Application of receptor kinase OsHPCA1 gene rich in leucine repetitive sequence to improvement of rice salt and oxidative stress tolerance

Abstract

The invention belongs to the field of plant genetic engineering, and discloses a key gene OsHPCA1 for positively regulating salt stress and oxidative stress tolerance of rice. The gene (with the login number of Os05g40770) encodes a receptor protein capable of specifically sensing hydrogen peroxide, and belongs to a leucine repeat receptor-like protein kinase (LRR-RLKs) family, wherein the family is the largest subfamily in the receptor-like protein kinase (RLKs). The OsHPCA1 responds to salt and oxidative stress signals, and the salt tolerance and oxidative stress resistance of the rice are positively regulated and responded. The OsHPCA1 overexpression rice strain shows very strong salt tolerance; and the OsHPCA1 knockout strain oshpca1 is more sensitive to salt stress. The OsHPCA1 protein encoded by the OsHPCA1 gene and rich in leucine repeat receptor-like protein kinase can positively regulate and control the activity of catalase C (CatC) in rice and enhance the removal efficiency of H2O2 under salt stress, so that the salt tolerance of rice is improved. When the OsHPCA1 is overexpressed, the activity of CatC in the overexpressed strain OsHPCA1 is obviously increased, the H2O2 removal capability is enhanced, and the salt tolerance and oxidative stress tolerance of the rice are improved.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant genetic engineering. Specifically, the present application relates to OsHPCA1 Use of a gene to improve salt and oxidative stress tolerance in rice. BACKGROUND

[0002] As a major food crop in China, rice, the exploration of salt-tolerant genes and the analysis of the mechanism have important theoretical and practical significance for improving rice yield, breeding salt-tolerant new varieties, and making full use of saline-alkali land. In recent years, the cultivation of salt-tolerant rice varieties and the analysis of molecular mechanisms have made some progress, but there are still problems such as low salt tolerance of rice, limited salt-tolerant genes available for breeding, and so on. Since the salt tolerance of rice is a comprehensive performance of multiple gene regulation, it is still necessary to increase the exploration of salt-tolerant genes and the innovation of germplasm resources, and to breed new salt-tolerant rice varieties with better quality (Wang C, Zhang Y, Zhao L, Zhu Z, Chen T, Zhao Q, Yao S, Zhou L, Zhao C, Liang H, Sun M, Yan G. Current status, problems and suggestions of salt-tolerant rice research. China Rice, 2019, 25, 1-6). Therefore, it is of great theoretical and practical significance to carry out the exploration of new salt-tolerant genes and the creation of new germplasm resources in rice, and to study the related mechanisms.

[0003] Salt stress can cause a large accumulation of reactive oxygen species (ROS) in plants, leading to oxidative stress and severely inhibiting plant growth and development or even death. Among them, H2O2 is a very important ROS molecule, not only can regulate intracellular signal transduction and biological processes, but also itself as a signal molecule involved in many biological processes, including tolerance to biotic and abiotic stress (Jin T C, Min F, Li Y D, Ding X Y, Han H, Shi M, Yang L P. Molecular mechanisms of defense gene expression in Arabidopsis induced by abiotic stress [J]. Journal of Northeast Forestry University, 2023, 51(05): 60-65). For example, H2O2 was found to activate the LRR receptor kinase HPCA1 on the plasma membrane in Arabidopsis, causing HPCA1 autophosphorylation, activating calcium ion channels, and inducing stomatal closure (Wu F, Chi Y, Jiang Z, Xu Y, Pei ZM. Hydrogen peroxide sensor HPCA1 is an LRR receptor kinase in Arabidopsis. Nature, 2020, 578(7796): 577-581.). However, excessive accumulation of ROS can affect the function of proteins, lipids and nucleic acids, and if not removed in time, it will cause cell damage or even death. In order to remove the excessive accumulation of ROS, plants have formed adaptive mechanisms at multiple levels, including molecules, physiology, development and morphological characteristics. Under stress conditions, the earliest response of plants is usually the change of gene expression. The expression of a large number of genes is induced, and these gene products cause signal transduction, leading to biochemical, physiological and morphological changes involved in the final adaptation process, such as genes encoding membrane-localized receptors, kinases, phosphatases, transcription factors and other regulatory proteins (Wu F, Chi Y, Jiang Z, Xu Y, Pei ZM. The receptor-like cytoplasmic kinase STRK1 phosphorylates and activates CatC, thereby regulating H2O2 homeostasis and improving salt tolerance in rice. Plant Cell, 2018, 30(5): 1100-1118).

