMNA-si74 GalNAc 2 LMNA-si93 LMNA-si75 GalNAc 2 LMNA-si94 LMNA-si78 GalNAc 2

[0889] LMNA-si52 was designed as another benchmark for comparing ARNATAR designed compounds. It has the sequence and chemistry of LMNA-si2 described in Example 1 and is conjugated to the GalNAc used by Alnylam in its siRNA compounds (e.g., votrisilane) (Keam, 2022, Drugs, 82: 1419-1425; Nair et al., J. Am. Chem. Soc. 2014, 136(49): 16958-16961; incorporated herein by reference): GalNAc1 (also known as GA1).

[0890] LMNA-si57, LMNA-si92, LMNA-si93, and LMNA-si94 used the sequences and chemistry described in Table 51 and were conjugated with GalNAc from AM Chemicals (U.S. Patent No. 10,087,208, incorporated herein by reference): GalNAc2 (also known as GalNAc(AM) or GA2).

[0891] 7- to 8-week-old Balb / c mice were subcutaneously injected with 3 mg / kg or 15 mg / kg of GalNAc-conjugated siRNA, with 3 mice per group. Phosphate-buffered saline (PBS) was injected as a control. Three days after administration, the mice were sacrificed and their organs were harvested for analysis (Table 52 and Figure 23).

[0892] Table 52: Percentage of LMNA mRNA in mouse liver on day 3

[0893]

[0894] *Due to material limitations, the dose was 13.5 mg / kg

[0895] At 3 mg or 15 mg doses, LMNA-si92, -si93, and -si94 were more effective than the reference siRNA LMNA-si57. These four siRNAs share the same GalNAc2. In addition, LMNA-si52 is essentially identical to LMNA-si57, differing only in GalNAc, but its potency appears to be stronger than LMNA-si57, suggesting that different GalNAcs can affect delivery efficiency. However, the data further suggest that the LMNA-si55 and LMNA-si64 designs evaluated in the experiments of Example 9 above (Figure 12) should have a higher potency increase compared to the reference siRNA chemistry if the same GalNAc is used.

[0896] Example 15: Comparison of Benchmark siRNA and ARNATAR siRNA

[0897] Homo sapiens hydroxy acid oxidase (HAO1) ​​was selected as the fourth test target, and the siRNA design is shown in Table 53 and Figure 24.

[0898] A previous study served as a benchmark modified siRNA in which the chemical modification pattern mirrored that of Lumacillin, except that the sense strand had an added TT overhang linked by a PS bond and no GalNAc conjugate, and the antisense strand was 21 nt instead of 23 nt.

[0899] In this example, the precise chemical modification motif of Lumasilan (without the GalNAc conjugate) was used to modify an siRNA targeting HAO1 (for a description of the chemical modification of Lumasilan, see Friedrich and Aigner (BioDrugs, 2022, 36(5):549-571). Additional siRNAs targeting the same HAO1 target sequence were designed based on the ARNATAR motif.

[0900] HAO-Lumasilan benchmark and ARNATAR motif siRNAs were tested head-to-head to compare HAO1 inhibition efficacy. All ARNATAR designed antisense strands have a 5'-phosphate.

[0901] Table 53: HAO1 oligomeric compounds with double-stranded modifications

[0902]

[0903]

[0904] 0-0.4 nM siRNA was transfected into Hep3b cells using RNAiMAX (Invitrogen, Waltham, MA) and the cells were cultured for 24 hours. siRNA activity was determined by ThermoFisher Scientific's HAO1 gene expression assay (Cat. # Hs00213909_m1; Waltham, MA, USA), and the amount of HAO1 mRNA remaining after siRNA knockdown was assessed (Table 54 and Figure 25).

[0905] Table 54: HAO1 siRNA inhibition in Hep3b cells after 24 hours

[0906]

[0907] ARNATAR designed siRNAs showed better inhibition rates than benchmark siRNAs.

