Gene editing method for inhibiting abnormal splicing in microtubule assembly protein 2 (STMN2) transcript

Abstract

Provided herein is a method for inhibiting abnormal splicing in a MicroTubular Assembly Protein-2 (STMN2) transcript, the method comprising: genetically editing an STMN2 gene in a cell to delete: (a) one or more nucleotides in a 3'splicing site of Intron 1, where the 3 'splicing site is adjacent to exon 2a; (b) one or more nucleotides in a region of intron 1 adjacent to the 3'splice site; or both (a) and (b), whereby the production of an STMN2 transcript comprising exon 2a is inhibited and the production of a functional STMN2 transcript is increased in the cell. The invention also provides a gene editing system for gene modification of the STMN2 gene.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 549,007, filed on February 2, 2024, U.S. Provisional Application No. 63 / 618,201, filed on January 5, 2024, and U.S. Provisional Application No. 63 / 445,926, filed on February 15, 2023, the contents of each of which are incorporated herein by reference in their entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing that has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy, created on February 13, 2024, is named 063586-511001WO_SeqList_ST26.xml and is 1,675,184 bytes in size. Background Art

[0005] Amyotrophic lateral sclerosis (ALS) is a late-onset neurodegenerative disease characterized by progressive loss of motor neurons in the spinal cord and brain. Most cases are sporadic and, in the 10% due to genetic mutations, a GGGGCC repeat expansion in chromosome 9 open reading frame 72 (C9orf72) represents the most common genetic cause of ALS. Many of the genes impaired in ALS are also associated with frontotemporal dementia (FTD), another neurodegenerative disease.

[0006] Cytoplasmic accumulation of TDP-43 (transactive responsive DNA-binding protein 43) is observed in both ALS and FTD. TDP-43 is a DNA / RNA-binding protein involved in RNA transcription, splicing, processing, transport, and stability. TDP-43 binds to thousands of pre-mRNA targets, and its reduction in the adult nervous system affects the splicing or expression of many RNAs. Recently, a significant loss of stathmin-2 mRNA has been noted following TDP-43 depletion.

[0007] The inhibitory microtubule assembly protein-2 gene (STMN2) encodes a microtubule-binding protein that is essential for maintaining axonal health. In ALS, STMN2 is aberrantly spliced ​​due to TDP-43 loss of function, resulting in a nonfunctional, truncated form of STMN2 (exon 2a variant). Methods for inhibiting this aberrant STMN2 splicing and enhancing the production of functional STMN2 transcripts / proteins would be beneficial for the treatment of diseases such as ALS and FTD. Summary of the Invention

[0008] The present disclosure is based, at least in part, on the discovery that gene editing at specific locations in the STMN2 gene (e.g., the 3' splice site in intron 1 and / or a region adjacent to the 3' splice site in intron 1) significantly reduces aberrant splicing of STMN2 (reducing the formation of non-functional transcripts containing cryptic exon 2a) and increases production of full-length STMN2 transcripts. Accordingly, provided herein are methods and gene editing systems for inhibiting aberrant splicing in STMN2 transcripts. Such methods and gene editing systems may be beneficial in treating diseases involving STMN2 deletions, such as ALS and FTD.

[0009] In some aspects, the present disclosure provides a gene editing system comprising:

[0010] (a) a V-type nuclease (e.g., those disclosed herein, such as SEQ ID NO: 3, 4, 5, or 6, or variants thereof also disclosed herein) or a nucleic acid encoding the same; and (b) one or more guide RNAs (gRNAs) targeting the STMN2 gene, or one or more nucleic acids encoding the one or more gRNAs. The gene editing system causes (a) a deletion of one or more nucleotides in the 3' splice site of intron 1 of STMN2, wherein the 3' splice site is adjacent to exon 2a; (b) a deletion of one or more nucleotides in a region of intron 1 adjacent to the 3' splice site; or both (a) and (b), thereby reducing the production of STMN2 transcripts including exon 2a and increasing the production of functional STMN2 transcripts in cells edited by the gene editing system.

[0011] In some cases, the gene editing system includes two or more gRNAs targeting the STMN2 gene, for example, the first gRNA and the second gRNA. In some instances, the first gRNA induces the deletion of one or more nucleotides in the 3' splice site, and the second gRNA induces the deletion of one or more nucleotides in the downstream 10-nt window. In other examples, the first gRNA induces the deletion in the 3' splice site and the downstream 10-nt window, and the second gRNA induces the deletion in the 3' splice site. In other examples, the first gRNA induces the deletion in the 3' splice site and the downstream 10-nt window, and the second gRNA induces the deletion in the downstream 10-nt window. In still other examples, each of the first gRNA and the second gRNA induces the deletion in both the 3' splice site and the downstream 10-nt window.

[0012] In some examples, the gene editing system disclosed herein comprises (a) a Cas12i2 nuclease, which optionally comprises an amino acid sequence at least 90% identical to SEQ ID NO: 3 or SEQ ID NO: 266; and (b) one or more guide RNAs (gRNAs) selected from those listed in Table 2. In specific examples, the gene editing system comprises a nuclease of SEQ ID NO: 3 or SEQ ID NO: 266 and a gRNA of G53, G55, or G56.

[0013] In some examples, the gene editing system disclosed herein comprises (a) a V-type nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 4 or SEQ ID NO: 255; and (b) one or more guide RNAs (gRNAs) selected from those listed in Table 3. In specific examples, the gene editing system comprises the nuclease of SEQ ID NO: 4 or SEQ ID NO: 255 and the gRNA of A_STMN2_splicing2a_4 or A_STMN2_splicing2a_4. In one example, the gRNA is A_STMN2_splicing2a_4. In another example, the gRNA is A_STMN2_splicing2a_3.

[0014] In some examples, the gene editing system disclosed herein comprises (a) a V-type nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 5; and (b) one or more guide RNAs (gRNAs) selected from those listed in Table 4.

[0015] In some examples, the gene editing system disclosed herein comprises (a) a V-type nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 6; and (b) one or more guide RNAs (gRNAs) selected from those listed in Table 5.

[0016] In some embodiments, the gene editing system disclosed herein comprises a nucleic acid encoding the type V CRISPR nuclease. In some instances, the nucleic acid is a vector comprising a nucleotide sequence encoding the type V CRISPR nuclease. The encoding nucleotide sequence can be operably linked to a promoter. In some instances, the vector can be an adeno-associated virus (AAV) vector (e.g., an AAVrh10 vector). In some instances, the promoter can be the synapsin 1 promoter.

[0017] Additionally, the present disclosure features a method for inhibiting aberrant splicing in a microtubule assembly inhibitor protein-2 (STMN2) transcript, the method comprising: (i) genetically editing the STMN2 gene in a cell to delete: (a) one or more nucleotides in the 3' splice site of intron 1, wherein the 3' splice site is adjacent to exon 2a; (b) one or more nucleotides in a region of intron 1 adjacent to the 3' splice site; or both (a) and (b), thereby inhibiting production of STMN2 transcripts including exon 2a and increasing production of functional STMN2 transcripts in the cell. In some embodiments, the method may further comprise (ii) measuring the level of STMN2 transcript and / or STMN2 protein in the cell after the genetic editing.

[0018] In some embodiments, the 3' splice site in (a) comprises the nucleotide sequence of TTGCAG. Alternatively or additionally, the region of exon 2a in (b) comprises the nucleotide sequence of ACTCGGCAGA (SEQ ID NO: 2) (also referred to herein as the downstream 10-nt window).

[0019] In some embodiments, the gene editing step (i) may result in the deletion of one or more nucleotides in both (a) and (b). In some cases, the gene editing step (i) is mediated by a gene editing system. For example, the gene editing system comprises a V-type nuclease and a guide RNA (gRNA) targeting the STMN2 gene.

[0020] In some examples, the V-type nuclease is a Cas12i nuclease, which optionally comprises an amino acid sequence at least 90% identical to SEQ ID NO: 3. In a specific example, the Cas12i nuclease is a Cas12i2 nuclease comprising the amino acid sequence of SEQ ID NO: 3. In another example, the Cas12i nuclease is a Cas12i2 nuclease comprising the amino acid sequence of SEQ ID NO: 266.

[0021] In other examples, the V-type nuclease is a nuclease comprising an amino acid sequence of any one of SEQ ID NOs: 4-6 or a variant thereof, and the nuclease may comprise an amino acid sequence that is at least 90% identical to SEQ ID NOs: 4, 5, or 6. In one example, the V-type nuclease comprises the amino acid sequence of SEQ ID NO: 4. In another example, the V-type nuclease comprises the amino acid sequence of SEQ ID NO: 255. In another example, the V-type nuclease comprises the amino acid sequence of SEQ ID NO: 5. In yet another example, the V-type nuclease comprises the amino acid sequence of SEQ ID NO: 6.

[0022] Any of the gene editing systems provided herein can be used in methods for inhibiting aberrant splicing in the STMN2 transcript, also disclosed herein.

[0023] In some embodiments, the gene editing system as disclosed herein may include two or more gRNAs targeting the STMN2 gene, for example, a first gRNA and a second gRNA. In some instances, the first gRNA induces a deletion of one or more nucleotides in the 3' splice site, and the second gRNA induces a deletion of one or more nucleotides in the downstream 10-nt window. In other instances, the first gRNA induces a deletion in the 3' splice site and the downstream 10-nt window, and the second gRNA induces a deletion in the 3' splice site. In yet other instances, the first gRNA induces a deletion in the 3' splice site and the downstream 10-nt window, and the second gRNA induces a deletion in the downstream 10-nt window. In still other instances, each of the first gRNA and the second gRNA induces a deletion in both the 3' splice site and the downstream 10-nt window.

[0024] In some embodiments, the cells disclosed herein for gene editing are in cell culture. In some cases, the cells are derived from a human patient with amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). In some instances, the cells are brain cells, such as neurons. In specific instances, the cells are motor neurons.

[0025] In other embodiments, the cell is a neuronal cell from a human patient with amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

[0026] In some embodiments, the methods disclosed herein for inhibiting aberrant splicing in STMN2 transcripts comprise delivering a gene editing system to a subject in need thereof (e.g., a human patient with ALS or FTD). In some cases, the gene editing system is delivered to the subject by intracerebroventricular (ICV) injection. In some cases, the gene editing system is delivered to the subject by intrathecal injection.

[0027] In other aspects, the present disclosure features a gene-edited cell comprising (a) a deletion of one or more nucleotides in the 3' splice site of intron 1 of STMN2, wherein the 3' splice site is adjacent to exon 2a; (b) a deletion of one or more nucleotides in a region of intron 1 adjacent to the 3' splice site; or both (a) and (b). Compared to their unedited counterparts, such gene-edited cells produce reduced levels of STMN2 transcripts including exon 2a and increased levels of functional STMN2 transcripts. In some cases, the gene-edited cells are human brain cells, such as human neuronal cells. In some instances, the human neuronal cells are motor neuron cells. The gene-edited cells disclosed herein can be produced by any gene editing method disclosed herein.

[0028] Furthermore, the present disclosure provides a gene editing system comprising: (a) a V-type CRISPR nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 4, or a nucleic acid encoding the same; and (b) a guide RNA (gRNA) targeting the inhibitory microtubule assembly protein-2 (STMN2) gene, or a nucleic acid encoding the same. This gene editing system genetically modifies the STMN2 gene to inhibit the production of STMN2 transcripts containing exon 2a. In some embodiments, the V-type CRISPR comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the V-type CRISPR comprises the amino acid sequence of SEQ ID NO: 255.

[0029] In some embodiments, the gene editing system disclosed herein comprises a nucleic acid encoding the type V CRISPR nuclease. In some instances, the nucleic acid is a vector comprising a nucleotide sequence encoding the type V CRISPR nuclease, the nucleotide sequence being operably linked to a promoter. In some instances, the vector is an adeno-associated virus (AAV) vector (e.g., an AAVrh10 vector). In some instances, the promoter is a synapsin 1 promoter. In some cases, the vector disclosed herein (e.g., an AAV vector, such as an AAVrh10 vector) may further comprise a nucleotide sequence encoding a gRNA as disclosed herein.

[0030] Furthermore, the present disclosure provides a method for genetically editing the STMN2 gene, the method comprising contacting a cell with any gene editing system disclosed herein, to allow gene editing of the STMN2 gene in the cell by the gene editing system.

[0031] In some embodiments, the methods disclosed herein for inhibiting aberrant splicing in STMN2 transcripts comprise delivering a gene editing system to a subject in need thereof (e.g., a human patient). In some cases, the gene editing system is delivered to the subject by intracerebroventricular (ICV) injection. In some cases, the gene editing system is delivered to the subject by intrathecal injection.

[0032] Furthermore, the present disclosure provides methods for treating diseases involving abnormal STMN2 splicing (e.g., ALS or FTD), comprising administering any of the gene editing systems disclosed herein or modified cells produced by the gene editing system to a subject in need of treatment. Also provided herein are gene editing systems for treating target diseases as disclosed herein, as well as uses of the gene editing systems for preparing medicaments for treating the target diseases.

[0033] Also provided herein are gene editing systems for genetically editing the STMN2 gene to inhibit the production of splice variants containing exon 2a, and for treating diseases involving abnormal splicing of STMN2 (e.g., ALS or FTD), as well as the use of such gene editing systems for preparing medicaments for intended therapeutic applications.

[0034] The details of one or more embodiments of the present invention are set forth in the following description. Other features and advantages of the present invention will become apparent from the following drawings and detailed description of several embodiments, as well as from the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The following drawings form part of this specification and are included to further illustrate certain aspects of the present disclosure, which may be better understood by reference to the drawings in combination with the detailed description of specific embodiments presented herein.

[0036] Figures 1A-1C Included are graphs demonstrating TDP-43 knockdown in SH-SY5Y cells. Figure 1A Shown is a 1.4-fold knockdown of TDP-43 in SH-SY5Y cells using siTDP-43 RNA. Figure 1B It is shown that knockdown of TDP-43 in the presence of a control RNP complex (ie, an RNP complex that does not target STMN2 exon 2a) results in a 60-fold increase in STMN2 exon 2a splice variants. Figure 1C It was shown that knockdown of TDP-43 in the presence of a control RNP complex (ie, an RNP complex not targeted to STMN2 exon 2a) resulted in a greater than 90-fold reduction in the STMN2 full-length isoform.

[0037] Figures 2A-2C Included are figures showing indel activity and splicing motif disruption of RNA guides tested in SH-SY5Y cells. Figure 2A It is shown that RNA guides 55 and 56 exhibit the highest motif disruption among all guides tested. Figure 2B Correlation between RNA guides that facilitated recovery of full-length STMN2 and primary indels is shown. Figure 2C Correlation between RNA guides promoting full-length STMN2 recovery and motif disruption is shown.

[0038] Figures 3A-3D Included are graphs showing the effects on STMN2 transcript production by targeting the STMN2 exon 2a splice site and TDP-43 binding site using Cas12i2. Figure 3A The 3' splice site, 10-nt window, and TBD-43 binding site in the corresponding region of the STMN2 gene are shown. Figure 3A The nucleotide sequence presented is shown as SEQ ID NO: 256. Figure 3B Figure 5 shows that disruption of the TDP-43 binding site with RNA guide 12 recapitulates the effects of siRNA TDP-43 knockdown. In the absence of siRNA-mediated TDP-43 knockdown and in the presence of RNA guide 12, splice site disruption by RNA guide 55 resulted in a decrease in exon 2a splice variants ( Figure 3C ) and full-length STMN2 increased ( Figure 3D NT: non-targeting guide. 12: Guide 12 (targeting the TDP-43 binding site). 55: Guide 55 (see Table 2).

[0039] Figures 4A-4B Included is a figure showing a representative plot of one analyzed data set, illustrating the maximum correlation observed across a 10-nt window starting at amplicon position 106 (see SEQ ID NO: 1). Figure 4A The correlation values ​​between the indel rate at the transguide position and the STMN2 recovery rate (y-axis) are shown for all amplicon positions (x-axis), with the position of maximum correlation (black dashed line) plotted. Figure 4B Shown are scatter plots of guide position indel rates (x-axis) and STMN2 recovery rates (y-axis) for a 10-nt window starting at position 106.

[0040] Figures 5A-5GIncluded is a graph showing the locations of indels induced by specific guides within the STMN2 amplicon (x-axis). The number of NGS reads is on the y-axis. Minimal or no full-length STMN2 recovery was observed for guides that did not induce indels within any window. Figure 5A : Wizard G1-G3. Figure 5B : Wizard G4-G6. Figure 5C : Wizard G7-G9. Figure 5D : Wizards G10, G11 and G50. Figure 5E : Wizard G51-G53. Figure 5F : Wizard G54-G56. Figure 5G Guides G57 and G58. Indel positions on the x-axis are numbered in base pairs (bp) relative to SEQ ID NO: 1. 3' splice site: positions 99-104 (region defined by the solid line, with the sequence TTGCAG); identified optimal 10-nt window: positions 106-115 (region defined by the dashed line; with the sequence ACTCGGCAGA (SEQ ID NO: 2)). See SEQ ID NO: 1 below.

[0041] Figure 6 is a graph showing RNA guides that produced >5% motif disruption (shown in bold in Table 6).

[0042] Figures 7A-7G Included are graphs showing the locations of indels induced by specific guides, as indicated by association with nuclease A within the STMN2 amplicon (x-axis). Figure 7A : Wizard A_STMN2_Splicing 2a_1. Figure 7B : Wizard A_STMN2_Splicing 2a_3. Figure 7C : Wizard A_STMN2_Splicing 2a_2. Figure 7D : Wizard A_STMN2_Splicing 2a_4. Figure 7E : Wizard A_STMN2_Splicing 2a_5. Figure 7F : Wizard A_STMN2_Splicing 2a_7. Figure 7G : Wizard A_STMN2_Splicing 2a_6.