[0004] Receptor-like kinases (RLKs) are a class of transmembrane proteins with N-terminal extracellular domain and C-terminal kinase domain. RLKs include a multigene family. So far, a large number of RLKs have been deduced from the complete genome sequences of Arabidopsis and rice. Among them, the extracellular leucine-rich repeat receptor-like kinases (LRR-RLKs) are the largest subfamily in the plant receptor-like kinase family. There are 235 RLK family members in Arabidopsis, 309 members in rice, and 467 members in soybean with LRR receptor domains. LRR-RLKs perceive environmental signals through extracellular leucine repeat domains and transmit signals through intracellular kinase domains, playing a pivotal role in growth and development and stress response (Coleman AD, Maroschek J, Raasch L, Takken FLW, Ranf S, Ralph Hückelhoven. The arabidopsis leucine‐rich repeat receptor‐like kinase mik2 is a crucial component of early immune responses to a fungal‐derived elicitor. New Phytologist, 2021, 229(6): 3453-3466; Laohavisit A, Wakatake T, Ishihama N, Mulvey H, Takizawa K, Suzuki T, Shirasu K. Quinone perception in plants via leucine-rich-repeat receptor-like kinases. Nature, 2020, 587(7832): 92-97). For example, LRXs, RALF and FER act as a module to transmit cell wall signals, thereby regulating plant growth and salt tolerance (Zhao C, Zayed O, Yu Z, Jiang W, Zhu P, Hsu CC, Zhang L, Tao WA, Lozano-Duran R, Zhu JK: Leucine-rich repeat extensin proteins regulate plant salt tolerance in Arabidopsis. Proc Natl Acad Sci U SA 2018, 115(51):13123-13128.).The bryophyte receptor protein kinase gene PnLRR-RLK2 acts as a positive regulator, enhancing Arabidopsis' response to salt and drought stress through heterologous expression of its antioxidant system and ABA-mediated signaling network (Wang J, Li C, Yao X, Liu S, Zhang P, Chen K: The Antarcticmoss leucine-rich repeat receptor-like kinase (PnLRR-RLK2) functions insalinity and drought stress adaptation. Polar Biology 2017, 41(2):353-364.). The expression of rice stress-induced protein kinase OsSIK1 is mainly induced by salt, drought, and H2O2. Overexpression of OsSIK1 in rice exhibits higher salt tolerance and stronger stems and leaves, while knockout mutants and RNA interference (RNAi) plants lead to increased sensitivity to these stresses (Ouyang SQ, Liu YF, Liu P, Lei G, He SJ, Ma B, Zhang WK, Zhang JS, Chen SY. Receptor-like kinase OsSIK1 improves drought and saltstress tolerance in rice (Oryza sativa) plants. Plant J 2010). Therefore, LRR-RLKs are the most numerous subfamily in the plant receptor protein kinase family, playing an important role in plant growth and development, hormone signal transduction, and stress resistance. Recently, this invention also identified a rice LRR receptor kinase OsHPCA1 involved in H2O2 scavenging in rice, improving the rice's salt tolerance and oxidative stress tolerance. Therefore, it is utilized through biotechnology. OsHPCA1 Developing salt-tolerant and oxidative stress-resistant rice varieties to improve saline-alkali land is of great practical significance. Summary of the Invention

[0005] This invention provides a key gene for tolerance to salt and oxidative stress. OsHPCA1 This gene positively regulates rice's tolerance to salt and oxidative stress by participating in the scavenging of H2O2 in rice.

[0006] The details are as follows: OsHPCA1 Application of genes in improving the regulation of rice's tolerance to salt and / or oxidative stress.

[0007] According to some embodiments of the present application, the regulation comprises knocking out, silencing or overexpressing the OsHPCA1 gene in rice by a genetic engineering method to obtain rice with different CatC activity and salt or oxidative stress response.

[0008] According to some embodiments of the present application, the nucleotide sequence of the OsHPCA1 gene is shown in SEQ ID NO: 1. The cDNA sequence of the OsHPCA1 gene is shown in SEQ ID NO: 2. The amino acid sequence encoded by the OsHPCA1 gene is shown in SEQ ID NO: 3.

[0009] The present application also provides a method for regulating the salt and / or oxidative stress tolerance of rice by knocking out, silencing or overexpressing the OsHPCA1 gene in rice by a genetic engineering method to obtain rice with different CatC activity, salt or oxidative stress response.

[0010] According to some embodiments of the present application, the nucleotide sequence of the OsHPCA1 gene is shown in SEQ ID NO: 1. The cDNA sequence of the OsHPCA1 gene is shown in SEQ ID NO: 2. The amino acid sequence encoded by the OsHPCA1 gene is shown in SEQ ID NO: 3.

[0011] According to some embodiments of the present application, the method obtains transgenic rice; the transgenic rice has improved salt tolerance; and the transgenic rice is sensitive to salt stress.

[0012] According to some embodiments of the present application, the genetic engineering method is a transgenic method for obtaining a transgenic rice with overexpressed genes, increasing the CatC activity of the transgenic rice and improving its salt and / or oxidative stress tolerance.