[0908] Example 16: Additional chemical modifications to evaluate the effects of 5'-phosphate on the antisense strand and phosphorothioate on the sense strand on siRNA activity

[0909] Additional chemical modification patterns were designed for LMNA siRNA (Table 55) and evaluated to determine if the new motifs would be beneficial.

[0910] The previous siRNAs evaluated above contained a 5'-phosphate on the antisense strand, which is required for Ago2 binding and function. Since siRNAs can be phosphorylated in cells (Weitzer S, Martinez J. Nature, 2007, 447(7141):222–226), the addition of a 5'-phosphate is not necessarily required during siRNA synthesis. Therefore, the activity of siRNAs with or without a 5'-phosphate was evaluated; LMNA-si94 is the previously disclosed LMNA-si78, which has a 5'-phosphate on its antisense strand and a GalNAc conjugate added to the sense strand. LMNA-si95 is LMNA-si94 with a 5'-OH residue on the antisense strand replacing the 5'-phosphate.

[0911] In addition, the effect of the position and number of phosphorothioates around the DNA or RNA nucleotides in the sense strand (5' or 3', or 5' and 3') was evaluated; LMNA-si96 to LMNA-si100 were designed based on the previously published LMNA-si78 or LMNA-si90. LMNA-si96 is LMNA-si90 with a GalNAc conjugate. The siRNA compounds LMNA-si97, LMNA-si98, LMNA-si99, and LMNA-si100 contain the antisense strand of LMNA-si78 and a sense strand with a newly designed motif, moving the phosphorothioate to various positions and a GalNAc conjugate.

[0912] The GalNAc conjugate used in this study is referred to herein as GalNAc2 (AM Chemicals, US Patent No. 10,087,208, incorporated herein by reference).

[0913] Table 55: LMNA oligomeric compounds with double-stranded modifications

[0914]

[0915] In vitro assay

[0916] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 72 hours and 96 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 values ​​of siRNA targeting LMNA were calculated (Table 56), and the percentage of inhibition of LMNA RNA levels was plotted (Figure 26).

[0917] Table 56: LMNA siRNA inhibition in HeLa cells

[0918]

[0919] The results showed that siRNA with an antisense strand of 5'-phosphate (LMNA-si94) showed better activity than siRNA with an antisense strand of 5'-OH (LMNA-si95), and siRNA can tolerate phosphorothioates in the 5' and 3' sense strands of DNA nucleotides or RNA nucleotides. In addition, phosphorothioates in the 3' sense strand of DNA nucleotides (LMNA-si96) appear to be slightly better than phosphorothioates in the 5' sense strand of DNA nucleotides (LMNA-si100). The results also showed that the compound designed by ARNATAR was more effective in vitro than the benchmark LMNA-si52. (Table 56 and Figure 26).

[0920] In vivo assay

[0921] Several siRNA compounds found to be effective in the in vitro inhibition assays described above were evaluated in vivo; 6- to 8-week-old male Balb / c mice were subcutaneously injected with 3 mg / kg of siRNA, with 3 mice per group. Groups of mice were evaluated at day 3, week 1, or week 2. Phosphate-buffered saline (PBS) was injected as a control. 3 days, 1 week, or 2 weeks after dosing, mice were sacrificed and organs were harvested for analysis (Table 57 and Figure 27). None of the groups of mice treated with LMNA-si94 or LMNA-si95 reached the 1- or 2-week time points.

[0922] siRNA activity was determined by measuring target mRNA levels by qRT-PCR using the LMNA primer-probe sets listed in Table 2. TM One-step RT-PCR reagents were used to perform qRT-PCR in a QS3 Real-Time PCR System (ThermoFisher Scientific, Waltham, MA, USA). Target RNA levels detected in the qRT-PCR assay were normalized to GAPDH mRNA levels detected in RNA sample aliquots using qRT-PCR.

