Gene marker for diagnosing latent tuberculosis infection and application thereof

Abstract

The invention discloses a gene marker for diagnosing latent tuberculosis infection and application of the gene marker, and belongs to the technical field of biological medicine. According to the present invention, the latent tuberculosis infection early diagnosis marker is screened based on the peripheral blood whole genome DNA methylation map, the new target is provided for the diagnosis of latent tuberculosis infection, the diagnosis efficiency of the marker is evaluated through pyrosequencing, the corresponding detection kit and the use method are developed, and the rapid and accurate diagnosis of latent tuberculosis infection is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a gene marker for diagnosing latent tuberculosis infection and an application thereof. Background Art

[0002] Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium tuberculosis (MTB), a serious threat to human health. Infection with MTB ranks among the highest causes of death among single infectious diseases. MTB infection can lead to diverse disease progression and outcomes, ranging from latent tuberculosis infection (LTBI) before developing disease to active pulmonary TB (differentiated into etiology-positive and -negative pulmonary TB) after infection. Accurate diagnosis of latent TB infection (LTBI) is a major challenge in global TB prevention and control. While existing mainstream diagnostic methods, such as the interferon-gamma release assay (IGRA) and tuberculin skin test (TST), can detect M. tuberculosis infection, they are ineffective in diagnosing latent TB infection and have limited sensitivity and specificity (e.g., IGRA sensitivity is 87.9% and specificity is 79.8%). Furthermore, these immunological methods cannot predict the risk of latent infection progressing to active tuberculosis, resulting in a lack of precision in clinical intervention strategies. Therefore, the exploration of novel biomarkers to improve diagnostic efficacy is urgent.

[0003] Epigenetics has advanced rapidly in recent years, with the role of DNA methylation in infectious diseases receiving significant attention. As a key mechanism of epigenetic regulation, DNA methylation has shown promise in tuberculosis diagnosis. Studies have shown that the methylation status of CpG sites in specific genes is closely associated with different stages of tuberculosis. For example, hypermethylation in the SIRT1 gene promoter region has been shown to be a distinguishing marker for active pulmonary tuberculosis. A classifier constructed using machine learning for methylation sites in the TSPAN4 gene achieved high diagnostic accuracy (AUC = 0.83) in blood samples. Furthermore, methylation signature analysis based on buccal swabs revealed that a classifier consisting of seven specific CpG sites achieved an AUC of 0.94 in the validation set, suggesting potential for application in non-invasive samples. However, existing studies have primarily focused on distinguishing active tuberculosis from healthy individuals or have relied on multi-marker combined testing. The value of single methylation sites in the specific diagnosis of LTBI and the development of corresponding diagnostic methods have yet to be fully explored.

[0004] The RUFY1 gene, also known as RABIP4 and ZFYVE12, primarily functions in endocytosis and membrane trafficking. The protein it encodes contains a RUN domain and an FYVE-type zinc finger domain. This protein binds to phosphatidylinositol 3-phosphate (PI3P) on the membranes of early endosomes, playing a key role in early endosomal trafficking, tethering, and fusion. RUFY1 also regulates the activity of small GTPases within the RAB family. RAB proteins play a crucial role in intracellular membrane trafficking, and RUFY1 interacts with these proteins to regulate their activity, thereby influencing intracellular transport pathways.

[0005] The present invention uses the peripheral blood genomic DNA methylation levels of latent tuberculosis infection and healthy control groups to find that the methylation level of RUFY1 is increased in patients with latent tuberculosis infection. The present invention's technicians predict that RUFY1 can be used as a gene marker for diagnosis or auxiliary diagnosis of latent tuberculosis infection.