[0013] According to some embodiments of the present application, the genetic engineering method is a gene knockout or RNAi interference method for silencing genes to obtain a transgenic rice, reducing the CatC activity, salt tolerance and / or oxidative stress tolerance of the transgenic rice.

[0014] The present application also provides an application of the OsHPCA1 gene in rice with changed CatC activity, salt tolerance and / or oxidative stress tolerance.

[0015] According to some embodiments of the present invention, gene silencing is achieved by gene knockout or RNAi interference to obtain transgenic rice, thereby reducing the CatC activity, salt tolerance, and / or oxidative stress tolerance of the transgenic rice; or gene overexpression is achieved by transgenic methods to increase the CatC activity and improve the salt tolerance and / or oxidative stress tolerance of the transgenic rice.

[0016] This invention constructs a novel pUC1390 vector by designing primers and adding homologous arms to the pUC1390 vector, followed by homologous recombination and cloning into the pUC1390 vector. OsHPCA1 Overexpression lines were developed. Simultaneously, a CRISPR / Cas9 gene editing system was used to construct... OsHPCA1 Knockout lines were transformed using Agrobacterium-mediated transformation, and homozygous knockout lines were obtained by sequencing and Western blotting, respectively. oshpca1 and overexpression lines. Under NaCl treatment, the seedling-stage overexpression lines... OsHPCA1 The salt tolerance was significantly stronger than that of wild-type WT, and its survival rate, CAT activity, and H2O2 content were all significantly higher than those of WT, while the mutants showed the opposite. Furthermore, OsHPCA1 The tolerance of rice to salt and oxidative stress was regulated from the seedling stage, specifically by improving the tolerance of rice to salt and oxidative stress during the seedling stage.

[0017] In summary, OsHPCA1 This invention enhances the ability to scavenge reactive oxygen species and positively regulates rice's tolerance to salt and oxidative stress. The gene in this invention positively regulates rice salt tolerance. OsHPCA1 It has important application value in cultivating salt-tolerant rice and improving rice quality.

[0018] This invention provides a product containing OsHPCA1 Expression vectors, transgenic cell lines, and host bacteria.

[0019] The method described in this invention, wherein OsHPCA1 The gene is derived from rice ( Oryza sativa L.), whose nucleotide sequence is shown in SEQ ID NO:1 and whose encoding amino acid sequence is shown in SEQ ID NO:3.

[0020] This invention also provides a method for improving the salt and oxidative stress tolerance of rice: the method involves using the gene for improving the salt and oxidative stress tolerance of rice. OsHPCA1 Introducing the drug into rice tissues or cells improves the rice's tolerance to salt and oxidative stress.

[0021] The genetic engineering method described herein is to silence genes through gene knockout or RNAi interference, thereby reducing the salt tolerance and oxidative stress resistance of transgenic rice; or to overexpress genes through transgenic methods, thereby increasing the salt tolerance and oxidative stress resistance of transgenic rice. Furthermore, this invention also provides... OsHPCA1Application of the gene in the plant with improved salt tolerance and oxidative stress tolerance; The application is to silence the gene by gene knockout or RNAi interference method, to reduce the salt tolerance and oxidative stress tolerance of the transgenic rice; or to increase the salt tolerance and oxidative stress tolerance of the transgenic rice by transgenic method of gene overexpression.

[0022] The application provides a salt and oxidative stress tolerance protein gene of rice and a protein encoded by the gene. OsHPCA1 The gene plays an important role in the response of rice to salt and oxidative stress, and positively regulates the salt tolerance and oxidative stress tolerance of rice. By gene knockout or RNAi interference method to silence the gene, and transgenic rice of gene overexpression, the salt and oxidative stress tolerance of the transgenic plant is changed, and then a transgenic plant variety with salt and oxidative stress tolerance is bred. Experiments show that by transgenic method of gene overexpression, the salt tolerance and oxidative stress tolerance of the transgenic rice is improved, and by CRISPR / Cas9 method, the salt and oxidative stress tolerance of the transgenic rice is significantly reduced. OsHPCA1 The gene knockout significantly reduces the salt and oxidative stress tolerance. It is shown that by transgenic technology of gene overexpression, the salt and oxidative stress tolerance of rice can be genetically improved, and the gene has a wide application prospect in the field of agricultural application. OsHPCA1 The gene can genetically improve the salt and oxidative stress tolerance of rice, and has a wide application prospect in the field of agricultural application. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 OsHPCA1 Gene structure analysis.

[0024] Figure 2 OsHPCA1 Expression pattern and transcription induced by salt and H2O2 stress.

[0025] Figure 3 OsHPCA1 Transgenic plant identification.

[0026] Figure 4 OsHPCA1 Positively regulating the oxidative stress tolerance of rice.