[0923] Table 57: Percentage of LMNA mRNA in Mouse Liver at Day 3, Week 1, or Week 2

[0924]

[0925] In vivo results showed that the motif designs of LMNA-si94, LMNA-si95, and LMNA-si97 were more effective than the benchmark compound LMNA-si52 over a 3-day period when administered at 3 mg / kg. LMNA-si97 and LMNA-si98 were more potent inhibitors than LMNA-si52 over a 1- and 2-week period. None of the mice treated with LMNA-si94 or LMNA-si95 survived beyond 3 days after treatment.

[0926] Example 17: Additional modifications to increase siRNA durability

[0927] In the previous example, the sense and antisense strands used to design LMNA siRNAs were mixed and matched in different combinations (Table 58) and evaluated to determine whether the new siRNA compounds were effective. The sense strands of LMNA-si97 (ATXL207) and LMNA-si98 (ATXL208), which showed persistent inhibitory activity at the 2-week time point in the previous example, were paired with different antisense strands of siRNAs that were previously shown to be effective LMNA inhibitors (LMNA-si74) or stable (LMNA-si79). Each antisense strand had a 5'-phosphate and each sense strand had a GalNAc2 conjugate.

[0928] Table 58: LMNA oligomeric compounds with double-stranded modifications

[0929]

[0930] In vitro assay

[0931] 0-10 nM siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 20 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 values ​​of the siRNA targeting LMNA were calculated (Table 59), and the percentage inhibition of LMNA RNA levels was plotted (Figure 28).

[0932] Table 59: LMNA siRNA inhibition in HeLa cells

[0933]

[0934] Compared to the reference siRNA (LMNA-si52), the siRNA containing several RNA nucleotides in the sense strand of LMNA-si97 showed better activity, while the siRNA with a fully 2'-OMe / F-modified sense strand and a DNA-modified antisense strand (LMNA-si103) also improved activity. However, the activity of the siRNA with fully 2'-OMe / F-modified sense and antisense strands (LMNA-si104) was slightly better than that of the reference siRNA.

[0935] Example 18: Additional modifications to increase siRNA durability

[0936] In the previous examples, the sense and antisense strands used to design LMNA siRNAs were mixed and matched in different combinations (LMNA-sil07 and LMNA-sil08) or a non-GalNAc version of LMNA-103 (LMNA-sil09), as shown in Table 60, and evaluated to determine whether the new siRNA compounds were effective. Each antisense strand had a 5'-phosphate. The sense strands of LMNA-sil07 and LMNA-sil08 had a GalNAc2 conjugate.

[0937] Table 60: LMNA oligomeric compounds with double-stranded modifications

[0938]

[0939] In vitro assay

[0940] 0-10 nM siRNA was transfected into HeLa cells or Hepa1-6 cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for the various times shown in the table. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 values ​​of siRNA targeting LMNA were calculated (Tables 61-63), and the percentage of inhibition of LMNA RNA levels was plotted (Figures 29-31).

[0941] Table 61: LMNA siRNA inhibition in HeLa cells

[0942]

[0943] Table 62: LMNA siRNA inhibition in Hepa1-6 cells

[0944]

[0945] Table 63: LMNA siRNA inhibition in HeLa cells

[0946]

[0947]

[0948] The results showed that the new siRNA combinations generally showed better activity than the reference siRNAs LMNA-si2 or LMNA-si52, while two siRNAs containing sense strand RNA nucleotides (LMNA-si107, LMNA-si108) had even better activity.