[0043] Figures 8A-8E Included are graphs showing the locations of indels induced by specific guides, as indicated by association with nuclease C within the STMN2 amplicon (x-axis). Figure 8A : Wizard C_STMN2_Splicing2a_36. Figure 8B : Wizard C_STMN2_Splicing2a_38. Figure 8C : Wizard C_STMN2_Splicing2a_37. Figure 8D: Wizard C_STMN2_Splicing2a_39. Figure 8E : Wizard C_STMN2_Splicing2a_43.

[0044] Figures 9A-9K Included are graphs showing that editing of the 3' splice site disclosed herein rescues the increased production of STMN2 exon 2A splice variants caused by specific guide-induced TDP-43 knockdown and indel locations, as indicated by association with nuclease A in SH-SY5Y cells. Figure 9A : is a graph showing that 3-fold TDP-43 knockdown was observed in SH-SY5Y cells using siTDP-43 RNA. Figure 9B : Graph showing that knockdown of TDP-43 in the presence of a non-targeting control RNP complex results in an 80-fold increase in the STMN2 exon 2A splice variant. Figure 9C : Graph showing that knockdown of TDP-43 in the presence of a non-targeting control RNP complex reduces STMN2 full-length transcript by more than 7.5-fold. Figure 9D It is a graph showing the indel activity of nuclease A in SH-SYSY cells. Figure 9E : Wizard A_STMN2_Splicing 2a_1. Figure 9F : Wizard A_STMN2_Splicing 2a_2. Figure 9G : Wizard A_STMN2_Splicing 2a_3. Figure 9H : Wizard A_STMN2_Splicing 2a_4. Figure 9I : Wizard A_STMN2_Splicing 2a_5. Figure 9J : Wizard A_STMN2_Splicing 2a_6. Figure 9K : Wizard A_STMN2_Splicing 2a_7.

[0045] Figures 10A-10C Figure 3 shows that a gene editing system comprising nuclease A or nuclease D and an exemplary gRNA targeting the 3' splice site successfully rescues the increased production of the STMN2 exon 2A splice variant caused by TDP-43 knockdown. Figure 10A : Graph showing 3-fold and 5-fold TDP-43 knockdown observed in SH-SY5Y cells using siTDP-43 RNA when co-infected with RNPs containing type V CRISPR nuclease variants as indicated. Figure 10B : Graph showing that knockdown of TDP-43 in the presence of a non-targeting control RNP complex results in 120- and 130-fold increases in STMN2 exon 2A splice variants when co-infected with RNPs containing type V CRISPR nuclease variants as indicated. Figure 10C: Graph showing 8-fold and 10-fold reductions in STMN2 full-length transcripts observed with siTDP-43 knockdown and RNPs containing type V CRISPR nuclease variants as indicated.

[0046] Figures 11A-11P Included are diagrams demonstrating splicing motif disruption and reversal of STMN2 mis-splicing in human motor neurons and the locations of indels induced by specific guides as indicated by association with Cas12i2 in motor neurons. Figures 11A-11B demonstrated an inverse relationship between the decrease in truncated exon 2a STMN2 transcripts and the increase in full-length STMN2 transcripts with motif disruptions. Figure 11C Demonstrated indel activity in motor neurons correlates with restoration of full-length STMN2 transcripts. gNT: non-targeting guide control. Figure 11D : Guide STMN2_splicing2a_4 (G4). Figure 11E : Guide STMN2_splicing2a_8 (G8). Figure 11F : Guide STMN2_Splicing2a_9 (G9). Figure 11G : Guide STMN2_splicing2a_10 (G10). Figure 11H : Wizard STMN2_Splicing2a_50 (G50). Figure 11I : Guide STMN2_splicing2a_51 (G51). Figure 11J : Guide STMN2_splicing2a_52 (G52). Figure 11K : Guide STMN2_splicing2a_53 (G53). Figure 11L : Guide STMN2_splicing2a_54 (G54). Figure 11M : Guide STMN2_splicing2a_55 (G55). Figure 11N : Guide STMN2_splicing2a_56 (G56). Figure 11O : Guide STMN2_splicing2a_57 (G57). Figure 11P : Guide STMN2_splicing2a_58 (G58).

[0047] Figures 12A-12L Included are diagrams demonstrating nuclease A splicing motif disruption and STMN2 mis-splicing reversal in human motor neurons and the locations of indels induced by specific guides as indicated by association with nuclease A in motor neurons. Figures 12A-12B demonstrated an inverse relationship between the decrease in truncated exon 2a STMN2 transcripts and the increase in full-length STMN2 transcripts with motif disruptions. Figure 12C Demonstrated indel activity in motor neurons correlates with restoration of full-length STMN2 transcripts. gNT: non-targeting guide control. Figure 12DWe demonstrate STMN2 motif disruption in motor neurons analyzed by digital droplet polymerase chain reaction (ddPCR) assay. Figure 12E : Wizard A_STMN2_Splicing 2a_1. Figure 12F : Wizard A_STMN2_Splicing 2a_2. Figure 12G : Wizard A_STMN2_Splicing 2a_3. Figure 12H : Wizard A_STMN2_Splicing 2a_4. Figure 12I : Wizard A_STMN2_Splicing 2a_5. Figure 12J : Wizard A_STMN2_Splicing 2a_6. Figure 12K : Wizard A_STMN2_Splicing 2a_7. Figure 12L : comparison.

[0048] Figures 13A-13D Includes images and figures showing phenotypic rescue in human motor neurons after reversal of STMN2 mis-splicing by Cas12i2 and the RNA guide G55. Figure 13A Shown are representative images from different conditions tested in the presence or absence of TDP43 knockdown and a non-targeting control guide or guide 55. Cells were stained with B3 tubulin and STMN2, and nuclei were stained with Hoechst. Figure 13B and Figure 13D Shown are the rescue of axon length and the increase in STMN2-positive neurons observed after treatment with the RNA guide G55, respectively. Figure 13C Shows that treatment with the RNA guide G55 has no effect on cell number. gNT: non-targeting guide control.

[0049] Figures 14A-14G Included is a diagram showing gene editing of the STMN2 gene in mice by the gene editing system provided herein, which is delivered by an AAV vector. Figures 14A-14D Graphs showing in vivo AAV vector genome quantification, splicing motif disruption, and reversal of STMN2 mis-splicing. Figure 14A Shown are the numbers of VGs per diploid genome observed in mice injected ICV with the four different vectors. Figures 14B-14D In vivo motif disruption, reduction of truncated exon 2a STMN2 transcripts, and increase of full-length STMN2 transcripts after injection of the tested vectors are shown, respectively. Figures 14E-14G is a graph showing the correlation between editing percentage and STMN2 transcript levels in mice injected with nuclease A + g4. Figure 14E : Correlation between editing percentage and exon 2a STMN2 transcripts. Figure 14F : Correlation between editing percentage and full-length STMN2 transcript. Figure 14G An inverse relationship between exon 2a STMN2 transcripts and full-length STMN2 transcripts is shown.Control: Mice injected ICV with vehicle. DETAILED DESCRIPTION

[0050] Inhibitory microtubule assembly protein-2 (STMN2) (also known as SCG10) is a microtubule-associated protein that is enriched in the brain. STMN2 plays an important role in promoting microtubule instability required for normal axonal growth and regeneration. STMN2 expression is strongly regulated by the nuclear transactive responsive DNA-binding protein 43 kDa (TDP-43). TDP-43 binds to a site within intron 1 of the STMN pre-mRNA to regulate the production of functional STMN2 transcripts and, therefore, functional STMN2 protein. Certain diseases, such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), are associated with loss of nuclear TDP-43, which leads to aberrant splicing of STMN2, resulting in nonfunctional transcripts that include a cryptic exon 2a. Melamed et al., Nat. Neurosci. 2019 22(2):180-190.

[0051] This article reports that disrupting the 3' splice site in intron 1 (e.g., adjacent to the cryptic exon 2a) and / or a region downstream and adjacent to the 3' splice site through gene editing significantly inhibited aberrant splicing of STMN2 and increased the production of functional STMN2 transcripts (encoding functional STMN2 protein). Thus, provided herein are methods and gene editing systems (e.g., comprising a V-type CRISPR nuclease) designed to inhibit or prevent aberrant splicing of STMN2. Such methods and gene editing systems may potentially alleviate motor neuron dysfunction in diseases involving aberrant STMN2 splicing, such as ALS and FTD.

[0052] I. Gene Editing in the STMN2 Gene to Suppress Aberrant Splicing

[0053] The human STMN2 gene is located at 8q21.13. Reference gene ID: 11075 provides the complete sequence of the human STMN2 gene (ncbi.nlm.nih.gov / gene / 11075), the relevant disclosure of which is incorporated by reference for the purposes and subject matter cited herein.

[0054] Provided herein are methods for gene editing at specific locations within intron 1 of STMN2 to inhibit or prevent aberrant splicing and increase the production of functional STMN2 transcripts, and thus, functional STMN2 protein. As used herein, "aberrant splicing of STMN2" refers to RNA splicing events that produce non-functional transcripts that include cryptic exon 2a. Due to the presence of premature stop codons in exon 2a and premature poly(A) sites (see disclosure below), non-functional transcripts result in the production of truncated, non-functional STMN2 protein.

[0055] (a) Targeted gene loci

[0056] In some embodiments, the location in intron 1 for gene editing includes the 3' splice site in intron 1 of the STMN2 gene (e.g., a 3' splice site adjacent to and upstream of the exon 2a sequence), a region in intron 1 adjacent to and downstream of the 3' splice site, or a combination thereof, such that the gene editing results in a reduction or elimination of aberrant STMN2 splicing. The nucleotide sequence of a fragment of STMN2 intron 1 is provided below for reference purposes.

[0057] ACTTCCGAACTCATATAACCTGGGGATTTTATTACTCTGGGAATTATGTGTTCTGCCCCATCACTCTCTCTTAATTGGATTTTTAAAATTATATTCATA TTGCAG GACTCGGCAGAAGACCTTCGAGAGAAAGG TAG AAAATAAGAATTTGGCTCTCTGTGTGAGCATGTGTGCGTGTGTGCGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCGGCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAGCAATACTGAAGAA ATTAAA ACAAAAGATTGCTGTCTCAATATATCTTATATTTATTATTTACCAAATTATTCTAAGAGTATTTCTTCCTGAATACCATGTGAGAAAATTCTTAAGAATTTATTGAGTATGACTGTATATTTGAAAAGAGTG (SEQID NO: 1)

[0058] In the above sequence, the 3' splice site, TTGCAG, is indicated in bold and underlined. The intron 1 region, ACTCGGCAGA (SEQ ID NO: 2), located adjacent and downstream of the 3' splice site, also known as the optimal 10-nt window (also called the optimal disruption window), is indicated in bold and italics. The hidden exon 2a begins at the "G" residue following the 3' splice site. Furthermore, the premature stop codon, TAG (which produces a truncated STMN2 protein when aberrant splicing occurs), and the premature poly(A) site, ATTAAA, are underlined.

[0059] In some examples, the gene editing methods disclosed herein target the 3' splice site, for example, causing the deletion of one or more nucleotides of the 3' splice site, thereby destroying its function as a 3' splice site. In other examples, the gene editing methods disclosed herein target a region adjacent to the 3' splice site as disclosed herein, for example, causing the deletion of one or more nucleotides in this region. In a specific example, the gene editing methods disclosed herein target the 3' splice site and the downstream adjacent region, causing the deletion of one or more nucleotides in the two regions.

[0060] Targeting the 3' splice site, the optimal 10-nt window, or both, as provided herein, is expected to reduce the production of splice variants containing exon 2a and increase the production of full-length STMN2 transcripts.

[0061] As used herein, the term "adjacent" refers to a nucleotide or amino acid sequence that is in close proximity to another nucleotide or amino acid sequence. In some embodiments, a nucleotide sequence is adjacent to (i.e., directly adjacent to) another nucleotide sequence if no nucleotides separate the two sequences. In some embodiments, a nucleotide sequence is adjacent to another nucleotide sequence if a small number of nucleotides separate the two sequences (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides). In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by at most 2 nucleotides, at most 5 nucleotides, at most 8 nucleotides, or at most 10 nucleotides.

[0062] As used herein, the terms "upstream" and "downstream" refer to relative positions within a single nucleic acid (e.g., DNA) sequence. "Upstream" and "downstream" each relate to the 5' to 3' direction in which RNA transcription occurs. A first sequence is upstream of a second sequence when its 3' end precedes its 5' end. A first sequence is downstream of a second sequence when its 5' end follows its 3' end.

[0063] In other embodiments, the gene editing systems provided herein (e.g., comprising a V-type nuclease having an amino acid sequence at least 90% identical to SEQ ID NO: 4) can be targeted to a genomic site within the STMN2 gene to reduce the production of splice variants containing exon 2a. In some cases, such gene editing systems can be targeted to a genomic site within the STMN2 gene to disrupt the expression of the STMN2 gene.

[0064] In other embodiments, the gene editing systems provided herein (e.g., comprising a V-type nuclease having an amino acid sequence at least 90% identical to SEQ ID NO: 4) can be targeted to a genomic site within the STMN2 gene to reduce the production of splice variants containing exon 2a. In some cases, such gene editing systems can be targeted to a genomic site within the STMN2 gene to disrupt the expression of the STMN2 gene.

[0065] Gene editing methods can enable gene editing at target locations as disclosed herein. As used herein, the term "editing" refers to one or more modifications introduced into one or more target locations in the STMN2 gene. Editing can be one or more substitutions, one or more insertions, one or more deletions, or a combination thereof. As used herein, the term "substitution" refers to the replacement of one or more nucleotides with different one or more nucleotides relative to a reference sequence. As used herein, the term "insertion" refers to the gain of one or more nucleotides in a nucleic acid sequence relative to a reference sequence. As used herein, the term "deletion" refers to the loss of one or more nucleotides in a nucleic acid sequence relative to a reference sequence.

[0066] Gene editing methods as disclosed herein can be performed on suitable cells (e.g., cells that produce STMN2 and may produce, or are at risk of producing, non-functional transcripts due to aberrant splicing events) to edit a specific genetic location within intron 1 of STMN2, as also disclosed herein. In some embodiments, the suitable cells can be neutrophil cells, for example, obtained from a human patient with a disease involving aberrant STMN2 splicing (such as ALS or FTD). In some cases, gene editing can be performed on cells cultured in vitro. Alternatively, gene editing can be performed in vivo to edit cells (e.g., neuronal cells) in a subject in need thereof (e.g., a human patient with ALS or FTD).

[0067] (ii) Gene editing methods

[0068] Gene editing of the STMN2 gene at a specific location described herein can be achieved by gene editing systems known in the art, such as CRISPR / Cas-mediated gene editing systems (e.g., involving CRISPR nucleases such as V-type nucleases), zinc finger nuclease (ZFN)-mediated gene editing systems, or transcription activator-like effector nuclease (TALEN)-mediated gene editing systems. Other examples include the DICE (double integrase cassette exchange) system using phiC31 and Bxb1 integrases.

[0069] In some embodiments, gene editing of the STMN2 gene as disclosed herein can be achieved using a gene editing system comprising a CRISPR nuclease and one or more guide RNAs targeted to appropriate genomic locations in the STMN2 gene to introduce the desired edit at the desired location, including the 3' splice site and / or a 10-nt downstream window as disclosed herein. The term "CRISPR nuclease" refers to an RNA-guided effector capable of binding nucleic acids and introducing single-strand breaks or double-strand breaks. In some embodiments, the CRISPR nuclease may be a type II CRISPR nuclease, which refers to a nuclease comprising a RuvC domain and an HNH domain. A type II nuclease may be a type II-A nuclease, a type II-B nuclease, or a type II-C nuclease. In some embodiments, a type II nuclease requires a tracrRNA. In some embodiments, the type II nuclease is a Cas9 polypeptide. The Cas9 polypeptide can cleave double-stranded DNA targets or act as a nickase. In other embodiments, the CRISPR nuclease may be a type V CRISPR nuclease (see detailed disclosure below). In some embodiments, the CRISPR nuclease is an effector, as described in Makarova et al., Classification and Nomenclature of CRISPR-Cas Systems: Where from Here?” CRISPR J. 1(5):325-36 (2018).

[0070] In addition to the CRISPR methods disclosed herein, other gene editing methods known in the art can also be used to prepare the genetically engineered T cells disclosed herein. Some examples include gene editing methods involving zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), restriction endonucleases, meganucleases, homing endonucleases, etc.

[0071] ZFNs are targeted nucleases comprised of a nuclease fused to a zinc finger DNA binding domain (ZFBD), a polypeptide domain that binds to DNA in a sequence-specific manner via one or more zinc fingers. Zinc fingers are approximately 30 amino acid domains within the zinc finger binding domain, their structure stabilized by the coordination of zinc ions. Examples of zinc fingers include, but are not limited to, C2H2 zinc fingers, C3H zinc fingers, and C4 zinc fingers. A designed zinc finger domain is a domain not found in nature whose design / composition is primarily derived from rational criteria, such as the application of substitution rules and computerized algorithms to databases containing existing ZFP design and binding data. See, for example, U.S. Patent Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536; and WO 03 / 016496. The zinc finger domain selected is a domain not found in nature and is generated primarily through empirical methods such as phage display, interaction trapping, or hybrid selection. ZFNs are described in more detail in U.S. Patent Nos. 7,888,121 and 7,972,854. The most recognized example of a ZFN is a fusion of the FokI nuclease with a zinc finger DNA binding domain.