[0027] Figure 5 OsHPCA1 Positively regulating the salt stress tolerance of rice seedlings. DETAILED DESCRIPTION

[0028] The application will be further described below in combination with specific examples. The experimental methods mentioned in the following examples are all conventional methods unless otherwise specified.

[0029] 1. OsHPCA1 Structure analysis and expression pattern analysis (1) Gene structure analysis: Downloaded from the rice database (http: / / rice.plantbiology.msu.edu) OsHPCA1 The coding sequence of (LOC Os05g40770) was compared with that of Japan's Haruhi. OsHPCA1 The cDNA and its genomic DNA sequence were found OsHPCA1 There are 18 exons (5' end of SEQ ID No:1: 275-362, 512-632, 727-798, 1384-1458, 1556-1627, 1726-1877, 1994-2065, 2146-2217, 2317-2388, 2463-2531, 2616-2690, 2780-2852, 2937-3069, 3178-3656, 3939-4097, 4274-4633, 4758-4990, 5444-5968) and 17 introns (SEQ ID No:1). The 5' end of No:1 is 363-511, 633-726, 799-1383, 1459-1555, 1628-1725, 1878-1993, 2066-2145, 2218-2316, 2389-2462, 2532-2615, 2691-2779, 2853-2936, 3070-3177, 3657-3938, 4098-4273, 4634-4757, 4991-5443; its full-length genome is 6143 bp (SEQ ID No:1), and its full-length cDNA is 2619 bp (SEQ ID No:2). Its open reading frame is SEQ ID No. No:2 contains 2619 bases from position 1 to position 2619 at the 5' end; the protein encoded by this gene is 872 amino acids in length. Figure 1 ).

[0030] (2) Expression pattern analysis: To investigate the subcellular localization, expression characteristics, and expression pattern of OsHPCA1 in different tissues and organs, this invention constructed corresponding vectors. Subcellular localization analysis revealed that OsHPCA1 is granularly localized on the cell membrane and in the cell nucleus ( Figure 2 A). Tissue-specific expression suggests that OsHPCA1 is mainly expressed in stems, 4-day-old seedlings, leaf sheaths, and young spikelets, with the highest expression level in stems (A). Figure 2The presence of BG suggests that OsHPCA1 may function in these different tissues and organs. Expression pattern analysis was then performed. Nipponbare seedlings were treated with 140 mM NaCl, 20% PEG, 60 mMALK, and 1% H2O2 for 0, 2, 4, 6, 8, 10, 12, and 24 h, respectively. RNA was then extracted and reverse transcribed into cDNA. qRT-PCR was performed using the cDNA as a template. OsHPCA1 Changes in transcriptional levels.

[0031] The qRT-PCR primers are F: 5'-GCCATGTCTCCACCCAAGTC-3'; R: 5'-TCACCAGCTCCAGCATCAC-3'.

[0032] The results showed that, under the conditions of NaCl, H2O2, PEG, and ALK treatment, the wild type showed increasing degradation with increasing treatment time. OsHPCA1 mRNA expression level with OsHPCA1 Gene expression levels increased, with the highest levels observed at 6 or 8 hours. Figure 2 HK), and then the expression level began to decrease, but except for NaCl, PEG and H2O2 treatment for 10 h, ALK from the treatment for 10 h, OsHPCA1 Gene expression levels began to rise again. These results indicate that... OsHPCA1 The expression of OsHPCA1 is induced by salt, alkali, drought, and H2O2, suggesting that OsHPCA1 plays an important role in these four stress responses. As an H2O2-specific receptor, OsHPCA1's function is closely related to plant oxidative stress tolerance. Simultaneously, salt stress induces intracellular ROS bursts (including excessive H2O2 accumulation), leading to oxidative damage. Therefore, this invention focuses on the dual regulatory mechanism of OsHPCA1 in salt and oxidative stress, exploring how this gene simultaneously enhances rice's salt tolerance and oxidative stress resistance through the H2O2-CatC signaling axis.

[0033] 2. Gene cloning and vector construction (1) Homologous recombination cloning: Designed using Primer Premier 5 OsHPCA1 Specific primers; Positive: 5' ATGGAGCCGCGGGTGTTGA 3'; Reverse: 5' CTTGGGCTTGACCTCAAAATAGG 3'.

[0034] And add a homologous arm of the pUC1390 vector at the 5' end; Positive: TCTGCACTAGGTACCTGCAG; Reverse: ATGGATCCGTCGACCTGCAG.

[0035] Using *Oryza sativa* L. japonica cv. Nipponbare cDNA as a template, PCR amplification was performed. OsHPCA1 The full-length gene sequence was obtained. The target gene was cloned into the pUC1390 vector via homologous recombination. After sequencing verification, it was transformed into E. coli DH5α by heat shock to obtain the recombinant plasmid pUC1390-OsHPCA1.