[0006] In view of this, the present invention provides the following technical solutions. Summary of the Invention

[0007] To address the problems of poor specificity, low sensitivity, and time-consuming testing in existing latent tuberculosis infection diagnostics, the present invention provides a technical concept based on the whole-genome DNA methylation profile of peripheral blood as an early diagnostic marker for latent tuberculosis infection, providing a new target and method for the diagnosis of latent tuberculosis infection. The present invention first screens for differentially methylated sites that can be used to diagnose latent tuberculosis infection, evaluates their diagnostic efficacy, and develops corresponding detection kits and methods for use to achieve accurate and rapid diagnosis of latent tuberculosis infection.

[0008] The present invention includes the following technical solutions: In a first aspect, the present invention provides a use of a gene marker methylation level or a reagent for detecting a gene marker methylation level in the preparation of a product for diagnosing and / or assisting in the diagnosis of latent tuberculosis infection, wherein the gene marker is RUFY1.

[0009] The product includes but is not limited to any one of a reagent, a test paper, a membrane strip, a chip, a test kit or a detection platform.

[0010] The methods for detecting gene methylation levels are known in the art, including but not limited to bisulfite sequencing, PCR, methylation-specific PCR, pyrophosphate sequencing, Sanger sequencing, high-throughput sequencing, third-generation sequencing, single-molecule sequencing, gene chips, chromatography, mass spectrometry or electrophoresis.

[0011] In the present invention, the reagents for detecting the methylation level of the gene marker include any reagents required for detecting the methylation level of the RUFY1 gene by any one or a combination of two or more of bisulfite sequencing, PCR, methylation-specific PCR, pyrosequencing, Sanger sequencing, high-throughput sequencing, third-generation sequencing or single-molecule sequencing.

[0012] In some embodiments of the present invention, the reagent for detecting the methylation level of the gene marker is selected from the reagent required for detecting the methylation level of the RUFY1 gene using gene methylation chip technology.

[0013] In some embodiments of the present invention, the reagent for detecting the methylation level of the gene marker is selected from the reagent required for detecting the methylation level of the RUFY1 gene by pyrosequencing technology.

[0014] In some embodiments of the present invention, the reagent for detecting the methylation level of the gene marker is selected from the reagents required for detecting the methylation level of the RUFY1 gene by methylation-specific PCR (MSP), preferably quantitative methylation-specific PCR (qMSP) technology.

[0015] In a specific embodiment of the present invention, the reagent for detecting the methylation level of the RUFY1 gene is a reagent required for detecting the methylation level of the RUFY1 gene by quantitative methylation-specific PCR (qMSP) technology.

[0016] The reagents include primers shown in SEQ ID NO.5-6 and a probe shown in SEQ ID NO.7.

[0017] .

[0018] Furthermore, the reagents for detecting the methylation level of the RUFY1 gene also include conventional reagents based on quantitative methylation-specific PCR detection, including but not limited to converters, DNA polymerase, dNTPs, Mg 2+ and buffer.

[0019] In a second aspect, the present invention provides a primer-probe combination for detecting the methylation level of the RUFY1 gene based on quantitative methylation-specific PCR (qMSP) technology, comprising primers shown in SEQ ID NOs. 5-6 and a probe shown in SEQ ID NO. 7.

[0020] Furthermore, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0021] The present invention does not specifically limit the fluorescent reporter group and the fluorescent quencher group, and those skilled in the art can select them according to specific needs. In some embodiments of the present invention, the fluorescent reporter group is selected from at least one of FAM, VIC, or CY5, and the fluorescent quencher group is selected from at least one of MGB, BHQ, or TAMRA.

[0022] In a third aspect, the present invention provides a kit for detecting the methylation level of the RUFY1 gene based on quantitative methylation-specific PCR (qMSP) technology, wherein the kit comprises the primer-probe combination according to the second aspect of the present invention.