[0949] Example 19: Characterization of the duration of siRNA activity in vivo

[0950] In addition to activity, another important factor for siRNA treatment is the duration of action in vivo. In order to evaluate the duration of action of siRNA with a new modification pattern, siRNA LMNA-si103 and reference siRNA LMNA-si52 were subcutaneously administered to 7-week-old BalB / C mice at 5 mg / kg and killed 10 days or 25 days after siRNA injection. Using the primer probe set described in Table 2, qRT-PCR was used to analyze the LMNA mRNA levels in the total liver. The results are shown in Table 64. In vivo, the knockdown of LMNA-103 was significantly better than that of reference siRNA LMNA-si52. In addition, LMNA-si103 had a similar recovery slope (Figure 32) with reference LMNA-si52, which shows that the newly modified siRNA has better activity than reference siRNA and a duration comparable to reference siRNA in animals.

[0951] Table 64: Percentage of LMNA mRNA in mouse liver on day 10 or day 25

[0952]

[0953] Example 20: Comparison of ARNATAR siRNA platform design and third-party siRNA platform design

[0954] As disclosed in Example 1, the LMNA-si2 benchmark was designed based on a chemically modified version of the commercially available therapeutic agent Lumacillin. The benchmark, LMNA-si52, is LMNA-si2 with a GalNAc conjugate (Example 8). However, to minimize the variables in the aforementioned experiments, LMNA-si2 (and LMNA-si52) differ from Lumacillin in that it was designed with an LMNA sequence, overhangs at both ends, and a length of 21 nt.

[0955] In this study, the chemical modification platform ESC Plus (ESC+) (Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5: 101) was used to design benchmark siRNAs for three targets (LMNA, NCL and ApoC3). As described by Hu et al., these new benchmark siRNAs have a 21nt sense chain, a 23nt antisense chain, no 3' overhang in the sense chain, and two natural nucleotides overhang at the 3' end of the antisense chain (forming a 23nt base pairing with the mRNA target). In addition, there is no phosphate at the 5' end of the antisense chain, and the 7th position in the antisense chain is a "GNA" modified nucleotide when commercially available. In order to form a better benchmark siRNA, antisense siRNAs share the same 21nt sequence from the 5' end to ensure similar seed sequences. The benchmark siRNAs are LMNA-si111, NCL-ALN, and ApoC3-AL, as shown in Table 65.

[0956] ARNATAR designed 21 nt siRNAs targeting NCL and ApoC3 were designed using the LMNA-74 chemistry motif, as shown in Table 65. The ARNATAR designed siRNAs have a 5'-phosphate on the antisense strand.

[0957] To compare chemical modification motifs only, siRNAs were prepared without GalNAc conjugates.

[0958] Table 65: Differently designed oligomeric compounds targeting NCL, LMNA and APOC3 mRNA

[0959]

[0960]

[0961] In vitro assay

[0962] 0-10 nM LMNA and NCL siRNAs were transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 20 hours. For ApoC3 siRNA, 0-10 nM was transfected into Hep3B cells using RNAiMax, and the cells were incubated for 60 hours. siRNA activity was determined by qRT-PCR using the primer probe sets listed in Table 2, Table 30, and Table 19. Table 66 shows the IC50 of siRNAs targeting the corresponding mRNAs, and the percentage of inhibition of LMNA RNA levels is plotted (Figure 33).

[0963] Table 66. Activity of siRNAs targeting different mRNAs in HeLa or Hep3B cells

[0964]

[0965] The results showed that the newly designed siRNAs had significantly improved activity compared to the ESC+ designs. Furthermore, the ARNATAR design motif generally resulted in increased activity, regardless of the mRNA target or siRNA sequence.

[0966] Example 21: Comparison of siRNAs of different lengths targeting LMNA, NCL and AGT mRNA

[0967] The siRNA compound previously tested is mainly 21nt long, with two overhangs at each end. Since the length of the siRNA generated by Dicer cutting in the cell may be different (for example, from about 21nt to 23nt), the impact of different siRNA lengths on siRNA activity is evaluated. For this reason, the siRNA of design length is 21-mer or 23-mer, with ARNATAR motif, to target NCL (NCL-74 and NCL-23nt) and LMNA (LMNA-si110), as shown in Table 67. ARNATAR design motif includes design elements such as 5'-phosphate on the 2nt overhang on two chains and the antisense strand. In the previous embodiment, the 23mer siRNA with non-ARNATAR chemical modification was used as a benchmark (LMNA-si111, NCL-ALN). In order to only compare chemically modified motifs, siRNA was prepared in the absence of GalNAc conjugates.