[0036] (2) Construction of CRISPR / Cas9 knockout vector A sgRNA targeting OsHPCA1 was designed, and the pYLCRISPR / Cas9-OsHPCA1 knockout vector was constructed. This vector was then transformed into callus tissue of the rice variety Kitaake using Agrobacterium EHA105. The infected callus tissue was co-cultured for 3 days (in the dark, at 28℃), followed by selection of resistant callus on a selection medium containing 50 mg / L hygromycin, and differentiation into resistant seedlings on a differentiation medium. The differentiated rice plants were then hydroponically hardened off in a cool place for one week before being transplanted to the field. Twelve OsHPCA1-FLAG overexpression lines were successfully obtained, and two lines (OsHPCA1-FLAG-21 and OsHPCA1-FLAG-41) were selected for subsequent experiments. Figure 3 B) and two homozygous mutants ( oshpca1-3 and oshpca1-4 , Figure 3 D).

[0037] The mutant oshpca1-3, due to a 4 bp deletion at the target site, causes premature termination of the protein at the 35th amino acid. -4 The protein terminates prematurely at the 36th amino acid due to the deletion of 1 bp. Figure 3 ).

[0038] 3. OsHPCA1 Gene function research (1) Phenotypic analysis of transgenic plants Methyl viologen (MV), a plant oxidative stress inducer, was used to simulate oxidative stress on wild-type and... OsHPCA1 When transgenic rice seedlings were treated, it was found that under normal conditions, there was no significant difference in growth between transgenic and wild-type seedlings. Figure 4 A).

[0039] In contrast, after 6 days of treatment with 4 μM MV, overexpression OsHPCA1 The seedlings are greener than the wild type, andoshpca1 The mutants exhibited yellowing and dwarfing phenotypes. Figure 4 A). Subsequently, to assess its oxidative tolerance from physiological data, seedling length, CAT activity, and H2O2 content of wild-type and transgenic plants under the above normal and treatment conditions were measured. The results showed that the plant height and CAT activity of the overexpression lines were significantly higher than those of the wild type, while the H2O2 content was significantly lower; conversely, oshpca1 The mutant's plant height and CAT activity were significantly lower than those of the wild type. Figure 4 BC), while the H2O2 content increased significantly ( Figure 4 D), Explanation OsHPCA1 Positively regulates the oxidative tolerance of rice.

[0040] Furthermore, this invention also demonstrated the results in another oxidative stress experiment. Wild-type and transgenic seedlings at the three-leaf stage were treated with 100 mM H2O2. After 2 days of H2O2 treatment, [the following was observed / observed / etc.]. oshpca1 The mutant exhibited severe necrosis and bleaching, with a greater degree of bleaching than the wild type, while overexpression remained green. However, under normal conditions, the leaves of both wild-type and transgenic plants were normal. Figure 4 E). In addition, the accumulation of H2O2 was further detected by DAB staining.

[0041] Under normal growth conditions, no obvious staining was observed in either transgenic or wild-type plants; after 2 days of H2O2 treatment, compared with the wild-type, overexpression... OsHPCA1 The staining intensity of the leaves was lower than that of WT, meaning that less H2O2 accumulated during overexpression. oshpca1 The mutant leaves showed the most severe staining, indicating a higher accumulation of H2O2 in the mutant. Figure 4 F).

[0042] Salt stress can also induce oxidative stress, and improving antioxidant capacity can also improve the salt tolerance of rice. The following section of this invention will further investigate... OsHPCA1 The study investigated whether this would alter the salt tolerance of rice: wild-type and... OsHPCA1 Genetically modified plants were discovered. OsHPCA1 The overexpression transgenic lines showed significantly better growth than the wild-type. oshpca1 The mutant strains mostly withered compared to the wild type, while under normal conditions, there was little difference in the growth status of each plant. Figure 5 A). Further statistical analysis of the survival rate of each plant revealed... OsHPCA1 The survival rate of overexpression lines was significantly higher than that of wild-type lines, while the survival rate of mutant lines was significantly lower than that of wild-type lines. Figure 5(BC). Relative ion leakage rate can directly reflect the integrity of plant cell membranes. The results showed that under normal conditions, there was no significant difference in the relative conductivity between wild-type and transgenic lines, but after treatment with 140 mM NaCl... OsHPCA1 The relative electrical conductivity of the overexpressing transgenic lines was significantly lower than that of the wild type. oshpca1 The relative conductivity of the mutant lines is higher than that of the wild type. Figure 5 F). This indicates that the membrane damage in the overexpressing plants was significantly less than that in the wild type, while the damage in the mutants was significantly greater than that in the wild type. Furthermore, chlorophyll content analysis results also showed that under normal conditions, there was no significant difference in chlorophyll content between the wild-type and transgenic lines, but under NaCl treatment conditions… OsHPCA1 The chlorophyll content in the overexpressing transgenic lines was significantly higher than that in the wild type, while the content in the mutant lines was significantly lower than that in the wild type. Figure 5 D). MDA is one of the products of cell membrane lipid peroxidation. Accumulation of MDA can further exacerbate membrane damage, affecting plasma membrane integrity and normal physiological function. Therefore, MDA content is often used to evaluate the degree of damage to plants under abiotic stress. MDA detection results in this study showed that under salt treatment, overexpression... OsHPCA1 The malondialdehyde (MDA) content in the transgenic lines was significantly reduced, while that in their mutants it was significantly increased. Figure 5 E). The results of these physiological indicators further prove that... OsHPCA1 It positively regulates the salt tolerance and antioxidant stress resistance of rice seedlings.