[0023] Furthermore, the kit also includes a primer-probe combination for detecting the methylation level of a reference gene (SEQ ID NO. 13). The nucleotide sequence of the reference gene is as follows: GGAGGAGGATGCGTATTTCGTTTAGAAGGTTTTTTTAGTTTTTTTTTGTCGGATAGTGTTAGTCGGGTGTTTGTAGGGAAGTATTTTTTTTTTAGTTTTAGGTTTAAATTTTTGTTGTCGATTTTTTGTCGTTATTAGTGGATAATTTTAGGTTTTACGTATAATTTTGTTTTTTGGTAAGGAAAATCGTTGGAGTTAAATGAATTTAGAGAGTTTTA.

[0024] In one embodiment of the present invention, to ensure 100% amplification efficiency, probe primers were designed for sequences near the target site that are not involved in methylation changes (reference genes). This reference primer-probe combination consists of primers set forth in SEQ ID NOs. 8-9 and the probe set forth in SEQ ID NO. 10. Relative quantification of the methylation level at the target site in the sample is ultimately obtained through a subtraction reaction.

[0025] .

[0026] Furthermore, the kit also includes common reagents based on quantitative methylation-specific PCR detection, including but not limited to conversion agent, DNA polymerase, dNTPs, Mg 2+ and buffer.

[0027] In the present invention, the conversion agent is used to convert all unmethylated cytosine bases into uracil, leaving the methylated cytosine bases unchanged. The present invention is not particularly limited to the conversion agent, and includes but is not limited to one or a combination of two or more of hydrazine salts, bisulfites, and bisulfites (e.g., sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.).

[0028] In a specific embodiment of the present invention, the kit further includes a positive quality control product and a negative quality control product. Specifically, the positive quality control product is a completely methylated plasmid shown in SEQ ID NO.11, and the negative quality control product is a completely unmethylated plasmid shown in SEQ ID NO.12.

[0029] In a fourth aspect, the present invention provides a use of the primer-probe combination described in the second aspect of the present invention and the kit described in the third aspect of the present invention in preparing a product for diagnosing and / or assisting in the diagnosis of latent tuberculosis infection, wherein the product is used to detect the methylation level of the RUFY1 gene, and the detection comprises the following steps: 1) Sample collection; 2) DNA extraction; 3) DNA sulfidation treatment; 4) Quantitative methylation-specific PCR (qMSP) was used to detect the methylation level of the RUFY1 gene in the sample DNA based on the Ct value.

[0030] Preferably, step 4) further includes performing synchronous real-time quantitative methylation-specific PCR (qMSP) detection on the reference gene to obtain a ΔCT value, ΔCT=CT 样本 -CT 参照 The higher the ΔCT, the lower the methylation level. The diagnostic threshold is ΔCT=6.31-6.43. The latent tuberculosis infection status is judged according to the diagnostic threshold.

[0031] In a specific embodiment of the present invention, step 4) uses the primer-probe combination described in the second aspect of the present invention to detect the methylation level of the RUFY1 gene. Without special limitations, those skilled in the art can configure a methylation-specific PCR reaction system according to specific needs.

[0032] In the present invention, the sample is selected from any one of serum, plasma, tissue, cultured cells, blood, feces, saliva, and urine.

[0033] In a specific embodiment of the present invention, the test sample is peripheral blood, which has the advantages of convenient sampling and non-invasive detection.

[0034] Unless otherwise specified, the sample collection, sample DNA extraction and DNA sulfation treatment described in the present invention are conventional technical means in the field. Those skilled in the art can use, including but not limited to, commercially available kits to complete sample DNA extraction and DNA sulfation treatment.

[0035] The technical solution provided by the present invention has the following advantages: 1. Screening for LTBI diagnostic markers based on DNA methylation levels: Using the 935K methylation array, we detect genomic DNA methylation in whole blood from patients with latent tuberculosis infection and healthy controls, identifying differentially methylated sites as candidate targets. This genome-wide screening approach is more comprehensive and systematic, providing greater opportunities for the discovery of new non-invasive biomarkers.

