Soybean ACS double-enzyme inactivation mutant caused by deletion of asparagine residue and application of soybean ACS double-enzyme inactivation mutant

Abstract

The invention is applicable to the technical field of plant genetic engineering, and provides a soybean ACS double-enzyme inactivation mutant caused by deletion of an asparagine residue and application, the soybean ACS double-enzyme inactivation mutant is GmAH4 delta 209N, and the amino acid sequence of the GmAH4 delta 209N is shown as SEQ ID NO.1. The invention further provides a preparation method of the soybean ACS double-enzyme inactivation mutant. A soybean ACS double-enzyme inactivation mutant in which ACS and C-S lyase activities are completely lost is obtained by utilizing a functional site modification technology of a soybean ethylene synthesis key enzyme ACS and adopting a gene editing means, and the alkali stress tolerance of the obtained soybean gene editing mutant is remarkably enhanced compared with that of wild soybean; a novel gene resource is provided for creation of soybean stress-resistant varieties, and the gene has a wide application prospect and an important economic value in molecular breeding of stress-resistant soybeans.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a soybean ACS double enzyme inactivation mutant caused by deleting an asparagine residue and its application. Background Art

[0002] The gaseous plant hormone ethylene plays a crucial regulatory role in numerous plant growth and development processes, encompassing key stages such as seed germination, cell elongation, root development, flowering, and fruit ripening. Furthermore, ethylene plays an essential role in plant responses to a variety of biotic and abiotic stresses, including pathogen invasion, waterlogging, high temperature, high salinity, and drought. In seed plants, ethylene biosynthesis follows an ACC-dependent pathway, also known as the Young's cycle. The rate-limiting step in this pathway is the formation of ACC, the immediate precursor of ethylene, catalyzed by ACC synthase (ACS). ACSs in higher plants are encoded by a multigene family whose members all possess a conserved AAT-like (Aspartate aminotransferase) domain in their amino acid sequences. They belong to the α superfamily of pyridoxal-5'-phosphate (PLP)-dependent proteases. In addition to ACSs, this family also includes other subfamilies, such as aminotransferases and CS lyases.

[0003] Traditionally, the key enzyme in ethylene biosynthesis, ACS, has been considered a single enzyme that catalyzes the formation of ACC from SAM, participating in ethylene biosynthesis in plants and primarily contributing to developmental processes such as fruit ripening and organ senescence. However, recent research has revealed that, in addition to the traditional ACS activity, the key ethylene biosynthesis enzyme in higher plants can also catalyze the production of ammonium ions, pyruvate, and sulfocysteine ​​from cystine, indicating that it also possesses CS lyase activity (CSL). Pyruvate is the end product of glycolysis and an energy substrate for the mitochondrial tricarboxylic acid cycle; sulfocysteine ​​can further generate hydrogen sulfide, both of which play important roles in plant growth and development and in resisting various stresses. The discovery of dual enzyme activity in higher plant ACS proteins has made them a critical intersection of two distinct yet closely linked life processes: promoting plant development, fruit ripening, and stress resistance. Balancing and regulating their dual enzyme activities is an important target for crop biotechnology. In-depth analysis of the key structural domains and key sites of the dual-enzyme activity of ACS proteins in higher plants will not only open up new perspectives for clarifying the biological functions of ACS proteins, but also provide important genetic resources for the creation of new high-yield and stress-resistant varieties, which has important theoretical value and practical significance.

[0004] Soybean (Glycine max) is a key dual-purpose grain, oil, and feed crop in my country, holding irreplaceable strategic significance for the development of the national economy. The plant hormone ethylene and the gaseous signaling molecule hydrogen sulfide play important roles in soybean growth and development, as well as in responses to environmental stresses. However, the identification of key sites and domains involved in the ACS and CS cleavage activity of soybean ACS proteins, their mechanisms of action, and their regulation and utilization remain underdeveloped. Summary of the Invention

[0005] The purpose of the embodiments of the present invention is to provide a soybean ACS dual enzyme inactivation mutant caused by deleting an asparagine residue and its application, aiming to solve the problems raised in the above background technology.

[0006] The embodiment of the present invention is achieved by deleting an asparagine residue to form a soybean ACS double enzyme inactive mutant, wherein the soybean ACS double enzyme inactive mutant is GmAH4 Δ209N , the GmAH4 Δ209N The amino acid sequence is shown in SEQ ID NO.1;

[0007] The GmAH4 Δ209N The AAA bases at positions 462037, 462038, and 462039 in the GmAH4 (Glycine max ACS homologue 4) genome, or positions 729, 730, and 731 in its corresponding mRNA sequence, or positions 624, 625, and 626 in its corresponding cDNA sequence, located between positions 460822 and 463208 on soybean chromosome Gm01, were deleted, resulting in a deletion of amino acid 209 (asparagine, N) in the GmAH4 protein. The resulting mutant protein was named GmAH4 Δ209N .