[0043] It should be noted that the present invention is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments that have the same structure and perform the same effects as the technical concept within the scope of the present invention are included within the scope of the present invention. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of the present invention, are also included within the scope of the present invention.

[0044] sequence list <110> Hunan Agricultural University <120> A leucine-rich repeat receptor kinase OsHPCA1 Application of genes to enhance rice's tolerance to salt and oxidative stress <130> Application of a leucine-rich repeat-sequence receptor kinase OsHPCA1 gene to enhance rice tolerance to salt and oxidative stress <160> 5 <210> 1 <211> 4398 <212> DNA <213> Rice (Rice)Oryza sativa L . <400>SEQ ID NO: 1 acactctgat catccatccg cgggtgggtt gacctcttcc cggcggcgcg gcgagagaag 61 ggaagacttc aacccggccg cggttggtgg cgccatcact ccccggcccc cgcgcccacc 121 atatacaccg aggcgtcgtc gcctccccgc accttgcgcg gactcttctc ctcttcttcc 181 tccacctcct cctccacgat ctccggtcaa gcagagcaca agcgtgtgct agctctcccg 241 gtggcttgcc tcgccggcga cggcgcggcg caggatggag ccgcgggtgt tgatggctct 301 tgcgctggtg gtggtggcgg cgggcgtgcc ggcggtgttg tgccagacca acgcccagga 361 cggtgagtgc tcttgcctcg ccgccggcga tcacctccgt ttcttccata gatgattcta 421 aagtcaggca ggatcttctt gcccggagaa gaatcgcttg gtttttgttg ctggtgttga 481 tgatcttctt cttgggcatg catgcgtgca gctgcggcgc tcgaggggct gaagagccaa 541 tggacgaact acccgttgag ctggaactcc ggcgacccct gcggcggcgg atgggacggc 601 atcatgtgca ccaacggcag ggtgacgacg ctgtaagtta cagccatctc cttctcctcc 661 taccaccaat atcatgtgat gggccttcct ctgaaatcgt gccatggatg tctctggttt 721 ttgcaggagg ctgtcaagcg tcagcctgca gggaacactg agcagcagca tcggccagct 781 cggccagctc acgtacctgt aagcaccttc ttctatcatc agttcatcac ccagcttagc 841 aaaagttcaa aacagcatga ttttgcaggc tatgaacttg ggattttcga aattttgttc 901 atgcttctgt agcagttcag attgtgaatt caggcaatca ggctaggaac ttctgattga 961 accagtcaag gggcagattg tcagaacagt ttgcttctag tttatgaact ctgctttttt 1021 ttttcttgag gcttagttca gctgaccagt tcatgtttac caatcttaagctttgactat 1081 ttcggcaatg tgacatggat taggttcatt tcttaccaaa tgaaagaaacaaagatatga 1141 tgccaagtta caatagtaaa tagatctgga tgaaatatct gaagctttgactattttcgc 1201 aatgtgacat ggattaggct catttcttac caaaagaaag aaacaagatactacacttga 1261 agttaaatta tcaatagcaa acgtacctgg atgaaatgat ccgtgacaaagttctggagt 1321 acaactaatt tgtctaagaa gaaatagtct agtagtagta gctgataacagaaacacttg 1381 cagggatctt tccttcaaca tcaatctcgg tggtccgctg ccagctgagattgggaacct 1441 tggggagctt acgacactgt atgcgccgca ctgcccattg ttgtcaacactactttttcc 1501 aatcagaaat accaaacttt cttactgatg tgcacaaatg ctgtgtaattgtcaggatct 1561 tagctggttg cagcttcact ggaaacattc caatagcaat aggcaacctgcggaaacttg 1621 ggttcttgta agtggatata cctggtccac agtttcagat gataaaccctttttttcttt 1681 tcttttgagt ggattgacat aatgaattcg tgccattctc tatagggccttgaattcaaa 1741 caagtttagt ggtggaatac cgtcttcgat tggcgtactc acaaacctcttatggctaga 1801 cctggctgat aatcaactca ctggatctgt ccccatctca acatcaacatcaccaggcct 1861 ggaccaactt gtcaaaacgc agcacttgta agtaatttta atcttactttatggtattat 1921 caattgagaa atatcagaat atgtaagtac ttacaattga ttgttttgctccaaacttca 1981 aattgatgaa cagccatttc aacaagaacc agttaactgg aacgcttactggacttttca 2041 actccaatat gactctcata cacatgtaag ggatcgacaa attttcatgtctaatatgaa 2101 taccgaatag atatatcttg ctaacatctc tccctatctc gtcagtttgt ttgatagcaa 2161 caaattctca ggctcaatcc cagctgaggt tgggactgtt agtacactc gaagttctgta 2221 agtatcttga aagttcacat aggtggaact catcctttta ttttctccaa aaaaaaat 2281 ggtcatatct