[0036] 2. Multi-technique combined validation: First, pyrosequencing, the gold standard for methylation detection, is used to verify the methylation level differences and diagnostic efficacy of candidate sites in a large sample. Then, Taqman probe primers are designed for the site, and the methylation level of the sample is detected using the qMSP method. The combination of multiple technologies improves the accuracy and reliability of molecular target validation.

[0037] 3. Propose new diagnostic markers: It was found that high methylation levels of the blood biomarker cg14820908 (RUFY1) can indicate LTBI, providing a new target for the diagnosis of latent tuberculosis infection.

[0038] 4. Development of relevant kits and usage methods: A cg14820908 (RUFY1) methylation level detection kit and its usage method are provided, including a complete process of sample collection, DNA extraction, sulfidation, and methylation level detection, which is highly practical and operational. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 DMR (RUFY1) in patients with latent tuberculosis infection (LTBI) and healthy controls (HC); Figure 2 Pyrosequencing validates DNA methylation molecular targets; A. Box plot showing the distribution of beta values ​​for the cg14820908 (RUFY1) methylation marker in whole-blood DNA from healthy controls (n=40) and LTBI (n=40) validated by pyrosequencing. P values ​​were calculated by t-test, P****≤0.001; B. Receiver operating characteristic (ROC) curve for the cg14820908 (RUFY1) methylation marker in all healthy controls and LTBI samples in the pyrosequencing set. Figure 3qMSP validates DNA methylation molecular targets; A. The methylation level of cg14820908 (RUFY1) in whole blood DNA was measured by qMSP in the validation set (80 healthy controls and 80 LTBI patients). The Y axis represents the methylation level (ΔCT = CT 样本 -CT 参照 ), higher ΔCT indicates lower methylation level, P value was calculated by t-test, P****≤0.001; B. ROC curve of methylation marker cg14820908 (RUFY1) in all healthy controls and LTBI in qMSP set. DETAILED DESCRIPTION

[0040] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts are within the scope of protection of the present invention.

[0041] The research involved in this invention was reviewed and approved by the Ethics Committee of Beijing Center for Disease Control and Prevention (No. 15, 2023). The study details have been explained to the patients or their guardians, and written informed consent has been obtained.

[0042] Example 1 Methylation chip reports elevated RUFY1 methylation levels in LTBI Objective: To screen differentially methylated sites as candidate biomarkers by performing 935K methylation array analysis on whole-genome DNA from peripheral blood of 5 patients with LTBI and 5 healthy controls (HC).

[0043] 1. Sample Collection Collect 500 μL of peripheral blood samples from the research subjects, which can be directly operated or frozen at -80℃.

[0044] 2. DNA Extraction Refer to the instructions of Tiangen DNA Extraction Kit (DP348) and perform the following steps: (2.1) Remove the sample from -80°C and thaw in a 38°C water bath. Centrifuge briefly, transfer to a 15 mL centrifuge tube, add 1-2.5 mL of CL, and mix by inversion. Centrifuge at 10,000 rpm (~11,500 x g) for 1 min, and carefully aspirate and discard the supernatant. (2.2) Add 200 μL of Buffer GB and 20 μL of Proteinase K premix, mix thoroughly by inversion, and incubate at 56°C for 10 min, inverting several times until the solution becomes clear. (2.3) After incubation at room temperature for 2–5 min, add 350 μL of Buffer BD, mix thoroughly by inversion, and transfer to adsorption column CG2 (which is placed in a collection tube). Centrifuge at 12,000 rpm (~13,400 x g) for 30 sec. Discard the liquid in the collection tube and transfer adsorption column CG2 to the collection tube. (2.4) Add 600 μL of PWB rinse buffer (add anhydrous ethanol before use) to the adsorption column CG2, centrifuge at 12,000 rpm (~13,400 x g) for 30 sec, and discard the waste liquid. (2.5) Centrifuge at 12,000 rpm (~13,400 xg) for 2 min, discard the waste liquid, transfer the column to a 1.5 mL eppendorf tube, and let it stand at room temperature for 2 min to dry the rinse liquid in the adsorption column; (2.6) Add 100 μL of elution buffer TB to the center of the adsorption membrane (avoid touching the adsorption membrane with the pipette tip), incubate at room temperature for 2 min, and centrifuge at 12,000 rpm (~13,400 x g) for 2 min. (2.7) Secondary incubation: Pipette the eluate from the centrifuge tube into the adsorption column, incubate at room temperature for 2 min, and centrifuge at 12,000 rpm (~13,400 x g) for 2 min to obtain the final DNA. Place the column in an ice box. (2.8) Use a UV spectrophotometer to measure the concentration and purity of the extracted DNA to ensure that the quality of the DNA meets the requirements of subsequent testing. The DNA can be directly used for subsequent operations or stored at -80°C for later use.