[0072] TALENs are targeted nucleases that comprise a nuclease fused to a TAL effector DNA binding domain. A "transcription activator-like effector DNA binding domain," "TAL effector DNA binding domain," or "TALE DNA binding domain" is a polypeptide domain of a TAL effector protein that is responsible for binding the TAL effector protein to DNA. TAL effector proteins are secreted by plant pathogens of the genus Xanthomonas during infection. These proteins enter the nucleus of plant cells, bind to effector-specific DNA sequences via their DNA binding domains, and activate gene transcription at these sequences via their transactivation domains. TAL effector DNA binding domain specificity depends on the variable number of effectors of an imperfect 34-amino acid repeat sequence that contains polymorphisms at selected repeat positions, termed repeat variable diresidues (RVDs). TALENs are described in more detail in U.S. Patent Application No. 2011 / 0145940. The most recognized example of a TALEN in the art is a fusion polypeptide of the FokI nuclease and the TAL effector DNA binding domain.

[0073] Other examples of suitable targeted nucleases as provided herein include, but are not limited to, Bxb1, phiC31, R4, PhiBT1, and Wβ / SPBc / TP901-1, whether used alone or in combination.

[0074] Any nuclease disclosed herein can be delivered using a vector system, including but not limited to plasmid vectors, DNA minicircles, retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors, poxvirus vectors, herpesvirus vectors and adeno-associated virus vectors and combinations thereof. Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids encoding nucleases and gRNAs into cells (e.g., T cells). In some instances, the gene editing system disclosed herein or its components (e.g., the nuclease therein) can be delivered via an AAV vector, which can be a specific serotype (e.g., AAVrh10) capable of infecting neuronal cells. Non-viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes or poloxamers. Viral vector delivery systems include DNA viruses and RNA viruses that have episomal or integrated genomes after delivery to cells. Non-viral delivery methods for nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycationic or lipid:nucleic acid conjugates, naked DNA, naked RNA, capped RNA, artificial virions, and agent-enhanced DNA uptake. Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used for the delivery of nucleic acids. Some specific examples are provided below.

[0075] Alternatively, the nucleases disclosed herein can be delivered via mRNA, which can be associated with or encapsulated by lipid nanoparticles (LNPs).

[0076] To perform the gene editing methods disclosed herein, a suitable gene editing system as disclosed herein can be delivered or introduced into a cell population (e.g., neuronal cells). In some cases, cells containing the desired gene editing can be collected and optionally cultured and expanded in vitro.

[0077] II. Gene Editing Systems Containing Type V Nucleases

[0078] In some aspects, the present disclosure provides a CRISPR V-type nuclease-mediated gene editing system for introducing an edit (e.g., a deletion) at a desired genetic location in the STMN2 gene as disclosed herein, to introduce the gene edit into a desired location in the STMN2 gene, including a 3' splice site adjacent to (upstream of) the cryptic exon 2a and / or a downstream optimal 10-nt window in intron 1, thereby reducing or preventing the inclusion of the cryptic exon 2a and increasing the production of functional STMN2 transcripts. In some embodiments, the CRISPR V-type nuclease-mediated gene editing system comprises a V-type nuclease or a nucleic acid encoding the nuclease, and one or more RNA guides, or one or more nucleic acids encoding one or more gRNAs, targeted to a suitable genomic site within the STMN2 gene (e.g., intron 1), as also disclosed herein.

[0079] (i) Type V nuclease

[0080] As used herein, the terms "V-type" and "V-type nuclease" refer to RNA-guided CRISPR nucleases with a RuvC domain. In some embodiments, a V-type nuclease does not require a tracrRNA. In some embodiments, a V-type nuclease requires a tracrRNA. In some embodiments, the V-type nuclease is a Cas12 polypeptide, such as a Cas12a (Cpf1), Cas12b (C2c1), Cas12c, Cas12d, Cas12e, Cas12f, Cas12h, Cas12i, or Cas12j (CasPhi) polypeptide.

[0081] (a) Cas12i nuclease

[0082] "Cas12i nuclease" (also referred to herein as Cas12i) refers to a polypeptide that binds to a target sequence on a target nucleic acid specified by an RNA guide, wherein the polypeptide has at least some amino acid sequence homology with a wild-type Cas12i nuclease. Such Cas12i polypeptides are known in the art or disclosed herein. See, for example, WO / 2021 / 202800 and WO2022256440, the relevant disclosures of each of which are incorporated herein by reference for the subject matter and purposes disclosed herein.

[0083] In some embodiments, the Cas12i nuclease is a Cas12i2 polypeptide. In one example, the Cas12i2 polypeptide used in the gene editing systems and methods disclosed herein can comprise one of the following amino acid sequences:

[0084] MSSAIKSYKS VLRPNERKNQ LLKSTIQCLE DGSAFFFKML QGLFGGITPE

[0085] IVRFSTEQEK QQQDIALWCA VNWFRPVSQD SLTHTIASDN LVEKFEEYYG

[0086] GTASDAIKQY FSASIGESYY WNDCRQQYYD LCRELGVEVS DLTHDLEILC

[0087] REKCLAVATE SNQNNSIISV LFGTGEKEDR SVKLRITKKI LEAISNLKEI

[0088] PKNVAPIQEI ILNVAKATKE TFRQVYAGNL GAPSTLEKFI AKDGQKEFDL

[0089] KKLQTDLKKV IRGKSKERDW CCQEELRSYV EQNTIQYDLW AWGEMFNKAH

[0090] TALKIKSTRN YNFAKQRLEQ FKEIQSLNNL LVVKKLNDFF DSEFFSGEET

[0091] YTICVHHLGG KDLSKLYKAW EDDPADPENA IVVLCDDLKN NFKKEPIRNI

[0092] LRYIFTIRQE CSAQDILAAA KYNQQLDRYK SQKANPSVLG NQGFTWTNAV

[0093] ILPEKAQRND RPNSLDLRIW LYLKLRHPDG RWKKHHIPFY DTRFFQEIYA

[0094] AGNSPVDTCQ FRTPRFGYHL PKLTDQTAIR VNKKHVKAAK TEARIRLAIQ

[0095] QGTLPVSNLK ITEISATINS KGQVRIPVKF RVGRQKGTLQ IGDRFCGYDQ

[0096] NQTASHAYSL WEVVKEGQYH KELGCFVRFI SSGDIVSITE NRGNQFDQLS

[0097] <h2 style=";text-align:left;direction:ltr">YEGLAYPQYA DWRKKASKFV SLWQITKKNK KKEIVTVEAK EKFDAICKYQ<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0098] <h2 style=";text-align:left;direction:ltr"> PRLYKFNKEY AYLLRDIVRG KSLVELQQIR QEIFRFIEQD CGVTRLGSLS<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0099] <h2 style=";text-align:left;direction:ltr"> LSTLETVKAV KGIIYSYFST ALNASKNNPI SDEQRKEFDP ELFALLEKLE<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0100] <h2 style=";text-align:left;direction:ltr"> LIRTRKKKQK VERIANSLIQ TCLENNIKFI RGEGDLSTTN NATKKKANSR<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0101] <h2 style=";text-align:left;direction:ltr"> SMDWLARGVF NKIRQLAPMH NITLFGCGSL YTSHQDPLVH RNPDKAMKCR<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0102] <h2 style=";text-align:left;direction:ltr"> WAAIPVKDIG DWVLRKLSQN LRAKNRGTGE YYHQGVKEFL SHYELQDLEE<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0103] <h2 style=";text-align:left;direction:ltr"> ELLKWRSDRK SNIPCWVLQN RLAEKLGNKE AVVYIPVRGG RIYFATHKVA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0104] <h2 style=";text-align:left;direction:ltr"> TGAVSIVFDQ KQVWVCNADH VAAANIALTG KGIGEQSSDE ENPDGSRIKL<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0105] <h2 style=";text-align:left;direction:ltr"> QLTS(SEQ ID NO: 3)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0106]

[0107] In some cases, the Cas12i2 polypeptide can comprise an amino acid sequence that is at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 3 or SEQ ID NO: 266. In one example, the Cas12i2 polypeptide comprises the amino acid sequence of SEQ ID NO: 3. In another example, the Cas12i2 polypeptide comprises the amino acid sequence of SEQ ID NO: 266.

[0108] The "percent identity" (also known as sequence identity) of two nucleic acid or amino acid sequences is determined using the algorithm of Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 87:2264-68, 1990, as modified in Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 90:5873-77, 1993. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul et al., J. Mol. Biol., 215:403-10, 1990. BLAST nucleotide searches can be performed with the NBLAST program (score = 100, wordlength = 12) to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program (score = 50, wordlength = 3) to obtain amino acid sequences homologous to the protein molecules of the invention. In the event that there is a gap between the two sequences, Gapped BLAST can be used as described in Altschul et al., Nucleic Acids Res., 25(17):3389-3402, 1997. When utilizing BLAST programs and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

[0109] In some cases, the Cas12i2 polypeptide may comprise one or more conservative amino acid substitutions compared to SEQ ID NO: 3. In some cases, the Cas12i2 polypeptide may comprise one or more conservative amino acid substitutions compared to SEQ ID NO: 266. As used herein, "conservative amino acid substitutions" refer to amino acid substitutions that do not change the relative charge or size characteristics of the protein to which the amino acid substitution is made. Variants can be prepared according to methods known to those of ordinary skill in the art for changing polypeptide sequences, as found in references for compiling such methods, such as Molecular Cloning: A Laboratory Manual, edited by J. Sambrook et al., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, edited by FM Ausubel et al., John Wiley & Sons, Inc., New York. Conservative substitutions of amino acids include substitutions between amino acids in the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.

[0110] (b) Other V-type nucleases

[0111] Other V-type nucleases can also be used in the gene editing systems and methods disclosed herein. Exemplary suitable V-type nucleases can be found in WO2019178427, WO2021202800, WO2021050534, WO2022192391, WO2024020567, WO2022192381, WO2024020557, WO2020018142 and WO2023039472, and the relevant disclosures of each document in the document are incorporated by reference for the themes and purposes cited herein. Specific examples of V-type nucleases are provided in Table 1 below, and all examples are within the scope of the present disclosure.

[0112] In some cases, the V-type nuclease can comprise an amino acid sequence that is at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4. Alternatively or additionally, the V-type nuclease can comprise one or more conservative amino acid substitutions relative to SEQ ID NO: 4. In a specific example, the V-type nuclease comprises the amino acid sequence of SEQ ID NO: 4 (nuclease A listed in Table 1 below). In a specific example, the V-type nuclease comprises the amino acid sequence of SEQ ID NO: 255 (nuclease D listed in Table 1 below).

[0113] In some cases, the V-type nuclease can comprise an amino acid sequence that is at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 5. Alternatively or additionally, the V-type nuclease can comprise one or more conservative amino acid substitutions relative to SEQ ID NO: 5. In a specific example, the V-type nuclease comprises the amino acid sequence of SEQ ID NO: 5 (Nuclease B listed in Table 1 below).

[0114] In some cases, the V-type nuclease can comprise an amino acid sequence that is at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 6. Alternatively or additionally, the V-type nuclease can comprise one or more conservative amino acid substitutions relative to SEQ ID NO: 6 (nuclease C listed in Table 1 below).

[0115] Table 1. Amino acid sequences of exemplary V-type nucleases

[0116]

[0117]

[0118] Any of the V-type nuclease polypeptides provided herein, such as the Cas12i2 nuclease or other V-type nucleases provided herein, can comprise one or more nuclear localization signals (NLS), such as at the N-terminus, at the C-terminus, or both.

[0119] (c) Preparation of V-type nuclease

[0120] In some embodiments, V-type nucleases such as Cas12i2 polypeptides or other V-type nucleases as disclosed herein (as well as any suitable nucleases for gene editing known in the art or as disclosed herein) can be prepared by: (a) culturing host cells capable of producing proteins, such as bacterial cells or mammalian cells, isolating the protein so produced, and optionally purifying the protein. Nucleases can also be prepared by (b) known genetic engineering techniques, specifically, by isolating a gene encoding a nuclease from bacteria, constructing a recombinant expression vector, and then transferring the vector into an appropriate host cell, wherein the vector expresses a guide RNA complexed with the nuclease in the host cell. Alternatively, the nuclease can be prepared by (c) an in vitro coupled transcription-translation system and then complexed with the guide RNA.

[0121] Unless otherwise indicated, all compositions and complexes and polypeptides provided herein are prepared with reference to the activity level of the composition, complex or polypeptide and do not include impurities, such as residual solvents or by-products, that may be present in commercially available sources. Enzymatic component weights are based on total active protein. Unless otherwise indicated, all percentages and ratios are calculated by weight. Unless otherwise indicated, all percentages and ratios are calculated based on the total composition. In the exemplified compositions, enzymatic levels are expressed as the weight of the pure enzyme relative to the total composition, and unless otherwise indicated, ingredients are expressed as the weight of the total composition.

[0122] carrier

[0123] The gene editing system disclosed herein can include a nucleic acid encoding the type V CRISPR nuclease. In some instances, the nucleic acid is a vector comprising a nucleotide sequence encoding the type V CRISPR nuclease. In some cases, the nucleotide sequence encoding the type V CRISPR nuclease can be operably linked to a promoter (e.g., a synapsin 1 promoter). In some instances, the vector is an adeno-associated virus (AAV) vector, e.g., an AAV vector of a suitable serotype that can infect neuronal cells. In one example, the AAV vector can be an AAVrh10 vector.

[0124] The present disclosure provides one or more vectors for expressing the V-type nucleases disclosed herein (as well as other suitable nucleases as also disclosed herein). In some embodiments, the vectors disclosed herein include a nucleotide sequence encoding a nuclease. The present disclosure also provides one or more vectors encoding a guide RNA. In some embodiments, the vectors include a U6 promoter, a synapsin promoter, a Pol II promoter, and / or a Pol III promoter.

[0125] Expression of natural or synthetic polynucleotides is typically achieved by operably linking a polynucleotide encoding a gene of interest, such as a nucleotide sequence encoding a V-type nuclease, to a promoter and incorporating the construct into an expression vector. The expression vector is not particularly limited, as long as it includes a polynucleotide encoding a nuclease and / or a guide RNA and is suitable for replication and integration in eukaryotic cells.

[0126] Typical expression vectors include transcriptional and translational terminators, initiation sequences, and promoters for the desired polynucleotide expression. For example, plasmid vectors carrying RNA polymerase recognition sequences (pSP64, pBluescript, etc.) can be used. Vectors derived from retroviruses such as lentiviruses are suitable tools for achieving long-term gene transfer because they allow for the long-term stable integration of transgenes and their propagation in daughter cells. Examples of vectors include expression vectors, replication vectors, probe generation vectors, and sequencing vectors. Expression vectors can be delivered to cells in the form of viral vectors.

[0127] Viral vector technology is well known in the art and is described in various virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, bacteriophage viruses, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. Typically, suitable vectors contain an origin that is replicable in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers.

[0128] The type of vector is not particularly limited, and any vector that can be expressed in host cells can be appropriately selected. More specifically, depending on the type of host cell, a promoter sequence that ensures expression of the polypeptide from the polynucleotide is appropriately selected, and this promoter sequence and the polynucleotide are inserted into any of various plasmids or the like for preparation of an expression vector.

[0129] Additional promoter elements, such as enhancer sequences, regulate the frequency of transcription initiation. Typically, these are located in the region 30-110 bp upstream of the start site, but many promoters have recently been shown to contain functional elements downstream of the start site as well. Depending on the promoter, it appears that each element may act synergistically or independently to activate transcription.

[0130] Furthermore, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present disclosure. The use of inducible promoters provides a molecular switch that can turn on the expression of a polynucleotide sequence operably linked thereto when such expression is desired, or turn off said expression when expression is not desired. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0131] In some embodiments, the expression vectors provided herein can comprise a nucleotide sequence encoding any of the V-type nucleases disclosed herein (e.g., SEQ ID NO: 3, SEQ ID NO: 266, or SEQ ID NO: 4) and a nucleotide sequence encoding a guide RNA also disclosed herein. For example, an expression vector can comprise a nucleotide sequence encoding the V-type nuclease of SEQ ID NO: 3 or SEQ ID NO: 266 and a nucleotide sequence encoding a guide for G53, G55, or G56. In other examples, an expression vector can comprise a nucleotide sequence encoding the V-type nuclease of SEQ ID NO: 4 or SEQ ID NO: 255 and a nucleotide sequence encoding a guide for A_STMN2_splicing2a_4 or A_STMN2_splicing2a_3. In some cases, the sequence encoding the nuclease and the sequence encoding the guide RNA can each be operably linked to a suitable promoter. For example, the sequence encoding the nuclease can be operably linked to the synapsin 1 promoter, and the sequence encoding the guide RNA can be operably linked to the U6 promoter.

[0132] The expression vector to be introduced can also contain any one or both of a selectable marker gene or a reporter gene to promote identification and selection of expressing cells from a cell colony sought to be transfected or infected by a viral vector. In other aspects, selectable markers can be carried on a separate DNA fragment and used for a co-transfection procedure. Both selectable markers and reporter genes can be flanked by appropriate transcription control sequences to enable expression in host cells. Examples of such markers include dihydrofolate reductase genes and neomycin resistance for eukaryotic cell culture, and tetracycline resistance genes and ampicillin resistance genes for cultivation in Escherichia coli and other bacteria. By using such selectable markers, it can be confirmed whether the polynucleotide encoding the polypeptide of the present invention has been transferred into a host cell and then successfully expressed.

[0133] The method for preparing the recombinant expression vector is not particularly limited, and examples thereof include methods using a plasmid, a phage, or a cosmid.

[0134] Expression

[0135] The present disclosure includes a method for expressing a V-type nuclease (and other suitable nucleases) in a host cell of interest.