[0008] Another object of the present invention is to use a soybean ACS double enzyme inactive mutant caused by deleting an asparagine residue, based on the above soybean ACS double enzyme inactive mutant GmAH4 Δ209N , the GmAH4 Δ209N Applied in molecular breeding of stress-resistant soybeans.

[0009] The soybean ACS dual-enzyme inactivation mutant caused by the deletion of an asparagine residue and its application provided in the embodiments of the present invention utilizes the functional site modification technology of ACS, a key enzyme in soybean ethylene synthesis, and adopts gene editing to obtain a soybean ACS dual-enzyme inactivation mutant in which both ACS and CSL activities are completely lost. The obtained soybean gene-edited mutant has significantly enhanced alkali stress tolerance compared to wild-type soybeans, providing a new gene resource for the creation of stress-resistant soybean varieties, and has broad application prospects and important economic value in the molecular breeding of stress-resistant soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 GmAH4 Δ209N The results of ACS and CSL activity assay of proteins (where A is GmAH4 and GmAH4 Δ209N The results of CSL activity assay of proteins were obtained. pET28a was used as negative control. B is GmAH4 and GmAH4 Δ209N ACS activity assay results of the protein, with pET28a as a negative control);

[0011] Figure 2 GmAH4 Δ209N Phenotypic observation and survival rate statistics of gene-edited soybean mutants (A is the 8-day-old GmAH4 Δ209N Phenotypes of the gene-edited soybean mutant and the Williams 82 non-transformed control after 3 days of alkali treatment (40 mM NaHCO3 pH = 8.3) and water treatment (mock) and 4 days of recovery treatment with Hoagland (1 / 2 Hoagland) nutrient solution (recovery); B is an 8-day-old seedling of GmAH4 Δ209N Survival statistics of gene-edited soybean mutants and Williams 82 non-transformed controls after 3 days of alkali treatment (40 mM NaHCO3 pH=8.3) and water treatment (mock), followed by 4 days of recovery with Hoagland (1 / 2) nutrient solution. DETAILED DESCRIPTION

[0012] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0013] The specific implementation of the present invention is described in detail below with reference to specific embodiments.

[0014] One embodiment of the present invention provides a soybean ACS double enzyme inactivation mutant caused by deleting an asparagine residue, wherein the soybean ACS double enzyme inactivation mutant is GmAH4 Δ209N , the GmAH4 Δ209N The amino acid sequence is shown in SEQ ID NO.1.

[0015] The GmAH4 Δ209NThe AAA bases at positions 462037, 462038, and 462039 in the GmAH4 (Glycine max ACS homologue 4) genome, or positions 729, 730, and 731 in its corresponding mRNA sequence, or positions 624, 625, and 626 in its corresponding cDNA sequence, located between positions 460822 and 463208 on soybean chromosome Gm01, were deleted, resulting in a deletion of amino acid 209 (asparagine, N) in the GmAH4 protein. The resulting mutant protein was named GmAH4 Δ209N The enzyme activity assay showed that compared with GmAH4, GmAH4 Δ209N The ACS and CS lyase activities were completely lost ( Figure 1 ), the soybean gene-edited mutant obtained showed significantly enhanced alkali stress tolerance compared to the Williams 82 non-transformed soybean control ( Figure 2 ).

[0016] As a preferred embodiment of the present invention, GmAH4 Δ209N The in vitro method for obtaining the protein comprises the following steps:

[0017] Step 1: Design primers;

[0018] Step 1.1: Design primers at the beginning and end of the gene, and seamless cloning primers can be used.

[0019] 01F: CAGCAAATGGGTCGCGGATCCATGGGTATTGAGATGGAGCAACCCTGTGT;

[0020] 01R: TGGTGGTGCTCGAGTGCGGCCGCTCAAAAAAAGACGTTTTGTGTCCTTAT;

[0021] Step 1.2: Generally, design primers at the missing base, about 15 bp above and below, for a total of about 30 bp:

[0022] 01-MF: CCTTCCCCATTAGGTGTAAC;

[0023] 01-MR: ATGGGGAAGGGTTTGTGATT.