ttgacttgct tttgtatctt ttgacagccg attggatagg aatggtttta c 2341 gggagcaata cctgctacaa ttggcagttt ggtcaaactg aatgagctgt aagtgacatc 2401 tgatcttaaa ggaagagtta tgacacttga ggcacctctc ttgaaaatgt tatcttctgc 2461 aggaacttag caaacaacaa gctaactgga tcagtgccag atctcagcaa catgaccaac 2521 ttgaatgttg tgtaagaaac taaccacccc catgcctcat catccaatca tataatttgt 2581 ctgcataact aaagattcca ctcttgaatt gccagggatt tgagcaacaa cacatttgat 2641 ccttcagtgg cccccagctg gttcacatct ttaacatctc ttgcttctgt gtgagttatc 2701 caaaactttt ggaattttaa attttgtgtc gtcttgtgat gacaatttca ctactcatct c 2761 tatatgtttt gatcactcag ttcaatagtt tctggaagtc tttctggcca ggtcccaaag 2821 gggctcttca cattgcccac actgcagcaa gtgtaatttt ctggtaacttacaactcaac 2881 atataagctt taaaaaaaag tgtcttatct ctgcctattt tgtggccaatcggacagtgt 2941 gctgagcaac aaccaattca acgggacact tgaaattaca ggcaacatcagcagctcact 3001 gcagacagta aatctcatgg acaaccgaat agtttctacc gatactgcaagctacaagaa 3061 aactctactg taagaacctg caaactcaat aagaaccaag aacaccatacaatcttcgtc 3121 ttctctccta cctttcacca acattgcctc acttctcatg ccatatcctgtctgcagcct 3181 ggcaggtaat ccgttttgcg ccgagcaaga tcccaacaac agagccttctgcagcaggca 3241 gctacagaac gcgagcccat acagtaccag tatggaaaaa tgcggctcagctcagtgcag 3301 tgatggtcag aacgtgaacc ctgcaagctg cggctgtgct ttctcatacaacggcaagat 3361 ggttttcagg gcacccttct tcgtcgactt ggtgagcagt acgccgttccagctgctgga 3421 gtcgaccatg gcggcaaagc tgaacctgct ccctggctcg gtcgctctctcagacatcca 3481 cttcaacagt gacaactacc tccaagttca agtgaagctg ttcccaacatccggggtgac 3541 cttcaacctg tcagaattga caaggattgg ttcttctctc agtaaccagatttacaaacc 3601 accagcaaat tttggacctt atttcttcat tgcagaccca tatgcccccttggcaggtac 3661 ttggatttca ctgtgtcgag actcccactt tatttgcact gaagtagttttagttttccc 3721 tttgagaatg cagaggtatc aaaattacag cttaggaaat accacatttcgttatctgag 3781 ggttggtatc ttgaaagttt taatttttta cttctaaatt gcaattaatgagatgctaaa 3841 aggactctgc tattttatgt cggagagttt agtatttgca caaaagtactagtatatagt 3901 ggtgtgagga ttgctcactc tgattttgtg tgtgccagtt gctcttggtggcaaaaaatc 3961 caagatgagc acaggtgcca tagctggaat tgcagtagcc ggtggggtccttgttatcgc 4021 cctcattttc atgtcattgt ttgctctccg acagaagaga agggctaaggaactcaagga 4081 aagagcagac ccttttggta aggatctaaa agctcatagg tatcatgtcactgcaatgcc 4141 accaagcaat ttgtcaggga cacattaaca gctacaagca gcagcatcctactgcatgct 4201 actactggaa taaactgaca agatcaagaa gttctgaaac aactgaacctgttttctgat 4261 ccaaaatttt cagcttcatg ggctgctggc cagaaggaca gtggaggggctccacagctg 4321 aagggagcaa ggttcttctc ctttgacgag ctcaagatct gcaccaacaacttctctgac 4381 aaccacgaga tcgggtca <210>2 <211>2619 <212>cDNA <213>Water Rice (Oryza sativa) Oryza sativa L.) <400>SEQ ID NO:2 <210>3 <211>872 <212>PRT <213>ORYZA SATIVA (RICE) Oryza sativa L. ) <400>SEQ ID NO:3 MEPRVLMALALVVVAAGVPAVLCQTNAQDAAALEGLKSQWTNYPLSWNSGDPCGGGWDGIMCTNGRVTTLRLSSVSLQGTLSSSIGQLGQLTYLDLSFNINLGGPLPAEIGNLGELTTLILAGCSFTGNIPIAIGNLRKLGFLALNSNKFSGGIPSSIGVLTNLLWLDLADNQLTGSVPISTSTSPGLDQLVKTQHFHFNKNQLTGTLTGLFNSNMTLIHILFDSNKFSGSIPAEVGTVSTLEVLRLDRNGFTGAIPATIGSLVKLNELNLANNKLTGSVPDLSNMTNLNVVDLSNNTFDPSVAPSWFTSLTSLASVSIVSGSLSGQVPKGLFTLPTLQQVVLSNNQFNGTLEITGNISSSLQTVNLMDNRIVSTDTASYKKTLLLAGNPFCAEQDPNNRAFCSRQLQNASPYSTSMEKCGSAQCSDGQNVNPASCGCAFSYNGKMVFRAPFFVDLVSSTPFQLLESTMAAKLNLLPGSVALSDIHFNSDNYLQVQVKLFPTSGVTFNLSELTRIGSSLSNQIYKPPANFGPYFFIADPYAPLAVALGGKKSKMSTGAIAGIAVAGGVLVIALIFMSLFALRQKRRAKELKERADPFASWAAGQKDSGGAPQLKGARFFSFDELKICTNNFSDNHEIGSGGYGKVYRGILGDGTRVAIKRADRNSMQGAVEFKNEIELLSRVHHRNLVSLIGFCYEQGEQMLVYEYISNGTLRENLTGSGMYLDWKKRLRIALGSARGLAYLHELADPPIIHRDIKSTNILLDNNLKAKVADFGLSKLVADTEKGHVSTQVKGTLGYLDPEYYMTQQLSEKSDVYSFGVVMLELVSGRQPIEKGRYVVREVRLAIDPADHDHHYGLRGIVRRRWRVGLHALF-.