[0136] In some embodiments, the host cells described herein are used to express V-type nucleases (and other suitable nucleases) and / or guide RNAs. The host cells are not particularly limited, and various known cells can be preferably used. Specific examples of host cells include bacteria such as Escherichia coli, yeast (budding yeast, Saccharomyces cerevisiae and fission yeast, Schizosaccharomyces pombe), nematodes (Caenorhabditis elegans), Xenopus laevis oocytes, and animal cells (e.g., CHO cells, COS cells, and HEK293 cells). The method for transferring the expression vectors described above into host cells, i.e., the transformation method, is not particularly limited, and known methods such as electroporation, calcium phosphate method, liposome method, and DEAE dextran method can be used.

[0137] After transforming a host with the expression vector, the host cells can be cultured, grown, or propagated to produce the V-type nuclease and / or guide RNA. Following expression of the nuclease and / or guide RNA, the host cells can be harvested and the nuclease and / or guide RNA can be purified from the culture medium, etc., according to conventional methods (e.g., filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, etc.).

[0138] A variety of methods can be used to determine the production level of mature V-type nucleases (or other suitable nucleases) and / or guide RNAs in host cells. Such methods include, but are not limited to, methods utilizing, for example, polyclonal or monoclonal antibodies specific for proteins or marker tags as described elsewhere herein. Exemplary methods include, but are not limited to, enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), fluorescence immunoassays (FIAs), and fluorescence-activated cell sorting (FACS). These and other assays are well known in the art (see, for example, Maddox et al., J. Exp. Med. 158:1211

[1983] ).

[0139] The present disclosure provides methods for expressing nucleases and / or guide RNAs in vivo in cells (e.g., in neuronal cells). Such methods may comprise providing polyribonucleotides encoding nucleases and / or guide RNAs to suitable cells (e.g., neuronal cells). Expression of the nucleases and guide RNAs in cells can produce the desired gene editing in the cells. In some embodiments, the V-type nucleases and gRNAs disclosed herein can be delivered to host cells (e.g., neuronal cells, such as motor neuron cells) via one or more viral vectors, such as AAV vectors (e.g., AAVrh10). In some instances, expression of the V-type nucleases in neuronal cells can be under the control of a suitable promoter, such as the synapsin 1 promoter. In some instances, expression of the gRNA nucleases in neuronal cells can be under the control of a suitable promoter, such as the synapsin 1 promoter or the U6 promoter.

[0140] (ii) Guide RNA (gRNA)

[0141] Any gene editing system disclosed herein also includes one or more guide RNAs (gRNAs) that target a suitable genomic site within the STMN2 gene (e.g., within intron 1 of the STMN2 gene), enabling gene editing at the desired STMN2 location, including the 3' splice site within intron 1 (for inclusion of cryptic exon 2a) and a 10-nt downstream window, as disclosed herein. See SEQ ID NO: 1 provided above. The gRNA mediates cleavage of the target nucleic acid by a CRISPR nuclease, also included in the gene editing system. The RNA guide (or gRNA) comprises a nuclease binding sequence and a DNA binding sequence (spacer). The nuclease binding sequence can comprise one or more binding sites that can be recognized by the CRISPR nuclease for binding. In some cases, the gRNA is a single RNA molecule comprising both the nuclease binding sequence and the spacer. Alternatively, the gRNA can comprise the nuclease binding sequence and the spacer as two separate RNA molecules.

[0142] As used herein, the term "RNA guide" or "RNA guide sequence" refers to an RNA molecule that facilitates targeting of the CRISPR nucleases described herein to a genomic site of interest. For example, an RNA guide can be a molecule that recognizes (e.g., binds to) a site in the non-PAM strand that is complementary to a target sequence in the PAM strand, e.g., designed to be complementary to a specific nucleic acid sequence. RNA guides comprise a spacer and a nuclease-binding sequence (e.g., a direct repeat (DR) sequence). The terms CRISPR RNA (crRNA), pre-crRNA, and mature crRNA are also used herein to refer to RNA guides. The 5' or 3' end of the RNA guide can be fused to an RT donor RNA as disclosed herein.

[0143] As used herein, the term "protospacer-adjacent motif" or "PAM sequence" refers to a DNA sequence adjacent to a target sequence. In some embodiments, the PAM sequence is required for enzymatic activity. In a double-stranded DNA molecule, the strand containing the PAM motif is referred to as the "PAM strand," and the complementary strand is referred to as the "non-PAM strand." The RNA guide binds to a site in the non-PAM strand that is complementary to a target sequence disclosed herein, and a PAM sequence as described herein is present in the PAM strand.

[0144] As used herein, the term "PAM strand" refers to the (double-stranded) target nucleic acid strand that contains a PAM motif. In some embodiments, the PAM strand is the coding (e.g., sense) strand. In other embodiments, the PAM strand is the non-coding strand (e.g., antisense strand). The term "non-PAM strand" refers to the complementary strand of the PAM strand.

[0145] A guide RNA typically comprises a spacer sequence and a scaffold sequence. The spacer sequence (also known as a DNA binding sequence) is the RNA equivalent of the target sequence (DNA sequence). The spacer contains a sequence that is capable of binding to the non-PAM strand through base pairing at a site complementary to the target sequence (in the PAM strand). Such spacers are also said to be specific for the target sequence. In some cases, the spacer can be at least 75% (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) identical to the target sequence, excluding the RNA-DNA sequence differences. In some cases, the spacer can be 100% identical to the target sequence, excluding the RNA-DNA sequence differences. The scaffold sequence contains a motif that can be recognized by a nuclease (e.g., a V-type nuclease as disclosed herein).

[0146] As used herein, the term "target sequence" refers to a DNA fragment adjacent to a PAM motif (on a PAM strand). The complementary region of the target sequence is on a non-PAM strand. The target sequence may be adjacent to the PAM motif. Alternatively, the target sequence and the PAM may be separated by a small sequence segment (e.g., up to 5 nucleotides, e.g., up to 4, 3, 2, or 1 nucleotides). According to CRISPR nucleases that recognize PAM motifs known in the art, the target sequence may be located at the 3' end of the PAM motif or at the 5' end of the PAM motif. For example, the target sequence is located at the 3' end of the PAM motif of a Cas12i polypeptide (e.g., a Cas12i2 polypeptide, as disclosed herein) or other V-type nucleases (such as those disclosed herein (see Table 1 above)).

[0147] As used herein, the term "complementary" refers to a first polynucleotide (e.g., a spacer sequence of an RNA guide) having a degree of complementarity with a second polynucleotide (e.g., a complementary sequence to a target sequence) such that the first polynucleotide and the second polynucleotide can form a double-stranded complex through base pairing, thereby allowing an effector polypeptide (e.g., a V-type nuclease or variant thereof) complexed with the first polynucleotide to act on (e.g., cleave) the second polynucleotide. In some embodiments, the first polynucleotide can be substantially complementary to the second polynucleotide, i.e., have at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity with the second polynucleotide. In some embodiments, the first polynucleotide is fully complementary to the second polynucleotide, i.e., has 100% complementarity with the second polynucleotide.

[0148] Nuclease binding sequence (direct repeat sequence)

[0149] In some embodiments, the nuclease binding sequence in the gRNA disclosed herein is a CRISPR nuclease binding sequence (e.g., a nuclease binding sequence capable of binding to a type V nuclease or a type II nuclease). In some embodiments, the nuclease binding sequence comprises a direct repeat sequence. In certain embodiments, the nuclease binding sequence comprises a direct repeat sequence linked to a DNA binding sequence (e.g., a DNA-targeting sequence or a spacer). In some embodiments, the nuclease binding sequence comprises a direct repeat sequence and a DNA binding sequence or a direct repeat sequence-DNA binding sequence-direct repeat sequence. In some embodiments, the nuclease binding sequence comprises a truncated direct repeat sequence and a DNA binding sequence, which is typical of processed or mature crRNA.

[0150] In embodiments where the nuclease binding sequence is a direct repeat sequence of a publicly available CRISPR nuclease, those direct repeat sequences are known in the art. In some embodiments, the direct repeat sequence capable of binding to a CRISPR nuclease is any of the direct repeat sequences disclosed in WO2021055874, WO202020206036, WO2020191102, WO2020186213, WO2020028555, WO2020033601, WO2019126762, WO2019126774, WO2019071048, WO2019018423, WO2019005866, WO2018191388, WO2018170333, WO2018035388, WO2018 035387, WO2017219027, WO2017189308, WO2017184768, WO2017106657, WO2016205749, WO2017070605, WO2016205764, WO2016205711, WO20160 28682, WO2015089473, WO2014093595, WO2015089427, WO2014204725, WO2015070083, WO2014093655, WO2014093694, WO2014093712, WO201409 3635, WO2021133829, WO2021007177, WO2020197934, WO2020181102, WO2020181101, WO2020041456, WO2020023529, WO2020005980, WO2019104 058, WO2019089820, WO2019089808, WO2019089804, WO2019089796, WO2019036185, WO2018226855, WO2018213351, WO2018089664, WO20180643 71. WO2018064352, WO2017106569, WO2017048969, WO2016196655, WO2016106239, WO2016036754, WO2015103153, WO2015089277, WO201415062 4. WO2013176772, WO2021119563, WO2021118626, WO2020247883, WO2020247882, WO2020223634, WO2020142754, WO2020086475, WO2020028729,WO2019241452, WO2019173248, WO2018236548, WO2018183403, WO2017027423, WO2018106727, WO2018 071672, WO2017096328, WO2017070598, WO2016201155, WO2014150624, WO2013098244, WO20211113522 , WO2021050534, WO2021046442, WO2021041569, WO2021007563, WO2020252378, WO2020180699, WO2020018142, WO2019222555, WO2019178428, WO2019178427 or WO2019006471, which are incorporated by reference for the subject matter and purposes cited herein. ,

[0151] In some embodiments, the direct repeat sequence of the RNA guide has a length of between 12-100, 13-75, 14-50, or 15-40 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides).

[0152] In some examples, the nuclease binding sequence is capable of binding to a Cas12i polypeptide (e.g., SEQ ID NO: 3 or SEQ ID NO: 266, or a variant thereof, disclosed herein). See Table 2 below. For example, a direct repeat sequence (e.g., SEQ ID NO: 3 or SEQ ID NO: 266) that can be recognized by a Cas12i2 nuclease can comprise (e.g., consist of) a nucleotide sequence of 5'-AGAAAUCCGUCUUUCAUUGACGG-3' (SEQ ID NO: 36).

[0153] In other examples, the nuclease binding site can bind to other V-type nucleases disclosed herein, for example, SEQ ID NO: 4, 5, or 6, or variants thereof (e.g., SEQ ID NO: 255). See Tables 3-5 below. For example, a direct repeat sequence recognized by V-type nuclease A and variants thereof (e.g., SEQ ID NO: 4 or SEQ ID NO: 255) can comprise (e.g., consist of) a nucleotide sequence of 5'-CUUGUUGUAUAUGUCCUUUUAUAGGUAUUAAACAAC-3' (SEQ ID NO: 56).

[0154] DNA binding sequence (spacer)

[0155] The RNA guide also comprises a DNA binding sequence (also referred to as a spacer). The spacer can be about 7 nucleotides to about 100 nucleotides in length. For example, the spacer can be about 7 nucleotides to about 80 nucleotides, about 7 nucleotides to about 50 nucleotides, about 7 nucleotides to about 40 nucleotides, about 7 nucleotides to about 30 nucleotides, about 7 nucleotides to about 25 nucleotides, about 7 nucleotides to about 20 nucleotides, or about 7 nucleotides to about 19 nucleotides in length. For example, the spacer can be about 7 nucleotides to about 20 nucleotides, about 7 nucleotides to about 25 nucleotides, about 7 nucleotides to about 30 nucleotides, about 7 nucleotides to about 35 nucleotides, about 7 nucleotides to about 40 nucleotides, about 7 nucleotides to about 45 nucleotides, about 7 nucleotides to about 50 nucleotides, about 7 nucleotides to about 60 nucleotides, about 7 nucleotides to about 70 nucleotides, about 7 nucleotides to about 80 nucleotides, about 7 nucleotides to about 90 nucleotides, about 7 nucleotides to about 100 nucleotides, about 10 nucleotides to about 25 nucleotides, about 10 nucleotides to about 30 nucleotides, about 10 nucleotides to about 35 nucleotides, about 10 nucleotides to about 40 nucleotides, about 10 nucleotides to about 45 nucleotides, about 10 nucleotides to about 50 nucleotides, about 10 nucleotides to about 60 nucleotides, about 10 nucleotides to about 70 nucleotides, about 10 nucleotides to about 80 nucleotides, about 10 nucleotides to about 90 nucleotides, or about 10 nucleotides to about 100 nucleotides.

[0156] In some embodiments, spacers in RNA guides can generally be designed to be between 7 and 50 nucleotides or between 15 and 35 nucleotides in length (e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides) and to be complementary to a specific target sequence.

[0157] In some embodiments, the DNA binding sequence has at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to a target sequence as described herein and is capable of binding to a complementary region of the target sequence by base pairing.

[0158] In some embodiments, the DNA binding sequence comprises only RNA bases. In some embodiments, the DNA binding sequence comprises DNA bases (e.g., the spacer comprises at least one thymine). In some embodiments, the DNA binding sequence comprises both RNA bases and DNA bases (e.g., the DNA binding sequence comprises at least one thymine and at least one uracil).

[0159] In some cases, the RNA guides disclosed herein can further comprise an adapter sequence, a 5' end and / or a 3' end protection fragment (see disclosure herein), or a combination thereof.

[0160] The spacer in any RNA guide disclosed herein can be specific for the target sequence, i.e., can bind to a complementary region of the target sequence by base pairing. In some cases, the target sequence can be within a genomic site of interest, e.g., a site where gene editing is desired.

[0161] In some embodiments, the target sequence is adjacent to a PAM sequence. PAM sequences are known in the art. In some embodiments, PAM sequences that can be recognized by CRISPR nucleases are disclosed in the following documents: WO2021055874, WO2020206036, WO2020191102, WO2020186213, WO2020028555, WO2020033601, WO2019126762, WO2019126774, WO2019071048, WO2019018423, WO2019005866, WO2018191388, WO2018170333, WO2018035388, WO2018035387, WO201721 9027, WO2017189308, WO2017184768, WO2017106657, WO2016205749, WO2017070605, WO2016205764, WO2016205711, WO2016028682, WO201508947 3. WO2014093595, WO2015089427, WO2014204725, WO2015070083, WO2014093655, WO2014093694, WO2014093712, WO2014093635, WO2021133829, W O2021007177, WO2020197934, WO2020181102, WO2020181101, WO2020041456, WO2020023529, WO2020005980, WO2019104058, WO2019089820, WO20 19089808, WO2019089804, WO2019089796, WO2019036185, WO2018226855, WO2018213351, WO2018089664, WO2018064371, WO2018064352, WO20171 06569, WO2017048969, WO2016196655, WO2016106239, WO2016036754, WO2015103153, WO2015089277, WO2014150624, WO2013176772, WO20211195 63. WO2021118626, WO2020247883, WO2020247882, WO2020223634, WO2020142754, WO2020086475, WO2020028729, WO2019241452, WO2019173248,WO2018236548, WO2018183403, WO2017027423, WO2018106727, WO2018071672, WO2017096328, W O2017070598, WO2016201155, WO2014150624, WO2013098244, WO2021113522, WO2021050534, WO2 021046442, WO2021041569, WO2021007563, WO2020252378, WO2020180699, WO2020018142, WO2019222555, WO2019178428, WO2019178427 or WO2019006471, the relevant disclosure of each of which is incorporated herein for the subject matter and purposes cited.

[0162] When the gene editing system comprises a Cas12i polypeptide, the PAM sequence comprises 5'-NTTN-3' (or 5'-TTN-3'), where N is any nucleotide (e.g., A, G, T, or C). The PAM sequence is upstream of the target sequence. PAM sequences associated with other CRISPR nucleases can comprise the sequence 5'-TTY-3' or 5'-TTB-3', where Y is C or T, and B is G, T, or C. The PAM sequence can be immediately adjacent to the target sequence, or, for example, within a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides of the target sequence.

[0163] When the gene editing system comprises other V-type nucleases as disclosed herein, the PAM comprises a 5'-NTTR-3' motif, wherein N is any one of A, T, G, and C; and R is A or G. The PAM motif is located at the 5' end of the target sequence.

[0164] The PAM sequences of nuclease AD are provided in Tables 3-5.

[0165] In some embodiments, the gRNA of the Cas12i2 (SEQ ID NO: 3 or SEQ ID NO: 266) nuclease may comprise the same spacer sequence as any of the gRNAs provided in Table 2 below. In one example, the gRNA may comprise the same spacer sequence as gRNA G53 (CUACCUUUCUCUCGAAGGUC; SEQ ID NO: 267). In another example, the gRNA may comprise the same spacer sequence as gRNA G55 (CUCUCGAAGGUCUUCUGCCG; SEQ ID NO: 268). In yet another example, the gRNA may comprise the same spacer sequence as gRNA G56 (UCUCGAAGGUCUUCUGCCGA; SEQ ID NO: 269). Table 2 below provides exemplary gRNAs for Cas12i2 (e.g., SEQ ID NO: 3 or SEQ ID NO: 266) nucleases, all of which are within the scope of the present disclosure.

[0166] In some embodiments, the gRNA for nuclease AD can comprise the same spacer sequence as the gRNAs provided in Tables 3-5 below. In one example, the gRNA can comprise the same spacer sequence as gRNA A_STMN2_splice2a_4 (UAUUCAUAUUGCAGGACUCG; SEQ ID NO: 270). In another example, the gRNA can comprise the same spacer sequence as gRNA A_STMN2_splice2a_3 (AAAUUAUAUUCAUAUUGCAG; SEQ ID NO: 271). Exemplary gRNAs for nuclease AD are provided in Tables 3-5 below, all of which are within the scope of the present disclosure.