[0024] Step 2: PCR amplification experiment;

[0025] Step 2.1: Amplification of fragments A and B;

[0026] (1) A fragment amplification primers:

[0027] 01F: CAGCAAATGGGTCGCGGATCCATGGGTATTGAGATGGAGCAACCCTGTGT

[0028] 01-MR:

[0029] ATGGGGAAGGGTTTGTGATT;

[0030] 649bp

[0031] (2) Primers for amplification of fragment B:

[0032] 01-MF: CCTTCCCCATTAGGTGTAAC

[0033] 01R: TGGTGGTGCTCGAGTGCGGCCGCTCAAAAAAAGACGTTTTGTGTCCTTAT;

[0034] 743bp

[0035] In a 50 μl reaction system, a plasmid containing the wild-type GmAH4 gene was used as a template, 1 μl of each 10 μM primer was added, and HiFi Hot Start was used as the DNA polymerase. The amplification conditions were: 95°C for 5 min; 98°C for 20 s; 58°C for 15 s; 72°C for 1 min; and 72°C for 10 min, for a total of 25 cycles.

[0036] Step 2.2: AB fragment fusion (1382 bp)

[0037] The amplification reaction system is as follows: in a 50 μl reaction system, the volume of A and B fragments to be added is calculated according to the concentration and length of the A and B fragments, respectively, according to the principle of a total volume of 15 μl, and HiFi Hot Start is used as the DNA polymerase; the amplification conditions are: 95°C for 5 min; 98°C for 20 s; 58°C for 15 s; 72°C for 2 min; 72°C for 10 min; a total of 11 cycles, then, the purified product obtained in this step is used as a template, HiFi Hot Start is used as the DNA polymerase, and the upstream and downstream primers 01F and 01R of GmAH4 are used to obtain the target product GmAH4 by fusion PCR. Δ209N .

[0038] Step 3: protein expression in vitro;

[0039] After the PCR product was purified, it was ligated to the pMD_18-T vector using the pMD_18-T Vector Cloning Kit. After sequencing verification, the pMD_18-T vector and the expression vector pET28a were double-digested with BamH I and Not I, and the target fragment was ligated to pET28a to obtain GmAH4 Δ209N nucleotide sequence. Take 20 ng of the expression vector verified by sequencing and transform it into BL21 competent cells, spread it on LB plates containing kanamycin, and culture it at 37°C overnight. Pick the monoclonal colonies identified as positive and place them in 5 ml of LB liquid medium containing kanamycin, and culture them at 37°C, 210 rpm, and shake overnight. The next day, take 100 μl of the bacterial solution to 10 ml of LB liquid medium containing kanamycin, and shake at 37°C, 210 rpm to OD 600 Add inducer IPTG to the bacterial solution to a final concentration of 0.6 mM and induce overnight at 16°C and 210 rpm.

[0040] In a preferred embodiment of the present invention, the method for determining the activity of ACS and CS lyases is as follows:

[0041] ACS activity assay: The induced bacterial suspension was placed in a 10 ml tube and centrifuged at 12,000 rpm for 5 minutes. The supernatant was transferred to a 5 ml EP tube and stored at 4°C. The supernatant or the corresponding positive and negative controls (GmAH4, extracts from strains transformed with the empty vector pET28a) were incubated with ACS reaction buffer (50 mM EPPS, pH 8.5, 10 μM PLP, 2 mM DTT) and S-adenosylmethionine (SAM). The reaction was terminated with 100 mM HgCl2. Freshly prepared ACC assay solution (saturated NaOH: sodium hypochlorite = 2:1 (v:v)) was then added to convert the generated ACC into ethylene. ACC production was analyzed and calculated using a gas chromatograph (Agilent 7890A).

[0042] CS lyase activity assay: After induction, the bacterial suspension was centrifuged at 6000 rpm for 6 minutes at 4°C. The supernatant was discarded and the suspension was resuspended in 3 ml of 20 mM imidazole. PMSF was added to a final concentration of 1 mM and the suspension was placed on ice. The cells were disrupted using an ultrasonicator 20 times, each for 2 seconds with 5 seconds between sonications. The disrupted bacterial suspension was centrifuged at 12000 rpm for 20 minutes at 4°C. The supernatant was supplemented with PMSF to a final concentration of 1 mM and the suspension was placed on ice. 100 μg of the crude protein extract or the corresponding positive and negative controls (GmAH4, extracted from a strain transformed with the empty pET28a vector, using the same procedure) was incubated with a substrate such as L-cystine, 0.1 M potassium phosphate buffer, pH 7.8, 10 mM PLP, and 2 mM DTT. After the reaction, the protein was extracted with chloroform. For the determination of the reaction product pyruvate, spectrophotometry was used to detect the amount of pyruvate-2,4-dinitrophenylhydrazone generated by the reaction of pyruvate with 2,4-dinitrophenylhydrazine.