[0968] Table 67: Modified LMNA oligomeric compounds of different lengths

[0969]

[0970] In vitro assays – comparison of LMNA-si110 and LMNA-si74 with the benchmark LMNA-si111

[0971] 0-10 nM LMNA siRNA was transfected into HeLa cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 16 and 36 hours. siRNA activity was determined by qRT-PCR using the primer probe set in Table 2, and the IC50 values ​​of siRNA targeting LMNA were calculated (Table 68), and the percentage of inhibition of LMNA RNA levels was plotted (Figure 34).

[0972] Table 68: LMNA siRNA inhibition in HeLa cells

[0973]

[0974] In vitro assays—comparison of NCL-74 and NCL-23nt with NCL-ALN

[0975] HeLa cells were transfected with 0-10 nM NCL siRNA using RNAiMAX (Invitrogen, Waltham, MA) and cultured for an additional 36 hours. siRNA activity was determined by qRT-PCR using the primer-probe sets listed in Table 30. The results are shown in Figure 35. Because NCL mRNA reduction was too high to determine an IC50, the percentage of mRNA levels at a 0.08 nM siRNA concentration is listed in Table 69.

[0976] Table 69: NCL siRNA inhibition in HeLa cells at 36 hours

[0977]

[0978]

[0979] The results showed that 23nt siRNAs with the newly designed chemistry also exhibited better activity compared to benchmark siRNAs of the same length, although 21nt siRNAs appeared to have higher activity compared to 23mer siRNAs.

[0980] In vitro testing - comparison of 21nt siRNA and 23nt siRNA targeting AGT

[0981] In order to further determine whether 21-mer siRNA has better activity than 23-mer siRNA and is also applicable to siRNA sequences targeting other mRNA transcripts, 21-mer siRNA and 23-mer siRNA targeting human angiotensinogen (AGT) mRNA were designed, as shown in Table 70 and Figures 36-37. GalNAc (as described in Sharma et al., 2018, Bioconjugate Chem, 29: 2478-2488, referred to herein as GA3 or GalNAc3) is conjugated to the sense strand. The siRNA designed by ARNATAR has 5'-phosphate on the antisense strand.

[0982] Table 70: Oligomeric compounds of different lengths targeting AGT mRNA

[0983]

[0984] In vitro assay

[0985] 0-10 nM AGT siRNA was transfected into Hep3B cells using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 36 hours. In addition, siRNA was incubated with untransfected human primary hepatocytes for 48 hours. siRNA activity was determined by qRT-PCR using the primer probe sets listed in Table 71. The IC50 of the siRNA targeting AGT is shown in Table 72, and the percentage inhibition of AGT mRNA levels is plotted (Figure 38).

[0986] Table 71: Primer probe set sequences for AGT

[0987] name sequence SEQ ID NO: hsAGT-F CTGATCCAGCCTCACTATGC 138 hsAGT-R AGGTCATAAGATCCTTGCAGC 139 hsAGT-P AGGGTCTCACTTTCCAGCAAAACTCC 140

[0988] Table 72: siRNA activity targeting AGT in Hep3B cells

[0989]

[0990] The results for this target also showed that 21nt siRNA had better activity than 23nt siRNA.