[0167] Nucleic acid modification

[0168] Any gRNA in the gene editing systems disclosed herein can include one or more modifications.

[0169] Exemplary modifications can include any modification to the sugar, the nucleobase, the internucleoside linkage (e.g., to the connecting phosphate / to the phosphodiester linkage / to the phosphodiester backbone), and any combination thereof. Some exemplary modifications provided herein are described in detail below.

[0170] The gRNA can include any available modification such as to the sugar, the nucleobase, or the internucleoside bond (e.g., to the connecting phosphate, to the phosphodiester bond, to the phosphodiester backbone). One or more atoms of the pyrimidine nucleobase can be replaced or substituted with an optionally substituted amino group, an optionally substituted thiol group, an optionally substituted alkyl group (e.g., a methyl or ethyl group), or a halide group (e.g., a chloro or fluoro group). In certain embodiments, the modification (e.g., one or more modifications) is present in each of the sugar and the internucleoside bond. The modification can be a modification of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or a hybrid thereof. Additional modifications are described herein.

[0171] In some embodiments, the modification may include chemical modification or cell-induced modification. For example, Lewis and Pan, "RNA modifications and structures cooperate to guide RNA-protein interactions," Nat Reviews Mol Cell Biol, 2017, 18:202-210, describe some non-limiting examples of RNA modifications in cells.

[0172] Different sugar modifications, nucleotide modifications and / or internucleoside linkages (e.g., backbone structures) can be present at different positions in the sequence. It will be understood by those of ordinary skill in the art that nucleotide analogs or other modifications can be located at any position of the sequence such that the function of the sequence is not substantially reduced. The sequence can include from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or to any one or more types of nucleotides, i.e., A, G, U, or C) or any intermediate percentages (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to % to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%).

[0173] In some embodiments, sugar modifications (e.g., at the 2' position or the 4' position) or substitution of sugars at one or more ribonucleotides of the sequence, and backbone modifications may include modification or substitution of phosphodiester bonds. Specific examples of sequences include, but are not limited to, sequences comprising a modified backbone or no natural internucleoside bond, such as internucleoside modifications, including modification or substitution of phosphodiester bonds. In addition, sequences with a modified backbone include those that do not have a phosphorus atom in the backbone. For the purposes of this application, and as sometimes mentioned in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbones may also be considered oligonucleosides. In a specific embodiment, the sequence will include ribonucleotides with a phosphorus atom in their internucleoside backbones.

[0174] Modified sequence backbone can comprise for example thiophosphate, chiral thiophosphate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonate, as 3 '-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate, as 3 '-aminophosphoramidate and aminoalkyl phosphoramidate, thiocarbonyl phosphoramidate, thiocarbonyl alkylphosphotriester and the borane phosphate with normal 3 '-5 ' key, 2 '-5 ' of these esters connect analogue and those esters with reverse polarity, wherein adjacent right nucleoside unit is with 3 '-5 ' to 5 '-3 ' or 2 '-5 ' to 5 '-2 ' connection.Various salts, mixed salts and free acid form have also been included.In certain embodiments, sequence can be negatively charged or positively charged.

[0175] Modified nucleotides that can be incorporated into a sequence can be modified at the internucleoside bond (e.g., phosphate backbone). Herein, in the context of a polynucleotide backbone, the phrases "phosphate" and "phosphodiester" are used interchangeably. The backbone phosphate group can be modified by replacing one or more oxygen atoms in the oxygen atom with different substituents. Further, modified nucleosides and nucleotides can include large-scale replacement of an unmodified phosphate moiety with another internucleoside bond as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, selenophosphates, boranophosphates, boranophosphate esters, hydrogen phosphates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Both non-linking oxygens of a phosphorodithioate are replaced by sulfur. Phosphate linkers can also be modified by replacing the linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene phosphonates).

[0176] The α-thiosubstituted phosphate moieties impart stability to RNA and DNA polymers through non-natural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and, therefore, a longer half-life in the cellular environment.

[0177] In specific embodiments, the modified nucleoside comprises an α-thio-nucleoside (e.g., 5'-O-(1-phosphorothioate)-adenosine, 5'-O-(1-phosphorothioate)-cytidine (a-thiocytidine), 5'-O-(1-phosphorothioate)-guanosine, 5'-O-(1-phosphorothioate)-uridine, or 5'-O-(1-phosphorothioate)-pseudouridine).

[0178] Other internucleoside linkages that can be employed in accordance with the present invention are described herein, including internucleoside linkages that do not contain a phosphorus atom.

[0179] In some embodiments, the sequence may include one or more cytotoxic nucleosides. For example, cytotoxic nucleosides may be incorporated into the sequence, such as bifunctional modifications. Cytotoxic nucleosides may include, but are not limited to, adenosine arabinoside, 5-azacytidine, 4'-thio-arabinoside, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, 1-(2-C-cyano-2-deoxy-β-D-arabinofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, ine), floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5-fluoro-1-(tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione), troxacitabine, tezacitabine, 2'-deoxy-2'-methylenecytidine (DMDC), and 6-mercaptopurine. Additional examples include fludarabine phosphate, N4-behenoyl-1-β-D-arabinofuranosylcytosine, N4-octadecyl-1-β-D-arabinofuranosylcytosine, N4-palmitoyl-1-(2-C-cyano-2-deoxy-β-D-arabinofuranosyl)cytosine, and P-4055 (cytarabine 5'-elaidate).

[0180] In some embodiments, the sequence includes one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly-A sequences, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than one hundred different nucleoside modifications identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucleic Acids Res. 27: 196-197). In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of: a pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurylmethyl-uridine, 1-taurylmethyl-pseudouridine, 5-taurylmethyl-2-thio- Uridine, 1-taurylmethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine and 4-methoxy-2-thio-pseudouridine. In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl- Pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine and 4-methoxy-1-methyl-pseudoisocytidine.In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6 -methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylaminoformyladenosine, N6-threonylaminoformyladenosine, 2-methylthio-N6-threonylaminoformyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine and 2-methoxy-adenine. In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of inosine, 1-methyl-inosine, wyosine, wyobutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0181] The sequence may or may not be uniformly modified along the full length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purines or pyrimidines, or any one or more or all of A, G, U, C, I, PU) may or may not be uniformly modified in the sequence or in its given predetermined sequence region. In some embodiments, the sequence includes pseudouridine. In some embodiments, the sequence includes inosine, which can help the immune system characterize the sequence as endogenous relative to viral RNA. The incorporation of inosine can also mediate an increase in RNA stability / reduction in degradation. See, for example, Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as "self". Cell Res. 25, 1283-1284, which is incorporated by reference in its entirety.

[0182] In some embodiments, any gRNA described herein may include a terminal modification (e.g., a 5' terminal modification or a 3' terminal modification). In some embodiments, the terminal modification is a chemical modification. In some embodiments, the terminal modification is a structural modification. See the disclosure herein. In specific examples, the gRNA may include a 2'-O-methylation and a phosphorothioate bond, for example, at the 5' and / or 3' end.

[0183] (iii) Delivery of gene editing systems to cells

[0184] In some embodiments, any gene editing system or components thereof as disclosed herein (e.g., including a carrier, such as a carrier and / or a polymer carrier, such as a liposome or lipid nanoparticle) can be formulated and delivered to cells (e.g., neuronal cells) by known methods. Such methods include, but are not limited to, transfection (e.g., lipid-mediated cationic polymers, calcium phosphate, dendrimers); electroporation or other membrane disruption methods (e.g., nucleofection), viral delivery (e.g., lentivirus, retrovirus, adenovirus, AAV), microinjection, microparticle bombardment ("gene gun"), fugene, direct acoustic loading, cell squeezing, optical transfection, protoplast fusion, impalefection, magnetofection, exosome-mediated transfer, lipid nanoparticle-mediated transfer, and any combination thereof.

[0185] In some embodiments, the methods comprise delivering one or more nucleic acids (e.g., nucleic acids encoding a V-type CRISPR nuclease and / or one or more gRNAs), one or more transcripts thereof, and / or preformed ribonucleoproteins to a cell. Exemplary intracellular delivery methods include, but are not limited to, viruses or virus-like agents; chemical-based transfection methods, such as those using calcium phosphate, dendrimers, liposomes, or cationic polymers (e.g., DEAE-dextran or polyethyleneimine); non-chemical methods, such as microinjection, electroporation, cell squeezing, sonoporation, optical transfection, puncture transfection, protoplast fusion, bacterial conjugation, delivery of plasmids or transposons; particle-based methods, such as using a gene gun, magnetofection or magnetic-assisted transfection, particle bombardment; and hybridization methods, such as nucleofection. In some embodiments, the present application further provides cells produced by such methods, as well as organisms (e.g., animals, plants, or fungi) comprising or produced from such cells. In some embodiments, the compositions of the present invention are further delivered with an agent (e.g., a compound, molecule, or biomolecule) that affects DNA repair or DNA repair mechanisms. In some embodiments, the compositions of the invention are further delivered with an agent (eg, a compound, molecule, or biomolecule) that affects the cell cycle.

[0186] In some embodiments, a first composition comprising a V-type CRISPR nuclease is delivered to a cell. In some embodiments, a second composition comprising a gRNA guide is delivered to a cell. In some embodiments, the first composition is contacted with the cell before the second composition is contacted with the cell. In some embodiments, the first composition is contacted with the cell while the second composition is contacted with the cell. In some embodiments, the first composition is contacted with the cell after the second composition is contacted with the cell. In some embodiments, the first composition is delivered by a first delivery method and the second composition is delivered by a second delivery method. In some embodiments, the first delivery method is the same as the second delivery method. For example, in some embodiments, the first composition and the second composition are delivered by viral delivery. In some embodiments, the first delivery method is different from the second delivery method. For example, in some embodiments, the first composition is delivered by viral delivery and the second composition is delivered by lipid nanoparticle-mediated transfer, and the second composition is delivered by viral delivery, or the first composition is delivered by lipid nanoparticle-mediated transfer and the second composition is delivered by viral delivery.

[0187] Alternatively, the components of the gene editing system provided herein (e.g., V-type nucleases or nucleic acids encoding thereof and guide RNAs or nucleic acids encoding thereof) can be formulated in a composition that can be delivered to the host cell of interest. For example, the gene editing system can include messenger RNA encoding the V-type nuclease and gRNA, which can be formulated together with a lipid excipient and delivered to the host cell via lipid nanoparticle-mediated transfer. In another example, the gene editing system can include a V-type nuclease and gRNA, and the V-type nuclease and gRNA can form a ribonucleoprotein (RNP) complex. The RNP complex can be delivered to the host cell by suitable routes known in the art. As another example, the gene editing system can include an expression vector capable of producing both the V-type nuclease and the gRNA. When transferred into the host cell, such an expression vector produces the nuclease and the gRNA. See the description of such expression vectors above.

[0188] III. Therapeutic Applications

[0189] Any gene editing system or modified cell (e.g., modified neuronal cell) generated using such a gene editing system as disclosed herein can be used to treat a disease involving aberrant splicing of STMN2 as disclosed herein, such as ALS or FTD.

[0190] Amyotrophic lateral sclerosis (ALS) is a progressive neurological disease that affects nerve cells in the brain and spinal cord, leading to a loss of muscle control. ALS typically begins with muscle twitching and weakness in the limbs, or slurred speech. Ultimately, ALS affects control of the muscles needed for movement, speaking, eating, and breathing. Currently, there is no cure for this fatal disease. The signs and symptoms of ALS vary from person to person, depending on which neurons are affected. It typically begins with muscle weakness that spreads and worsens over time. Exemplary signs and symptoms of ALS include difficulty walking or performing normal daily activities, stumbling and falling, weakness in the legs, feet, or ankles, weakness or clumsiness in the hands, slurred speech or difficulty swallowing, muscle spasms and twitching in the arms, shoulders, and tongue, inappropriate crying, laughing, or yawning, and / or cognitive and behavioral changes.

[0191] Frontotemporal dementia (FTD), a common cause of dementia, is a group of conditions that develop when nerve cells in the frontal and temporal lobes of the brain are lost. This causes the lobes to shrink. FTD can affect behavior, personality, language, and movement. The most common types of FTD include the frontal variant (affecting behavior and personality), primary progressive aphasia (communication difficulties), including progressive nonfluent aphasia (affecting the ability to speak), and semantic dementia (affecting the ability to use and understand language). A less common form of FTD affects movement, leading to symptoms similar to Parkinson's disease or amyotrophic lateral sclerosis.

[0192] In some embodiments, provided herein are methods for treating a target disease disclosed herein (e.g., ALS or FTD), comprising administering any gene editing system disclosed herein to a subject in need of treatment (e.g., a human patient). The gene editing system can be delivered to a specific tissue (e.g., brain) or a specific type of cell (e.g., neuronal cell) in need of gene editing. The gene editing system can comprise an LNP encompassing one or more of the components, one or more vectors (e.g., viral vectors) encoding one or more of the components, or a combination thereof. The components of the gene editing system can be formulated to form a pharmaceutical composition, which can further comprise one or more pharmaceutically acceptable carriers.

[0193] In some embodiments, modified cells generated using any of the gene editing systems disclosed herein can be administered to a subject in need of treatment (e.g., a human patient). As described and disclosed herein, the modified cells can include the desired gene edit in the STMN2 gene, including deletions at the desired location (3' splice site and / or downstream 10-nt window). Modified cells can be prepared using neuronal cells isolated from human patients (e.g., ALS patients or FTD patients). Compared to their unedited counterparts, the modified cells thus prepared produce reduced levels of non-functional STMN2 transcripts due to aberrant splicing events and increased levels of functional STMN2 transcripts (and functional STMN protein).

[0194] In some embodiments, provided herein is a composition comprising a gene editing system disclosed herein or a component thereof (e.g., a Cas12i2 polypeptide or a V-type CRISPR nuclease disclosed herein, and a corresponding gRNA targeting a genomic site of interest in the STMN2 gene as also disclosed herein). Such a composition may be a pharmaceutical composition. Useful pharmaceutical compositions can be prepared, packaged, or sold in formulations for suitable delivery routes (e.g., parenteral, intralesional, intra-organ administration, or other routes of administration). The pharmaceutical compositions of the present disclosure can be prepared, packaged, or sold in large quantities in the form of a single unit dose or multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition (e.g., a gene editing system or a component thereof) that will be administered to a subject or a convenient fraction of such a dose, for example, half or one-third of such a dose.

[0195] The formulation of a pharmaceutical composition suitable for parenteral administration may include an active agent (e.g., a gene editing system or components thereof or modified cells) in combination with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations can be prepared, packaged, or sold in a form suitable for bolus administration or continuous administration. Some injectable formulations can be prepared, packaged, or sold in unit dosage form, such as in ampoules or multi-dose containers containing preservatives. Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Some formulations may further include one or more additional ingredients, including but not limited to suspending agents, stabilizers, or dispersants.

[0196] The pharmaceutical composition can be in the form of a sterile injectable aqueous or oily suspension or solution. Such suspensions or solutions can be formulated according to known techniques and can also contain other ingredients, such as dispersants, wetting agents or suspending agents described herein, in addition to cells. Such sterile injectable formulations can be prepared using non-toxic parenteral acceptable diluents or solvents, such as water or saline. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution and fixed oils, such as synthetic monoglycerides or diglycerides. Other available parenteral formulations include those that can contain cells in a packaged form, in a liposomal formulation form or as a component of a biodegradable polymer system. Some compositions for sustained release or implantation can include pharmaceutically acceptable polymers or hydrophobic materials, such as emulsions, ion exchange resins, slightly soluble polymers or slightly soluble salts.

[0197] In some cases, the gene editing systems disclosed herein for therapeutic applications can include viral vectors, such as AAV vectors containing coding sequences for the V-type nucleases disclosed herein. Such AAV vectors (e.g., AAVrh10) can be used to deliver the nucleases to a subject in need of treatment (e.g., to a specific cell type, such as a neuronal cell, in which the STMN2 gene is to be edited). In some instances, the AAV vector can also carry coding sequences for an RNA guide, allowing the RNA guide to be produced in the host cell. Alternatively, the RNA guide can be co-delivered with the AAV vector to a subject in need of treatment.

[0198] IV. Kit for Inhibiting Abnormal STMN2 Splicing and Alleviating Target Diseases

[0199] The present disclosure also provides kits that can be used, for example, to implement the gene editing methods described herein to genetically modify the STMN2 gene as disclosed herein. In some embodiments, the kit includes an RNA guide and a V-type nuclease (e.g., a Cas12i polypeptide as provided herein or another V-type nuclease, e.g., as described in Table 1). In some embodiments, the kit includes an RNA guide and a V-type nuclease. In other embodiments, the kit includes a polynucleotide encoding such a V-type nuclease, and optionally the polynucleotide is contained in a vector, e.g., as described herein. In some embodiments, the kit includes a polynucleotide encoding an RNA guide disclosed herein. The V-type nuclease (or a polynucleotide encoding a V-type nuclease) and the RNA guide (e.g., as a ribonucleoprotein) can be packaged in the same or other container within the kit, or can be packaged in separate vials or other containers, the contents of which can be mixed prior to use.

[0200] The V-type nuclease and RNA guide can be packaged in the same or other container within the kit, or can be packaged in separate vials or other containers, the contents of which can be mixed prior to use. The kit can additionally include optional buffers and / or instructions for use of the RNA guide and V-type nuclease.