Claims

1. OsHPCA1 Application of genes in improving the regulation of salt and / or oxidative stress tolerance in rice.

2. The application according to claim 1, characterized in that, The regulation includes using genetic engineering methods to modify the rice... OsHPCA1 Gene knockout, silencing, or overexpression were used to obtain rice varieties with different CatC activities and responses to salt or oxidative stress.

3. The application according to claim 1, characterized in that, The OsHPCA1 The nucleotide sequence of the gene is shown in SEQ ID NO:1; The OsHPCA1 The cDNA sequence of the gene is shown in SEQ ID NO:2; The OsHPCA1 The amino acid sequence encoded by the gene is shown in SEQ ID NO:

3.

4. A method for regulating the tolerance of rice to salt and / or oxidative stress, characterized in that, Using genetic engineering methods to extract the essence of rice OsHPCA1 Gene knockout, silencing, or overexpression were used to obtain rice varieties with different CatC activities, salt or oxidative stress responses.

5. The method as described in claim 4, characterized in that, The OsHPCA1 The nucleotide sequence of the gene is shown in SEQ ID NO:1; The OsHPCA1 The cDNA sequence of the gene is shown in SEQ ID NO:2; The OsHPCA1 The amino acid sequence encoded by the gene is shown in SEQ ID NO:

3.

6. The method as described in claim 4 or 5, characterized in that, The method yields transgenic rice; the transgenic rice exhibits enhanced salt tolerance; the transgenic rice is sensitive to salt stress.

7. The method as described in claim 4 or 5, characterized in that, The genetic engineering method described above obtains transgenic rice with gene overexpression through transgenic methods, thereby increasing the CatC activity of the transgenic rice and improving its tolerance to salt and / or oxidative stress.

8. The method as described in claim 4 or 5, characterized in that, The genetic engineering method described above involves silencing genes through gene knockout or RNAi interference to obtain transgenic rice, thereby reducing the CatC activity, salt tolerance, and / or oxidative stress tolerance of the transgenic rice.

9. A kind OsHPCA1 Application of genes in rice with altered CatC activity, salt tolerance, and / or oxidative stress tolerance.

10. The application as described in claim 9, characterized in that, Gene silencing can be achieved through gene knockout or RNAi interference to obtain transgenic rice, which reduces CatC activity, salt tolerance, and / or oxidative stress tolerance; or gene overexpression can be achieved through transgenic methods to increase CatC activity and improve salt tolerance and / or oxidative stress tolerance.

Images