[0991] Example 22: New chemical modification motifs show better activity than reference designs for different siRNAs targeting AGT

[0992] The above results show that the newly optimized ARNATAR chemical design improves the activity of siRNA to different targets or sequences. In order to further determine whether the observation result has universality, siRNA is designed to 5 different regions of targeting people AGT, which is a therapeutic target for treating refractory hypertension. siRNA sequence and chemistry are listed in Table 73. For comparison, siRNA is designed using the ARNATAR motif, or the structure and modification design (ESC or ESC+, such as Hu et al., Therapeutic siRNA:State of the Art, Signal Transduction and Targeted Therapy, 2020, 5: described in 101) of a third party. The siRNA designed by ARNATAR has 5'-phosphate on the antisense strand. In order to only compare chemical modification motifs, siRNA is prepared in the absence of GalNAc conjugates.

[0993] Table 73: Oligomeric compounds targeting different regions of AGT mRNA

[0994]

[0995]

[0996] ++ 612-Ala differs from normal ESC+ chemistry in the position of the gna modification due to the unavailability of gnaG; however, gna at position 6 is also widely used in drug discovery (see PCT / US2019 / 032150).

[0997] +++ Since gnaG is not available, 598a-AL does not contain a gna at position 7, similar to ESC chemistry.

[0998] In vitro assays – comparison of the ARNATAR motif with third-party motifs

[0999] 0-10 nM AGT siRNA was transfected into Hep3B cells using RNAiMAX (Invitrogen, Waltham, MA) and the cells were further cultured for 24 hours. siRNA activity was determined by qRT-PCR using the primer probe sets listed in Table 71. The IC50 values ​​of the siRNA targeting AGT are shown in Table 74, and the percentage inhibition of AGT mRNA levels is plotted ( FIG. 39 ).

[1000] Table 74: siRNA activity targeting AGT in Hep3B cells

[1001] siRNAs IC50(nM) 579AL 15.06 ATsi-579 0.0947 597AL 1.105 ATsi-597 0.087 598-AL 0.3776 ATsi-598 0.0604 612-AL 1233 612-AN 0.1821 ATsi-565 0.0284 643-AL N / A ATsi-365m 0.1346 643-AN 0.4656

[1002] The results showed that for all these different sequences, the optimized ARNATAR design was more efficient than the third-party design.

[1003] Example 23: Comparison of siRNAs with different chemical motifs targeting the same AGT region

[1004] As shown in the previous experiments above, varying the chemical modification can affect siRNA activity. Therefore, we evaluated the activity of varying the chemical modification of siRNAs targeting the same AGT mRNA sequence (see Table 75 and Figures 36-37).

[1005] Table 75. Oligomeric compounds with different chemical motifs targeting the same region of AGT

[1006]

[1007]

[1008] In vitro assay - comparison of siRNAs with different chemical motifs targeting the same AGT sequence

[1009] siRNA was incubated with human primary hepatocytes at a final concentration of 0-5 μM (ATsi481, ATsi482, ATsi482a, ATsi483, ATsi484) or 0-50 μM (ATsi603, ATsi612) by free uptake. The cells were incubated for 42 hours and total RNA was prepared. qRT-PCR was used to evaluate siRNA activity using the AGT primer probe set (Table 71). The IC50 values ​​of siRNAs targeting AGT mRNA are shown in Table 76, and the percentage inhibition of AGT mRNA levels is plotted (Figure 40).

[1010] Table 76: Activity of siRNA targeting AGT in human primary hepatocytes

[1011] siRNA IC50 (μM) ATsi481 0.0015 ATsi482 0.0353 ATsi482a 0.0085 ATsi603 0.0009 ATsi612 0.0269 ATsi483 0.026 ATsi600 0.096 ATsi484 0.154

[1012] sequence

[1013] Table 77: Sequence Listing

[1014]

[1015]

[1016]

Claims

1. An oligomeric compound for inhibiting expression of a target nucleic acid, comprising a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (X): 5'MFMMNMNMFFNMNMNMMNMDD 3', in D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, and F is a 2'-F modified nucleoside, and A single modification type does not modify more than two consecutive nucleotides.