[0201] General Technology

[0202] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are fully explained in such texts as Molecular Cloning: A Laboratory Manual, 2nd ed. (Sambrook et al., 1989), Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed., 1984); Methods in Molecular Biology (Humana); Cell Biology: A Laboratory Notebook (JE Cellis, ed., 1989), Academic Press; Animal Cell Culture (RI Freshney, ed., 1987); Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998), Plenum Press; and Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, ed., 1993-8) John Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of experimental immunology (D. M. Weir and C. C. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Molecular Biology: A Manual (FMAusubel et al., ed., 1987); PCR: The Polymerase Chain Reaction (Mullis et al., ed., 1994); Current Protocols in Immunology (J.E. Coligan et al., ed., 1991); Short Protocols in Molecular Biology (John Wiley & Sons, 1999); Immunobiology (C.A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty, ed., IRL Press, 1988–1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 1991). 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds.; Harwood Academic Publishers, 1995); DNA Cloning: A practical approach, Volumes I and II (D. N. Glover, ed.; Nucleic Acid Hybridization (B. D. Hames and S. J. Higgins, eds.; (1985)); Transcription and Translation (B. D. Hames and S. J. Higgins, eds.; (1984)); Animal Cell Culture (RIFreshney, ed. (1986); Immobilized Cells and Enzymes (IRL Press, (1986)); and B. Perbal, A practical guide to molecular cloning (1984); FM Ausubel et al. (eds.).

[0203] Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. Therefore, the following specific examples should be construed as merely illustrative and not limiting in any way the remainder of the present disclosure. All publications cited herein are incorporated by reference for any purpose or subject matter mentioned herein.

[0204] Example 1 - Targeting the STMN2 exon 2a splice site by Cas12i2 in SH-SY5Y cells

[0205] This example demonstrates that the use of Cas12i2 complexed with an RNA guide designed to disrupt the exon 2a splice site of STMN2 (such as the 3' splice site in intron 1 disclosed herein) results in a reduction in STMN2 exon 2a splice variants and a corresponding increase in full-length STMN2 transcripts.

[0206] SH-SY5Y cells were cultured in DMEM / F12 (Gibco #10565018) supplemented with 10% FBS (Hyclone, heat-inactivated #SH30071.03) for 48 hours to 70–80% confluence. Cells were extracted with TrypLE (Gibco), counted, rinsed with PBS, and resuspended in Lonza SF Nucleofection Buffer + Supplement (Lonza, V4XC-2024) at a concentration of 20,000 cells / µL. Two million cells were used for each electroporation reaction.

[0207] Each RNA guide designed to target the 3' splice site of STMN2 intron 1 (splice site of exon 2a) from Table 2 was complexed with variant Cas12i2 (SEQ ID NO: 3). The variant Cas12i2 / RNA guide RNP complex was generated by mixing Cas12i2 (in 50 mM HEPES, 700 mM NaCl, 0.5 mM TECEP (tris(2-carboxyethyl)phosphine), 5% glycerol, pH 7.5) with the RNA guide (in 250 mM NaCl) at a 1:2.5 molar ratio on ice for 60 minutes. RNPs were added to each reaction at a final concentration of 20 µM (Cas12i2) and 50 µM RNA guide in the presence of 1 µM siTARDBP (siTDP-43 RNA; Horizon Discovery Biosciences ON-TARGETplus human TARDP [GCUCAAGCAUGGAUUCUAA (SEQ ID NO: 7), CAAUCAAGGUAGUAAUAUG (SEQ ID NO: 8), GGGCUUCGCUACAGGAAUC (SEQ ID NO: 9), and CAGGGUGGAUUUGGUAAUA (SEQ ID NO: 10)]) or si non-targeting pool (si control RNA; Horizon Discovery Biosciences ON-TARGETplus non-targeting pool).

[0208] Table 2. Cas12i2 RNA guides targeting human microtubule assembly inhibitor protein-2

[0209]

[0210]

[0211] *: spacer sequences shown in bold.

[0212] The nuclease binding fragment in the exemplary gRNA of Cas12i2 has a nucleotide sequence of AGAAAUCCGUCUUUCAUUGACGG (SEQ ID NO: 36).

[0213] The tubes were electroporated using an electroporation device (Program CA-137, Lonza 4D-Nucleofection). After electroporation, the cells were allowed to rest for 10 minutes before being added to pre-warmed culture medium and gently mixed by pipetting. 90% of the cells were plated for downstream RNA analysis, and 10% for NGS. The cells were then incubated at 37°C for 72 hours. Next, the cells were rinsed with PBS and purified using QuickExtract. TM(DNA extraction solution; Lucigen) or RLT+ (Qiagen) lysis. Cells were incubated in QuickExtract at 65°C for 15 minutes, 68°C for 15 minutes, and 98°C for 10 minutes before analysis by NGS. Samples for NGS were prepared by two rounds of PCR. The first round (PCR1) was used to amplify specific genomic regions based on the target. A second round of PCR (PCR2) was performed to add Illumina adapters and indexes. Reactions were then pooled and purified by column purification. 300 cycles of NEXTSEQ TM Sequencing runs were performed using the Illumina 500 / 550 High Output v2.5 kit.

[0214] For cells in RLT+, RNA was isolated using QIAshredder columns and the RNeasy plus micro kit (Qiagen). RNA (2 μg) was converted to cDNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative reverse transcription-polymerase chain reaction (PCR) was performed using the Faststart Universal Probe Master (Rox) (Roche) and TaqMan probes for TARDP (Hs00606522_m1, Thermo Fisher), STMN2 (Hs00975900_m1, Thermo Fisher), and GAPDH (Hs02786624_g1, Thermo Fisher). TaqMan probes and PCR primers were used to detect STMN2 exon 2a splice variants.

[0215] like Figure 1A As shown in , 30-fold knockdown of TDP-43 was observed in SHSY5Y cells using siTDP-43 RNA. Knockdown of TDP-43 in the presence of a non-targeting control RNP complex resulted in a 60-fold increase in the STMN2 exon 2a splice variant and a greater than 90-fold decrease in the STMN2 full-length transcript ( Figure 1B and Figure 1C RNP guides G9, G10, G11, G50, G52, G53, G54, G55, G56, G48, and G17 partially or completely alleviated exon 2a gain ( Figure 1B An inverse relationship was observed between exon 2a and full-length microtubule assembly protein-2 RNA ( Figure 1CSignificant restoration of full-length STMN2 signaling, which was reduced by TDP-43 depletion, was observed using guides G8, G9, G10, G52, G53, G54, G55, and G56. Guides G9, G55, and G56 showed the highest fold change for both full-length and aberrantly spliced ​​transcripts.

[0216] Figures 2A-2C Figure 3 shows the indel activity and splice region disruption of the RNA guides tested in SH-SY5Y cells. A correlation was observed between guides promoting full-length restoration of STMN2 and motif disruption ( Figure 2C ), and the correlation between the original indel and the restoration of the full length of STMN2 ( Figure 2B Guide 9 showed approximately 36% disruption of splice site motifs and 97.2% overall editing; greater than 35% of total editing disrupted splice sites ( Figure 2A Among all the guides tested, guides G55 and G56 showed the highest indels and caused the highest motif disruptions ( Figure 2A Guide G55 showed 93.5% disruption of splice site motifs and 97.3% global editing; greater than 95% of total editing disrupted splice sites. Guide G56 showed approximately 87% disruption of splice site motifs and 91% global editing; greater than 95% of total editing disrupted splice sites.

[0217] Thus, this example demonstrates that, in the presence of TDP-43 knockdown, editing with Cas12i2 and an RNA guide targeting the STMN2 exon 2a splice site not only disrupts the DNA splice site, leading to a decrease in exon 2a splice variants, but also promotes a corresponding increase in full-length STMN2.

[0218] Example 2 - Targeting STMN2 exon 2a splicing site and TDP-43 binding site by Cas12i2 in SH-SY5Y cells

[0219] This example shows that an RNA guide designed to disrupt the TDP-43 binding site recapitulates the effects of siRNA knockdown of TDP-43, demonstrating the effectiveness of RNA-guided disruption of the STMN2 exon 2a site.

[0220] SH-SY5Y cells were cultured in DMEM / F12 (Gibco #10565018) containing 10% FBS (Hyclone, heat-inactivated #SH30071.03) for 48 hours to 70–80% confluence. Cells were extracted with TrypLE (Gibco), counted, washed with PBS, and resuspended in Lonza SF Nucleofection Buffer + Supplement (Lonza, V4XC-2024) at a concentration of 20,000 cells / µL.

[0221] Two million cells were co-nuclearly infected with RNP complexes containing RNA guides targeting the TDP-43 binding site (guide 12: AGAAAUCCGUCUUUCAUUGACGGGGCUCUCUGUGUGAGCAUGU; SEQ ID NO: 39), the STMN2 exon 2a splice site (guide 55: AGAAAUCCGUCUUUCAUUGACGGCUCUCGAAGGUCUUCUGCCG; SEQ ID NO: 40), or a non-targeting guide (AGAAAUCCGUCUUUCAUUGACGGAGUGCGUACGAGCUCGGACG; SEQ ID NO: 41), both in the presence and absence of siRNA-mediated knockdown of TDP-43, as described in Example 1. For the location of the 3' splice site, 10-nt window, and TDP-43 binding motif in the corresponding region of the STMN2 gene, see Figure 3A .

[0222] Figure 3B The results show that disruption of the TDP-43 binding site with RNA guide 12 recapitulates the effects of siRNA TDP-43 knockdown. Downstream effects of guide G55 splice site disruption—a decrease in exon 2a splice variants and an increase in full-length STMN2—were also observed in the absence of siRNA-mediated TDP-43 knockdown and in the presence of guide 12 (see Table 1 for details). Figure 3C and Figure 3D ).

[0223] Thus, this example shows that, in the presence or absence of siRNA-induced TDP-43 knockdown, co-nucleofection of Cas12i2 RNP targeting the TDP-43 binding site and exon 2a splicing site causes a decrease in STMN2 exon 2a and an increase in full-length STMN2. These results demonstrate the feasibility of an in vivo strategy using mice carrying a humanized STMN2 gene with a constitutively disrupted TDP-43 binding site. Such a strategy enables the in vivo effects of STMN2 exon 2a splicing site disruption to be studied by RNA guides disclosed herein without the need to knock down TDP-43 in animals, as knocking down TDP-43 in vivo may result in non-STMN2-related results.

[0224] Example 3 - Computational analysis of Cas12i2-induced indels

[0225] In this example, computational analysis was performed on samples from Example 1 to determine how indels within or near the 3' splice site of exon 2a correlated with recovery of full-length STMN2. Full-length STMN2 transcripts refer to mRNAs encoding functional STMN2 protein containing exons 1-5.

[0226] To identify the optimal disruption region, sliding windows of variable size (1-10 nt) were used to calculate the positional indel rate for the nucleotide within the window. This was performed for each guide tested across the STMN2 amplicon sequence (n = 20). For each position and window size, the correlation between the window position indel rate and the STMN2 recovery rate was calculated to identify the amplicon position and window size with the largest correlation coefficient, indicating which disruption site / motif maximized STMN2 transcript recovery.

[0227] Figures 4A-4B A representative plot of one analyzed data set is shown, illustrating the maximum correlation observed over a 10-nt window starting at amplicon position 106. Figure 4A The correlation values ​​between the indel rate at the transguide position and the STMN2 recovery rate (y-axis) are shown for all amplicon positions (x-axis), with the position of maximum correlation (black dashed line) plotted. Figure 4B Shown are scatter plots of guide position indel rates (x-axis) and STMN2 recovery rates (y-axis) for a 10-nt window starting at position 106.

[0228] Figures 5A-5G The locations of indels induced by specific guides within the STMN2 amplicon are shown (x-axis). The number of NGS reads is on the y-axis. The region defined by the solid line on the left indicates the location of the literature-defined splice site. The region defined by the dashed line on the right indicates the location of the optimal disruption window identified above. Minimal or no full-length STMN2 recovery was observed for guides that did not induce indels within either window. See, e.g., Figure 5A 、 5C and RNA guides G1, G2, G3, G7, and G11 in 5D. Use was primarily within literature-defined splice sites (see, e.g., Figure 5B RNA guide G4 in the ) or primarily within the optimal destruction window defined herein (see e.g., Figure 5C 、 5D Measurable recovery of full-length STMN2 was observed with guides that induced indels (guides G9, G10, G53, and G54 in 5E and 5F). The greatest recovery of full-length STMN2 was observed with guides that induced indels within the 3' splice site and the optimal disruption window identified herein (see, e.g., Figure 5F RNA guides G55 and G56 in .

[0229] These results indicate that disruption of nucleotides within a 10-nt window downstream of the STMN2 3′ splice site provides a high recovery rate of full-length STMN2.

[0230] Example 4 - Editing STMN2 using type V CRISPR nuclease

[0231] In this example, RNA guides were designed to target the optimal disruption window of STMN2 exon 2a identified above in Example 3. Indels were assessed in cells following transfection with plasmids encoding the V-type nucleases in Table 1 above and the RNA guides in Tables 3-5 below.

[0232] Table 3. RNA guide and target sequences for nuclease A

[0233]

[0234] *The RNA guide for nuclease A includes the nuclease-binding fragment CUUGUUGUAUAUGUCCUUUUAUAGGUAUUAAACAAC (SEQ ID NO: 56). The spacer sequence in each guide RNA is underlined.

[0235] Table 4. RNA guide and target sequences for nuclease B

[0236]

[0237]

[0238]

[0239]

[0240]

[0241] *The RNA guide for nuclease B includes the nuclease-binding fragment CCUGUUGUGAAUACUCUUUUAUAGGUAUCAAACAAC (SEQ ID NO: 183). The spacer sequence in each guide RNA is underlined.

[0242] Table 5. RNA guide and target sequences for nuclease C

[0243]

[0244]

[0245]

[0246] *The RNA guide for nuclease C includes the nuclease-binding fragment GGUCCCAUCGGAACGGGUUGUGGUUCCGAC (SEQ ID NO: 38). The spacer sequence in each guide RNA is underlined.

[0247] Editing efficiency

[0248] The exemplary V-type nucleases A, B, and C listed in Table 1 were individually cloned into plasmids containing a CMV promoter. Fragments encoding the RNA guides in Tables 3-5 were cloned into a pUC19 backbone (New England Biolabs) containing the hU6 promoter. The plasmids were then maximized and diluted.

[0249] Approximately 16 hours before transfection, plate 25,000 HEK293T cells in DMEM / 10% FBS + Pen / Strep (D10 medium) into each well of a 96-well plate. On the day of transfection, cells should be 70-90% confluent. For each well to be transfected, prepare LIPOFECTAMINE ® 2000 transfection reagent (Thermo Fisher Scientific) and Opti-MEM® Reduced Serum Medium (Thermo Fisher Scientific) were added and incubated at room temperature for 5 minutes (Solution 1). ® 2000:Opti-MEM ® (Transfection reagent (Thermo Fisher Scientific): Reduced serum medium (Thermo Fisher Scientific)) mixture was added to the culture medium containing the nuclease plasmid, RNA guide plasmid and Opti-MEM ® A separate mixture of reduced serum medium (Thermo Fisher Scientific) (Solution 2) was added. In the case of a negative control, the RNA guide plasmid was not included in Solution 2. Solutions 1 and 2 were mixed 8 times by pipetting and then incubated at room temperature for 25 minutes. After incubation, the mixture of Solutions 1 and 2 was added dropwise to each well of a 96-well plate containing cells. 72 hours after transfection, the cells were plated by adding TRYPLE to the center of each well. TM (recombinant cell dissociation enzyme; Thermo Fisher Scientific) and incubate at 37°C for approximately 5 minutes to trypsinize the cells. D10 medium was then added to each well and mixed to resuspend the cells. The resuspended cells were centrifuged at 500 × g for 10 minutes to obtain a pellet, and the supernatant was discarded. QUICKEXTRACT TM (DNA extraction solution; Lucigen) extraction reagent was added to lyse the pelleted cells, and the cells were incubated at 65°C for 15 minutes, 68°C for 15 minutes, and 98°C for 10 minutes.

[0250] Samples for NGS were prepared using two rounds of PCR. The first round (PCR1) was used to amplify specific genomic regions based on the target. A second round of PCR (PCR2) was performed to add Illumina adapters and indexes. Reactions were then pooled and purified by column purification. 300 cycles of NEXTSEQ TM Sequencing runs were performed using the Illumina 500 / 550 High Output v2.5 kit.

[0251] For the RNA guides in Tables 2-4, the percentage of NGS reads containing indels (% Indel) and the percentage of NGS reads containing indels within the 10-bp optimal window described herein (% Motif Disruption) are shown in Table 6. The seven RNA guides that produced > 5% motif disruption are shown in bold (Table 6) and are Figure 6 Two other RNA guides produced significant motif disruption % > 5%, however further evaluation revealed that these elevated percentages (italicized) were due to high background (e.g., A_STMN2_Splice2a_7 ( Figure 7F ) and C_STMN2_splicing2a_43 ( Figure 8E )).

[0252] Table 6. Disruption of STMN2 splicing 2a by nucleases A, B, and C.

[0253]

[0254]

[0255]

[0256] When co-delivered with nuclease A, the RNA guides A_STMN2_splice2a_3, A_STMN2_splice2a_4, A_STMN2_splice2a_5, and A_STMN2_splice2a_6 resulted in greater than 5% motif disruption.

[0257] The RNA guides used in this example that induce indels within the 3' splice sites disclosed herein and / or the optimal disruption window identified in Example 3 above allow for functional STMN2 restoration (e.g., restoration of full-length STMN2 transcripts) in cells such as SH-SY5Y cells and neurons. Nuclease A guides with the highest overall indel rate and high % motif disruption were selected for testing in SH-SY5Y cells (Example 5).

[0258] Computational analysis of V-type nuclease-induced indels

[0259] Computational analysis was performed on the samples described in Example 4 above to determine how indels within or near the 3' splice site of exon 2a correlated with recovery of full-length STMN2. Full-length STMN2 transcripts refer to mRNA encoding a functional STMN2 protein containing exons 1-5. The methods used here were similar to those described in Example 3.