[0043] In the embodiment of the present invention, the specific detection results are as follows: Figure 1 As shown. Among them, Figure 1 The pictures in A are GmAH4 and GmAH4 Δ209N The pyruvic acid color reaction, the bar graph is based on the OD of the mixed solution after the reaction 520 The numerical value of GmAH4 and GmAH4 Δ209N The CSL activity of the cells was quantified. The pET28a empty vector was used as a negative control. The error bars represent the standard error of three biological replicates. The bar graph in Figure B is based on the OD 600 The values ​​and ACC contents of GmAH4 and GmAH4 Δ209N Quantification of protein ACS activity. The pET28a empty vector was used as a negative control. The error bars represent the standard error of three biological replicates. The test results showed that GmAH4 Δ209N Both ACS and CSL activities were lost.

[0044] As a preferred embodiment of the present invention, GmAH4 Δ209N The methods for constructing gene editing vectors and obtaining related soybean mutants are as follows:

[0045] CRISPR-PLANT software (http: / / www.genome.arizona.edu / crispr / index.html) was used to design sgRNA for the soybean GmAH4 gene. BsaI restriction sites were introduced upstream and downstream of the sgRNA, respectively. The two sgRNAs were named GmAH4-CRISPR-F and GmAH4-CRISPR-R. The sequences are as follows:

[0046] GmAH4-CRISPR-F: 5'—ATTGTACACCTAATGGGTTTGAA—3'

[0047] GmAH4-CRISPR-R: 5'—AAACTTCAAAACCCATTAGGTGTA—3'

[0048] 10 µl of each of the two primers (100 µM) was mixed and annealed at 95°C for 5 minutes to synthesize a double-stranded fragment. The pBSE401 vector was digested with BsaI, and the resulting double-stranded fragment was ligated with the digested pBSE401 vector and transformed into Escherichia coli DH5α. Positive clones were screened and identified by bacterial lysis PCR using primers U6-26p-F and U6-26t-R, with the following sequences and a target fragment size of 423 bp. Correct plasmids were extracted and sent for sequencing to confirm the identity. Correct plasmids were transformed into Agrobacterium tumefaciens EHA105 and sent to Tianjin Jinuowo Biotechnology Co., Ltd. for stable transformation using soybean Williams 82 as the recipient cell line. Separation and screening for Basta resistance were performed, resulting in regenerated plants homozygous for the editing site and lacking Bar and Cas9.

[0049] U6-26p-F: 5'—TGTCCCAGGATTAGAATGATTAGGC—3'

[0050] U6-26t-R: 5'—CCCCAGAAATTGAACGCCGAAGAAC—3'

[0051] In the present embodiment, the phenotype of the GmAH4 gene-edited soybean mutant was observed. Specifically, 8-day-old Williams 82 untransformed soybeans and GmAH4 Δ209N Forty-eight gene-edited soybean seedlings were used, 24 of which served as the experimental group and 24 as the control group. The experimental group was placed in an incubator containing 40 mM NaHCO3 pH=8.3 solution with support holes, while the control group was placed in the same incubator containing water (i.e., mock treatment). After three days of treatment, photos were taken to record the phenotype. After recording, a recovery process was performed, that is, the alkaline water used in the treatment group was replaced with Hoagland-type (1 / 2) nutrient solution, and the distilled water in the control group was also replaced with 1 / 2 Hoagland nutrient solution. After four days, the survival rate of the seedlings in the treatment and control groups was counted and photographed. The experimental results are shown in the figure. Figure 2 As shown, Figure A shows the 8-day-old GmAH4 209NPhenotypes of the gene-edited soybean mutant and the Williams 82 non-transformed control after 3 days of alkali treatment (40 mM NaHCO3 pH=8.3) and water treatment (mock) and 4 days of recovery treatment with Hoagland (1 / 2 Hoagland) nutrient solution; B is an 8-day-old seedling of GmAH4 Δ209N Survival statistics of gene-edited soybean mutants and Williams 82 non-transformed controls after 3 days of alkali treatment (40 mM NaHCO3 pH=8.3) and water treatment (mock) and 4 days of recovery with Hoagland nutrient solution (1 / 2 Hoagland nutrient solution). The results showed that compared with the Williams 82 non-transformed soybean control, the obtained GmAH4 209N The alkali resistance of gene-edited soybean plants has been significantly improved.

[0052] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A soybean ACS dual enzyme inactive mutant caused by deletion of an asparagine residue, characterized in that: The soybean ACS dual enzyme inactive mutant is GmAH4 Δ209N ; The GmAH4 Δ209N The amino acid sequence is shown in SEQ ID NO.

1.

2. Use of a soybean ACS dual enzyme inactive mutant caused by deletion of an asparagine residue, based on the soybean ACS dual enzyme inactive mutant caused by deletion of an asparagine residue according to claim 1, characterized in that: The GmAH4 Δ209N Applied in molecular breeding of stress-resistant soybeans.

Images