2. An oligomeric compound for inhibiting target nucleic acid expression, comprising an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VIII): 5'L-MNMNMFNMFMMNMFMFMM 3', in D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, and L is 5' phosphate, 5' vinylphosphonate or 5' OH, and A single modification type does not modify more than two consecutive nucleotides.

3. An oligomeric compound for inhibiting target nucleic acid expression, comprising: a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (X): 5'MFMMNMNMFFNMNMNMMNMDD 3', b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (VIII): 5'L-MNMNMFNMFMMNMFMFMM 3', and c) a duplex formed by the sense strand and the antisense strand, in D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, and L is 5' phosphate, 5' vinylphosphonate or 5' OH, wherein the duplex region is 19 nucleotide pairs in length, wherein each strand has a 2 nucleotide overhang at the 3' end, and A single modification type does not modify more than two consecutive nucleotides.

4. An oligomeric compound for inhibiting expression of a target nucleic acid, comprising a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (XI): 5'MFMMNMNMFFMMNMNMMFMDD 3', in D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, and F is a 2'-F modified nucleoside, and A single modification type does not modify more than two consecutive nucleotides.

5. An oligomeric compound for inhibiting target nucleic acid expression, comprising an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (XII): 5'L-MDMFMFNMFMMFMFMMMNMM 3', in D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, and L is 5' phosphate, 5' vinylphosphonate or 5' OH, and A single modification type does not modify more than two consecutive nucleotides.

6. An oligomeric compound for inhibiting target nucleic acid expression, comprising: a) a sense strand having 21 linked nucleotides, wherein the sense strand sequence is represented by formula (XI): 5'MFMMNMNMFFMMNMNMMFMDD 3', b) an antisense strand having 21 linked nucleotides, wherein the antisense strand sequence is represented by formula (XII): 5'L-MDMFMFNMFMMFMFMMMNMM 3', and c) a duplex formed by the sense strand and the antisense strand, in D is a deoxyribonucleoside, M is a 2'-OMe modified nucleoside, N is a modified nucleoside or an unmodified nucleoside, F is a 2'-F modified nucleoside, and L is 5' phosphate, 5' vinylphosphonate or 5' OH, wherein the duplex region is 19 nucleotide pairs in length, wherein each strand has a 2 nucleotide overhang at the 3' end, and A single modification type does not modify more than two consecutive nucleotides.

7. The oligomeric compound according to any preceding claim, wherein N can be a ribonucleoside (R), a deoxyribonucleoside (D), 2'-OMe, 2'-MOE, 2'-F, an unlocked nucleic acid (UNA) or a locked nucleic acid (LNA).

8. The oligomeric compound according to any preceding claim, wherein the oligomeric compound comprises at least one phosphorothioate internucleotide (PS) linkage.

9. The oligomeric compound according to any preceding claim, wherein the phosphorothioate internucleotide (PS) linkage is adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R).

10. The oligomeric compound according to any preceding claim, wherein the oligomeric compound is siRNA.

11. The oligomeric compound according to any preceding claim, further comprising a conjugate.

12. The oligomeric compound according to claim 9, wherein the conjugate is N-acetylgalactosamine (GalNAc).

13. The oligomeric compound of any preceding claim, wherein the compound inhibits expression of a target nucleic acid by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

14. A pharmaceutical composition comprising the oligomeric compound of any preceding claim, alone or in combination with a pharmaceutically acceptable carrier or excipient.

15. A method for inhibiting expression of a target nucleic acid in a subject, said method comprising the step of administering to said subject an oligomeric compound of any preceding claim in an amount sufficient to inhibit expression of the target nucleic acid in said subject.

16. A process for preparing an oligomeric compound according to any one of the preceding claims, said process comprising the steps of: a. Synthesis of sense-strand oligonucleotides on a solid support using phosphoramidite chemistry b. synthesizing antisense oligonucleotides on a solid support using phosphoramidite chemistry; and c. Annealing the two oligonucleotides synthesized in this way Thus, the oligomeric compound is prepared.

Images