[0260] Figures 7A-7G The positions of indels induced by nuclease A and seven different STMN2 guides within the STMN2 amplicon are shown (x-axis). The number of NGS reads is on the y-axis. The gray bars on the left indicate the positions of the literature-defined splice sites (99-104). The gray bars on the right indicate the positions of the optimal 10-nt disruption windows determined above (106-115). Consistent with the indel data in Table 4, Guide A_STMN2_Splice2a_4 ( Figure 7D , bottom panel) shows the maximum motif disruption % and peak reads in the best 10-nt window. In general, the highest motif disruption % corresponds to an increase in the number of reads in the best 10-nt disruption window.

[0261] Figures 8A-8E The positions of indels induced by nuclease C and four representative STMN guides within the STMN2 amplicon are shown (x-axis). The number of NGS reads is on the y-axis. The gray bar on the left indicates the location of the literature-defined splice sites. The gray bar on the right indicates the location of the optimal 10-nt disruption window determined above. The graph shows that the maximum motif disruption percentage is associated with the peak read within the optimal 10-nt window.

[0262] Figure 7F and 8E Guides exhibited high background and indels that peaked outside of the canonical splice sites or optimal windows defined herein, and therefore these gRNAs were not additionally tested.

[0263] Figures 7A-7G and Figures 8A-8E The indel patterns observed in , combined with the % motif disruption seen in Table 6 , support the selection of the Nuclease A Guide for further studies of functional STMN2 restoration in SH-SY5Y cells and neurons.

[0264] Example 5 - V-type CRISPR nuclease targeting STMN2 exon 2A splice site in SH-SY5Y cells

[0265] This example demonstrates that use of a V-type CRISPR nuclease (nuclease D listed in Table 1 above) complexed with an RNA guide (Table 3) designed to disrupt the exon 2A splice site of STMN2 (such as the 3' splice site in intron 1 disclosed herein) results in a decrease in the STMN2 exon 2A splice variant, which corresponds to an increase in the full-length STMN2 transcript.

[0266] SH-SY5Y cells were cultured in DMEM / F12 (Gibco #10565018) supplemented with 10% FBS (Hyclone, heat-inactivated #SH30071.03) for 48 hours to 70–80% confluence. Cells were extracted with TrypLE (Gibco), counted, rinsed with PBS, and resuspended in Lonza SF Nucleofection Buffer + Supplement (Lonza, V4XC-2024). Two million cells were used for each electroporation reaction.

[0267] Each RNA guide in Table 3 was designed to target the 3' splice site of STMN2 intron 1 (splice site of exon 2A) and complexed with nuclease D. A non-targeting control guide (CUUGUUGUAUAUGUCCUUUUAUAGGUAUUAAACAACAGUGCGUA

[0268] CGAGCUCGGACG; SEQ ID NO: 260). RNP complexes were generated by mixing type V CRISPR nuclease (in 20 mM HEPES pH 7.8, 500 mM NaCl, 10% glycerol, 0.5 mM TCEP) with RNA guide (in 250 mM NaCl) at a 1:2.5 molar ratio on ice for 60 minutes. RNPs were added to each reaction at a final concentration of 10 µM nuclease and 25 µM RNA guide in the presence of 1 µM siTARDBP (siTDP-43 RNA; Horizon Discovery Biosciences ON-TARGETplus human TARDP [GCUCAAGCAUGGAUUCUAA (SEQ ID NO: 7), CAAUCAAGGUAGUAAUAUG (SEQ ID NO: 8), GGGCUUCGCUACAGGAAUC (SEQ ID NO: 9), and CAGGGUGGAUUUGGUAAUA (SEQ ID NO: 10)]) or sinontargeting pool (sicontrol RNA; Horizon Discovery Biosciences ON-TARGETplus nontargeting pool).

[0269] The tubes were electroporated using an electroporation device (program CA-137, Lonza 4D-Nucleofection). After electroporation, the cells were allowed to rest for 10 minutes before being added to prewarmed culture medium and gently mixed by pipetting. The cells were then incubated at 37°C for 72 hours. Next, the cells were rinsed with PBS and lysed using RLT+ (Qiagen). RNA was isolated using QIAshredder columns and the RNeasy plus micro kit (Qiagen). RNA (2 µg) was converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative reverse transcription-PCR was performed using Faststart Universal Probe Master (Roche) and TaqMan probes for TARDP (Hs00606522_m1, Thermo Fisher Scientific), STMN2 (Hs00975900_m1, Thermo Fisher Scientific), and GAPDH (Hs02786624_g1, Thermo Fisher Scientific). Custom TaqMan probes and PCR primers were used to detect STMN2 exon 2A splice variants (Baughn et al., Science 379 (2023): forward primer CTTTCTCTAGCACGGTCCCAC (SEQ ID NO: 257), reverse primer ATGCTCACACAGAGAGCCAAATT (SEQ ID NO: 258), probe CTCTCGAAGGTCTTCTGCCG (SEQ ID NO: 259)).

[0270] Table 3 above provides RNA guides and corresponding target sequences, and for reference to sample identifiers, see Figures 9A-9K and Table 7 below.

[0271] Table 7. Sample identifiers and corresponding RNA guides

[0272]

[0273] like Figure 9A As shown in Figure 2, 3-fold knockdown of TDP-43 was observed in SH-SY5Y cells using siTDP-43 RNA. Knockdown of TDP-43 in the presence of a non-targeting control RNP complex resulted in an 80-fold increase in the STMN2 exon 2A splice variant and a greater than 7.5-fold decrease in the STMN2 full-length transcript ( Figure 9B and Figure 9C The RNP guides A_STMN2_splicing2a_3 and A_STMN2_splicing2a_4 significantly alleviated the increase in exon 2A ( Figure 9BSignificant restoration of full-length STMN2 signaling that was reduced by TDP-43 depletion was observed using the RNA guides A_STMN2_splicing2a_3 and A_STMN2_splicing2a_4 ( Figure 9C Indel activity of nuclease A with various gRNAs as indicated in SH-SYSY cells Figure 9D Computational analysis of the indel positions induced in the STMN2 sequence by a specific guide associated with nuclease A in SH-SY5Y cells is shown in Figures 9E-9K The data demonstrate that full-length STMN2 transcripts increased the most ( Figure 9C ) and exon 2A transcripts were reduced the most ( Figure 9B ) also exhibited the highest indel activity within the desired optimal disruption window ( Figure 9G and 9H ).

[0274] Example 6 - Disruption of STMN2 exon 2A splice site by CRISPR nuclease variants in SH-SY5Y cells

[0275] This example compares disruption of the exon 2A splice site of STMN2 and the effect on expression levels of STMN2 exon 2A splice variants and full-length STMN2 with the type V CRISPR nuclease variants of nuclease A and nuclease D listed in Table 1 above.

[0276] SH-SY5Y cells were cultured in DMEM / F12 (Gibco #10565018) containing 10% FBS (Hyclone, heat-inactivated #SH30071.03) for 48 hours to 70–80% confluence. Cells were extracted with TrypLE (Gibco), counted, washed with PBS, and resuspended in Lonza SF Nucleofection Buffer + Supplement (Lonza, V4XC-2024) at a concentration of 20,000 cells / µL.

[0277] Two million cells were co-nuclearly infected with the RNP complex containing the RNA guide A_STMN2_Splicing2a_4 (see Table 3 above, Figures 10A-10C ) or a non-targeting control guide (CUUGUUGUAUAUGUCCUUUUAUAGGUAUUAAACAACAGUGCGUACGAGCUCGGACG; SEQ ID NO: 260: Control G).

[0278] like Figure 10AAs shown in , 3-fold and 5-fold knockdown of TDP-43 were observed in SH-SY5Y cells using siTDP-43 RNA when co-infected with RNPs containing the V-type CRISPR nuclease variants of nuclease D and nuclease A, respectively. Knockdown of TDP-43 in the presence of a non-targeting control RNP complex resulted in a 120-fold and 130-fold increase in STMN2 exon 2A splice variants, respectively, when co-infected with RNPs containing the V-type CRISPR nuclease variants of nuclease D and nuclease A. Figure 10B An 8-fold and 10-fold reduction in STMN2 full-length transcripts was observed with siTDP-43 knockdown and RNPs containing type V CRISPR nuclease variants of nuclease D and nuclease A, respectively. Figure 10C The RNA guide A_STMN2_splicing2a_4 significantly alleviated the increase in exon 2A ( Figure 10B Significant restoration of full-length STMN2 signaling that was reduced by TDP-43 depletion was observed using the RNA guide A_STMN2_splicing2a_4 ( Figure 10C ).

[0279] Example 7 - Targeting the STMN2 exon 2a splice site by Cas12i2 in human iPSC-derived motor neurons

[0280] This example demonstrates that the use of Cas12i2 and an RNA guide designed to disrupt the exon 2a splice site of STMN2 (such as the 3' splice site in intron 1 disclosed herein) results in a reduction in STMN2 exon 2a splice variants and a corresponding increase in full-length STMN2 transcripts.

[0281] Human iPSC-derived motor neurons (BrainXell) were thawed and cultured according to the manufacturer's protocol. Briefly, motor neurons were rapidly thawed from liquid nitrogen in a 37°C water bath. Cells were added to a medium containing 1:1 DMEM / F12 (Thermo Fisher Scientific #11330-032):Neurobasal medium (Life Technologies #21103-049) supplemented with 1x B27 (Thermo Fisher Scientific #17504-044), 1x N2 (Thermo Fisher Scientific #17502-048), 0.5 mM GlutaMAX (Thermo Fisher Scientific #35050-061), 10 ng / ml BDNF (Peptech #450-02), 10 ng / ml GDNF (Peptech #450-10), 1 ng / ml TGF-β1 (Peptech #100-21C), 15 µg / ml Geltrex (Life Technologies #A1413201), and 1x motor neuron seeding supplement (BrainXell). Next, cells were counted for viability using trypan blue and plated onto plates pre-coated with Poly-D-lysine (Thermo Fisher Scientific #A3890401). Four days after plating, neurons were transduced with Cas12i2 (SEQ ID NO: 3) and RNA guide lentivirus at an MOI of 10 for each virus. 72 hours later, neurons were also transduced with TDP43 shRNA lentivirus (VectorBuilder hTARDBP shRNA [AGATCTTAAGACTGGTCATTCCTCGAGGAATGACCAGTCTTAA] at an MOI of 10).

[0282] GATCT; SEQ ID NO: 261]) or non-targeting shRNA (VectorBuilder Scramble shRNA [CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG; SEQ ID NO: 262]).

[0283] Ten days after transduction with nuclease and RNA guide (14 days after thawing), neurons were harvested for downstream RNA analysis and NGS. Cells were washed with PBS and purified using QuickExtract TM(DNA extraction solution; Lucigen) or RLT Plus (Qiagen). Cells were incubated in QuickExtract at 65°C for 15 minutes, 68°C for 15 minutes, and 98°C for 10 minutes before analysis by NGS. Samples for NGS were prepared by two rounds of PCR. The first round (PCR1) was used to amplify specific genomic regions based on the target. A second round of PCR (PCR2) was performed to add Illumina adapters and indexes. Reactions were then pooled and purified by column purification. 300 cycles of NEXTSEQ TM Sequencing runs were performed using the Illumina 500 / 550 High Output v2.5 kit.

[0284] For cells grown in RLT Plus, RNA was isolated using QIAshredder columns and the RNeasy plus micro kit (Qiagen). RNA was converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative reverse transcription-polymerase chain reaction (RT-PCR) was performed using the Faststart Universal Probe Master (Roche) and TaqMan probes for TARDP (Hs00606522_m1, Thermo Fisher Scientific), STMN2 (Hs00975900_m1, Thermo Fisher Scientific), and GAPDH (Hs02786624_g1, Thermo Fisher Scientific). TaqMan probes and PCR primers were used to detect STMN2 exon 2a splice variants.

[0285] Knockdown of TDP-43 in the presence of a non-targeting control guide RNA resulted in a 75-fold decrease in the full-length STMN2 transcript and an approximately 700-fold increase in the STMN2 exon 2a splice variant ( Figure 11A and Figure 11B RNA guides G9 and G10 partially alleviated the increase in exon 2a, and G52, G53, G54, G55, and G56 more significantly alleviated the increase in exon 2a ( Figure 11B An inverse relationship was observed between exon 2a and full-length STMN2 RNA, where a significant restoration of the reduced full-length STMN2 signal was observed with the same RNA guide ( Figure 11A ).

[0286] Figure 11C Figure 2 shows the indel activity of RNA guides tested in motor neurons. A correlation was observed between guides that promoted full-length restoration of STMN2 and the original indel. Guides G53 and G55 showed the highest indel rates of 67.7% and 62.5%, respectively.

[0287] Figures 11D-11PThe locations of indels induced by specific guides are shown, as indicated by association with Cas12i2 in motor neurons within the STMN2 amplicon (x-axis).

[0288] Thus, this example demonstrates that, in the presence of TDP-43 knockdown, editing with Cas12i2 and an RNA guide targeting the STMN2 exon 2a splice site not only disrupts the DNA splice site and the optimal disruption window, leading to a decrease in exon 2a splice variants, but also promotes a corresponding increase in full-length STMN2.

[0289] Example 8 - STMN2 exon 2a splice site targeting by nuclease A in human iPSC-derived motor neurons

[0290] This example demonstrates that the use of a V-type nuclease (nuclease A listed in Table 1 above) complexed with an RNA guide designed to disrupt the exon 2a splice site of STMN2 (such as the 3' splice site in intron 1 disclosed herein) results in a reduction of STMN2 exon 2a splice variants and a corresponding increase in full-length STMN2 transcripts in motor neurons. Human iPSC-derived motor neurons (BrainXell) were thawed and cultured according to the manufacturer's protocol. Briefly, motor neurons were thawed and added to medium containing 1:1 DMEM / F12 (Thermo Fisher Scientific #11330-032):Neurobasal medium (Life Technologies #21103-049) supplemented with 1x B27 (Thermo Fisher Scientific #17504-044), 1x N2 (Thermo Fisher Scientific #17502-048), 0.5 mM GlutaMAX (Thermo Fisher Scientific #35050-061), 10 ng / ml BDNF (Peptech #450-02), 10 ng / ml GDNF (Peptech #450-10), 1 ng / ml TGF-β1 (Peptech #100-21C), and 15 µg / ml dapoxetine. Geltrex (Life Technologies #A1413201) and 1x motor neuron seeding supplement (BrainXell). Motor neurons were first transduced with nuclease A (SEQ ID NO: 4) and RNA guide lentivirus, and further transduced with TDP43 shRNA lentivirus (VectorBuilder hTARDBP shRNA) or non-targeting shRNA (VectorBuilder Scramble shRNA). The RNA guides and corresponding target sequences are provided in Table 3 above. For reference to sample identifiers, see Figures 12A-12D , see Table 7.

[0291] Ten days after transduction with nucleases and RNA guides, neurons were harvested for downstream RNA analysis and NGS. Cells were rinsed with PBS and lysed using QuickExtract™ (DNA extraction solution; Lucigen) or RLT Plus (Qiagen). Samples were prepared for NGS using two rounds of PCR. The first round (PCR1) amplified specific genomic regions based on the target. A second round of PCR (PCR2) was performed to add Illumina adapters and indexes. Reactions were then pooled and purified by column purification. Sequencing runs were performed using a 300-cycle NEXTSEQ™ (Illumina) 500 / 550 High Output v2.5 kit.

[0292] For cells grown in RLT Plus, RNA was isolated using QIAshredder columns and the RNeasy plus micro kit (Qiagen). RNA was converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative reverse transcription-polymerase chain reaction (RT-PCR) was performed using the Faststart Universal Probe Master (Roche) and TaqMan probes for TARDP (Hs00606522_m1, Thermo Fisher Scientific), STMN2 (Hs00975900_m1, Thermo Fisher Scientific), and GAPDH (Hs02786624_g1, Thermo Fisher Scientific). TaqMan probes and PCR primers were used to detect STMN2 exon 2a splice variants.

[0293] Knockdown of TDP-43 in the presence of a non-targeting control guide RNA resulted in a 60-fold decrease in STMN2 full-length transcripts and an approximately 380-fold increase in STMN2 exon 2a splice variants ( Figure 12A and Figure 12B RNA guides G3 and G4 significantly mitigated the increase in exon 2a ( Figure 12B An inverse relationship was observed between exon 2a and full-length STMN2 RNA, where partial restoration of the reduced full-length STMN2 signal was observed with the same RNA guide ( Figure 12A ).

[0294] Figure 12C Figure 2 shows the indel activity of RNA guides tested in motor neurons. A correlation was observed between guides that promoted full-length restoration of STMN2 and the original indel. Guides G3 and G4 showed the highest indel rates of 35% and 27%, respectively.

[0295] Figure 12D We demonstrate STMN2 motif disruption in motor neurons analyzed by digital droplet polymerase chain reaction (ddPCR) assay.

[0296] Figures 12E-12L Included are diagrams showing the locations of indels induced by specific guides, as indicated by association with nuclease A in motor neurons within the STMN2 amplicon (x-axis).

[0297] Thus, this example demonstrates that, in the presence of TDP-43 knockdown, editing with nuclease A and an RNA guide targeted to the STMN2 exon 2a splice site not only disrupts the DNA splice site, leading to a decrease in exon 2a-containing splice variants, but also promotes a corresponding increase in full-length STMN2.

[0298] Example 9 - Reversal of phenotypic defects caused by STMN2 mis-splicing in human iPSC-derived motor neurons

[0299] This example demonstrates that the use of Cas12i2 (SEQ ID NO: 3) and an RNA guide (STMN2-exon 2a-55, SEQ ID NO: 31(G55)) designed to disrupt the exon 2a splice site of STMN2 (such as the 3' splice site in intron 1 disclosed herein) allows phenotypic rescue of abnormal neuronal growth promoted by TDP-43 knockdown in human iPSC-derived motor neurons.

[0300] Human iPSC-derived motor neurons were generated as described in Du et al., 2015. On days 20-22 after initiating iPSC differentiation, neurons were transduced with Cas12i2 (SEQ ID NO: 3) and an RNA-guide lentivirus. Seventy-two hours later, neurons were also transduced with either a TDP43 shRNA lentivirus or a non-targeting shRNA.

[0301] Twenty-five days after transduction with nucleases and RNA guides, neurons were fixed, blocked, permeabilized, and incubated with primary antibodies overnight at 4°C (rabbit anti-STMN2, Abcam, #ab185956, 1:500; mouse anti-β3-tubulin, R&D Systems, #MAB1195, 1:1,000). Cells were then washed with PBS and incubated with secondary antibodies (AlexaFluor 488 and 555, Life Technologies, 1:1,000) at room temperature. Nuclei were stained with Hoechst 33342 (1 µg / ml). Images were captured and analyzed using the Operetta CLS High Content Analysis System (Perkin Elmer).

[0302] Knockdown of TDP-43 in the presence of a guide RNA that does not target the STMN2 intron 3' splice site (non-targeting control) resulted in an approximately 50% reduction in motor neuron neurite outgrowth ( Figure 13AChina Library and Figure 13B ), as determined by measuring the length of Tuj1-positive neurites. This impairment was significantly reversed in the presence of the RNA guide G55 ( Figure 13A Right picture and Figure 13B Although no significant changes in cell number were observed after treatment with the RNA guide G55 ( Figure 13C ), but a significant increase in the percentage of STMN2-positive neurons was observed ( Figure 13D ), from 6% STMN2-positive neurons in the non-targeting guide shTDP43 condition to 60% STMN2-positive neurons in the G55 and TDP43 knockdown condition.

[0303] Thus, this example demonstrates that targeting the STMN2 exon 2a splice site and optimal disruption window with editing using Cas12i2 and the RNA guide G55 in the presence of TDP-43 knockdown not only disrupts the DNA splice site, leading to reversal of the molecular phenotype (Example 7), but also promotes the corresponding phenotypic rescue by reversing impaired neurite outgrowth and increasing the number of STMN2-positive neurons.

[0304] Example 10 - Gene Editing to Reduce Abnormal Splicing of STMN2 in Exon 2a in Humanized Mice

[0305] This example demonstrates that Cas12i2 and a V-type nuclease and corresponding RNA guide designed to disrupt the exon 2a splice site of STMN2 (such as the 3' splice site in intron 1 disclosed herein) reduce aberrant splicing of STMN2 in exon 2A humanized mice.

[0306] Stmn2 em8(STMN2*) Mice were provided by The Jackson Laboratory (Jax) (RRID:MMRRC_069792-JAX; available on the World Wide Web at jax.org / strain / 035721). In these mice, the STMN2-like gene was engineered using CRISPR / Cas9 to generate a 222-nucleotide mutant carrying exon 2a of human STMN2. Additionally, the STMN2 sequence was modified to include a human MS2 stem-loop sequence and replace the TDP43 binding site. Animal experiments were performed at Jax. Briefly, at post-gestational day 1 (P1), mouse pups received bilateral intracerebral incisions (ICV) of 2.5 μl of vector into each lateral ventricle (2 × 10 cells per injection). 11 AAV vector genomes). The sample identifiers and corresponding nucleases and RNA guides are shown in Table 8.

[0307] Table 8. Sample identifiers and corresponding nucleases and RNA guides

[0308]

[0309] The AAV genome expresses Cas12i2 (SEQ ID NO: 266) under the control of the synapsin promoter and gRNA under the control of the U6 promoter.

[0310] Twenty-eight days after injection, the animals were sacrificed. The brains were removed and sectioned in the sagittal plane to separate the left and right hemispheres; the cerebellum was removed. Frozen mouse hemibrains were homogenized using a TissueLyser II (Qiagen) in RLTPlus buffer (Qiagen) containing β-mercaptoethanol (Sigma-Aldrich). DNA and RNA were isolated using the All Prep Universal Kit (Qiagen). RNA was converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative reverse transcription-PCR was performed using the Faststart Universal Probe Master (Rox) (Roche), and TaqMan probes were used to detect full-length STMN2 (IDT Stock Assay #Mm.PT.58.13787385) and exon 2a splice variants. The primers / probe used to detect exon 2a were: forward primer: GCCTTACTCAGACTCCTCTCTC (SEQ ID NO: 263), reverse primer: TCTTCTGCCGAGTCCCATT (SEQ ID NO: 264) and probe: CTGGACCCTTCTCCTTTGCCTTCG (SEQ ID NO: 265) (Baughn MW et al., Science, 2023 Mar 17;379(6637):1140-1149).

[0311] DNA was analyzed using a digital droplet polymerase chain reaction (ddPCR) assay to determine the efficiency of nuclease cleavage at defined STMN2 splice sites. The assay utilizes genomic DNA partitioned into oil droplets, followed by amplification and fluorescence detection to quantify the number of STMN2 disruption and non-disruption events.

[0312] Motif disruption observed in vivo after injection of each vector tested Figure 14B The number of vector genomes per diploid genome (VG / dg) is determined relative to the number of copies of bovine growth hormone (bGH) and can be found in Figure 14AThe highest motif disruption was observed in animals injected with nuclease A + RNA guide 4 (A_STMN2_splicing2a_4), followed by animals injected with Cas12i2+g55, Cas12i2+g53, and Cas12i2+g56 (means of 17.8%, 13.8%, 13.5%, and 9.4%, respectively). Following treatment with all vectors, exon 2a levels were significantly reduced in animals injected with vehicle (control), with a greater decrease in animals receiving nuclease A + RNA guide 4 (65% reduction; Figure 14C In these mice, a significant increase in full-length microtubule assembly inhibitor protein-2 RNA was also observed (26% increase; Figure 14D ).

[0313] The correlation between editing percentage and STMN2 transcript levels in mice injected with nuclease A + g4 was Figures 14E-14G Shown in.

[0314] Other embodiments

[0315] All features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Therefore, unless expressly stated otherwise, each feature disclosed is merely an example of a general set of equivalent or similar features.

[0316] From the above description, those skilled in the art can easily determine the essential characteristics of the present invention, and without departing from the spirit and scope of the present invention, various changes and modifications can be made to the present invention to adapt it to various uses and conditions. Therefore, other embodiments are also within the scope of the claims.

[0317] Equivalent form

[0318] Although several embodiments of the present invention have been described and illustrated herein, a person of ordinary skill in the art will readily conceive of various other devices and / or structures for performing the functions described herein and / or obtaining these results and / or one or more of these advantages, and each of such variations and / or modifications is considered to be within the scope of the embodiments of the present invention described herein. More generally, a person of ordinary skill in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary, and that actual parameters, dimensions, materials, and / or configurations will depend on one or more specific applications in which the teachings of the present invention are used. Using only routine experimentation, a person of ordinary skill in the art will recognize or be able to determine many equivalents to the specific embodiments of the present invention described herein. Therefore, it should be understood that the foregoing embodiments are presented by way of example only, and within the scope of the appended claims and their equivalents, embodiments of the present invention may be practiced in a manner different from that specifically described and claimed. The embodiments of the present invention disclosed herein relate to each individual feature, system, product, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits and / or methods is included within the inventive scope of the present disclosure if such features, systems, articles, materials, kits and / or methods are not mutually inconsistent.

[0319] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0320] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which they are cited, which in some cases may be incorporated in their entirety.

[0321] As used herein in the specification and claims, the indefinite articles "a," "an," and "a" should be understood to mean "at least one," unless explicitly stated to the contrary.

[0322] As used herein in the specification and claims, the phrase "and / or" should be understood to mean "either or both" of the elements so combined, i.e., elements present in combination in some cases and separately in other cases. Multiple elements listed with "and / or" should be interpreted in the same manner, i.e., "one or more elements" of the elements so combined. In addition to the elements specifically identified by the "and / or" clause, other elements may optionally be present, whether related or unrelated to those specifically identified. Thus, as a non-limiting example, when used in conjunction with open language such as "comprising," a reference to "A and / or B" may, in one embodiment, refer to only A (optionally including elements in addition to B); in another embodiment, to only B (optionally including elements in addition to A); in yet another embodiment, to both A and B (optionally including other elements); and so on.

[0323] As used herein in this specification and claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive, that is, including at least one element from a number of elements or a list of elements, but also including more than one element and optionally additional unlisted items. Only phrases that clearly indicate the opposite, such as "only one of..." or "exactly one of..." or "consisting of..." when used in a claim, will refer to the inclusion of exactly one element from a plurality of elements or a list of elements. Generally speaking, when preceded by an exclusive term, such as "any one of...", "one of...", "only one of...", or "exactly one of...", the term "or" as used herein should only be interpreted to indicate exclusive alternatives (i.e., "one or the other, but not both"). When used in a claim, "consisting essentially of..." should have the ordinary meaning used in the field of patent law.

[0324] As used herein in the specification and claims, the phrase "at least one" with respect to a list of one or more elements should be understood to mean at least one element selected from any one or more elements in the list of elements, but not necessarily including at least one element from every element specifically listed in the list of elements, and not excluding any combination of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether related or unrelated to those specifically identified elements. Thus, as a non-limiting example, in one embodiment, "at least one of A and B" (or equivalently, "at least one of A or B," or equivalently, "at least one of A and / or B") may refer to at least one that optionally includes more than one A, without B (and optionally includes elements in addition to B); in another embodiment, may refer to at least one that optionally includes more than one B, without A (and optionally includes elements in addition to A); in yet another embodiment, may refer to at least one that optionally includes more than one A and at least one that optionally includes more than one B (and optionally includes other elements); and so on.

[0325] It should also be understood that in any method claimed herein that includes more than one step or action, the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are recited unless explicitly stated to the contrary.

Claims

1. A gene editing system comprising: (a) a type V CRISPR nuclease or a nucleic acid encoding the same; and (b) one or more guide RNAs (gRNAs) targeting the Stathmin-2 (STMN2) gene, or one or more nucleic acids encoding the one or more gRNAs; The gene editing system causes (a) deletion of one or more nucleotides in the 3' splice site of intron 1 of STMN2, wherein the 3' splice site is adjacent to exon 2a; (b) deletion of one or more nucleotides in the region of intron 1 adjacent to the 3' splice site; or both (a) and (b), thereby reducing the production of STMN2 transcripts including exon 2a and increasing the production of functional STMN2 transcripts in cells edited by the gene editing system.

2. The gene editing system of claim 1, wherein the V-type CRISPR nuclease is a Cas12i2 nuclease, optionally comprising an amino acid sequence at least 90% identical to SEQ ID NO:

3.

3. The gene editing system of claim 2, wherein the type V CRISPR nuclease comprises the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO:

266.

4. The gene editing system of claim 1 , wherein the V-type CRISPR nuclease is a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 4-6 or a variant thereof; optionally wherein the variant comprises an amino acid sequence at least 90% identical to SEQ ID NOs: 4, 5 or 6.

5. The gene editing system of claim 3, wherein the V-type CRISPR nuclease comprises the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO:

255.

6. The gene editing system according to claim 1, wherein: (a) the type V CRISPR nuclease is a Cas12i2 nuclease, optionally comprising an amino acid sequence at least 90% identical to SEQ ID NO: 3 or SEQ ID NO: 266; and (b) the one or more guide RNAs (gRNAs) are selected from those listed in Table 2; optionally wherein the gRNA is G53, G55 or G56.

7. The gene editing system according to claim 1, wherein: (a) the type V CRISPR nuclease is a nuclease comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 4; and (b) the one or more guide RNAs (gRNAs) are selected from those listed in Table 3; optionally wherein the gRNA is A_STMN2_splicing2a_4 or A_STMN2_splicing2a_3.

8. The gene editing system according to claim 1, wherein: (a) the type V CRISPR nuclease is a nuclease comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 5; and (b) The one or more guide RNAs (gRNAs) are selected from those listed in Table 4.

9. The gene editing system according to claim 1, wherein: (a) the type V CRISPR nuclease is a nuclease comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 6; and (b) The guide RNA (gRNA) is selected from those listed in Table 5.

10. The gene editing system of any one of claims 1 to 9, comprising the nucleic acid encoding the type V CRISPR nuclease.

11. The gene editing system of claim 10, wherein the nucleic acid is a vector comprising a first nucleotide sequence encoding the type V CRISPR nuclease, the first nucleotide sequence being operably linked to a first promoter.

12. The gene editing system of claim 11, wherein the vector further comprises a second nucleotide sequence encoding the gRNA, and the second nucleotide sequence is operably linked to a second promoter.

13. The gene editing system of claim 11 or claim 12, wherein the vector is an adeno-associated virus (AAV) vector, optionally an AAVrh10 vector.

14. The gene editing system according to any one of claims 11 to 13, wherein the first promoter is a synapsin 1 promoter.

15. A method for inhibiting aberrant splicing in a STMN2 transcript, the method comprising: (i) genetically editing the STMN2 gene in a cell to delete: (a) one or more nucleotides in the 3' splice site of intron 1, wherein the 3' splice site is adjacent to exon 2a; (b) one or more nucleotides in a region of intron 1 adjacent to the 3' splice site; or both (a) and (b), Thereby, the production of STMN2 transcripts including exon 2a is suppressed and the production of functional STMN2 transcripts is increased in said cells.

16. The method according to claim 15, wherein the 3' splice site in (a) comprises a nucleotide sequence of TTGCAG; and / or wherein the region of exon 2a in (b) comprises a nucleotide sequence of ACTCGGCAGA (SEQ ID NO: 2).

17. A method according to claim 15 or claim 16, wherein step (i) results in deletion of both (a) and (b).

18. The method according to any one of claims 15 to 17, wherein the gene editing step (i) is mediated by a gene editing system.

19. The method of claim 18, wherein the gene editing system comprises (i) a type V CRISPR nuclease or a first nucleic acid encoding the nuclease, and (ii) a guide RNA (gRNA) targeting the STMN2 gene or a second nucleic acid encoding the gRNA.

20. The method of claim 19, wherein the editing system is as set forth in any one of claims 2 to 13.

21. The method of any one of claims 15 to 20, wherein the cells are in cell culture; optionally wherein the cells are from a human patient with amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

22. The method of claim 21, wherein the method further comprises measuring the level of STMN2 transcript and / or STMN2 protein in the cell after the gene editing.

23. The method of any one of claims 15 to 22, wherein the cell is a brain cell, optionally a neuronal cell.

24. The method of claim 23, wherein the cell is a motor neuron cell.

25. The method of claim 23 or claim 24, wherein the neuronal cell is located in a human patient suffering from amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

26. The method of claim 25, comprising delivering the gene editing system of any one of claims 1 to 14 to a subject in need thereof.

27. The method of claim 26, wherein the gene editing system is delivered to the subject by intracerebroventricular (ICV) injection or intrathecal injection.

28. A gene-edited cell comprising (a) a deletion of one or more nucleotides in the 3' splice site of intron 1 of STMN2, wherein the 3' splice site is adjacent to exon 2a; (b) a deletion of one or more nucleotides in a region of intron 1 adjacent to the 3' splice site; or both (a) and (b), wherein the gene-edited cell produces reduced levels of STMN2 transcripts including exon 2a and increased levels of functional STMN2 transcripts compared to its unedited counterpart.

29. A gene editing system comprising: (a) a type V CRISPR nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 4, or a first nucleic acid encoding the type V CRISPR nuclease; and (b) a guide RNA (gRNA) targeting the inhibitory microtubule assembly protein-2 (STMN2) gene or a second nucleic acid encoding the gRNA; The gene editing system genetically modifies the STMN2 gene to inhibit the production of STMN2 transcripts containing exon 2a.

30. The gene editing system of claim 29, wherein the V-type CRISPR comprises an amino acid sequence of SEQ ID NO: 4 or SEQ ID NO:

255.

31. The gene editing system of claim 29 or claim 30, comprising the first nucleic acid encoding the type V CRISPR nuclease.

32. The gene editing system of claim 31 , wherein the nucleic acid is a vector comprising a first nucleotide sequence encoding the type V CRISPR nuclease, the first nucleotide sequence being operably linked to a first promoter.

33. The gene editing system of claim 32, wherein the vector further comprises a second nucleotide sequence encoding the gRNA, the second nucleotide sequence being operably linked to a second promoter.

34. The gene editing system of claim 32 or claim 33, wherein the vector is an adeno-associated virus (AAV) vector, optionally an AAVrh10 vector.

35. The gene editing system of any one of claims 32 to 34, wherein the first promoter is a synapsin 1 promoter.

36. A method for genetically editing the inhibitory microtubule assembly protein-2 (STMN2) gene, the method comprising contacting a cell with the gene editing system according to any one of claims 29 to 35, to allow the STMN2 gene in the cell to be genetically edited by the gene editing system.

37. The method of claim 36, wherein the contacting step is performed by administering the gene editing system to a subject in need thereof.

38. The method of claim 37, wherein the gene editing system is delivered to the subject by intracerebroventricular (ICV) injection or intrathecal injection.

39. A method for treating a disease involving abnormal splicing of STMN2, the method comprising administering an effective amount of the gene editing system according to any one of claims 1 to 13 and claims 29 to 34 to a subject in need thereof.

40. The method of claim 39, wherein the subject is a human patient.

41. The method of claim 39 or claim 40, wherein the disease is ALS or FTD.

Images