[0045] 3. DNA Sulfidation Refer to the instructions of the ZYMO DNA Methylation-Gold™ Kit (Cat. No.: D500) and perform the following steps: (3.1) Prepare CT Conversion Reagent: Add 900 μL of pure water, 300 μL of M-Dilution buffer, and 50 μL of Dissolving Buffer to the CT Conversion Reagent tube and vortex for 10 minutes. (3.2) Transfer 130 μL of CT Conversion Reagent to a PCR tube and add 500 ng of DNA. If the total volume is less than 150 μL, fill with water. Gently flick the tube or invert it to mix the sample and centrifuge briefly. (If the DNA volume is greater than 20 μL, adjust the water ratio in the CT Conversion Reagent: for every 10 μL increase in DNA, reduce the water volume by 100 μL, to a maximum of 50 μL of DNA.) (3.3) Curing procedure: 98°C for 10 min; 64°C for 2.5 h; 4°C for up to 20 h; (3.4) Add 600 µL of M-Binding Buffer to the Zymo-Spin™ IC Column. Place the filter column in a collection tube. Transfer the mixture obtained in (2) to the Zymo-Spin™ IC Column, invert to mix, and centrifuge at full speed (>10,000 x g) for 30 seconds. Discard the filtrate. (3.5) Add 100 μL of M-Wash Buffer to the column and centrifuge at full speed for 30 seconds. (3.6) Add 200 μL of M-Desulphonation Buffer to the column, incubate at room temperature for 15-20 minutes, and centrifuge at full speed for 30 seconds. (3.7) Add 100 μL of M-Wash Buffer to the column and centrifuge at full speed for 30 seconds. Repeat once. (3.8) Remove the column and place it in a sterile 1.5 mL EP tube. Add 10 μL M-Elution Buffer to the column filter membrane. Centrifuge at full speed for 30 seconds to elute the DNA. Store at -20°C for short-term storage and -80°C for long-term storage.

[0046] 4. Methylation chip detection (4.1) Denaturation and amplification: Add 0.1 mol / L NaOH to the sample to denature the DNA into single strands. Add whole genome amplification reagent and incubate at 37°C overnight. (4.2) DNA fragmentation: Enzymatically treat the amplified product to obtain fragmented DNA. Add isopropanol and centrifuge at 4°C to precipitate the DNA. Air-dry the precipitated DNA and then add hybridization buffer to redissolve the precipitated DNA. (4.3) DNA hybridization: The resuspended DNA sample is distributed on an Illumina hybridization oven chip to complete the hybridization reaction. During the hybridization process, the fragmented DNA undergoes denaturation and anneals with the 50 bases at the specific site (attached to the microbeads on the chip); (4.4) Washing, extension, staining, and scanning: Non-specific hybridization and unhybridized DNA are washed away, and the captured DNA is used as a template to perform a single-base extension reaction on the chip. A detectable fluorescent group is added to the chip to report the methylation status of the sample; the corresponding manifest file is downloaded in advance, the chip is placed in the scanner, and the laser is used to excite the fluorescent group of the single-base extension product on the chip. The scanner obtains the fluorescence emitted by the fluorescent group and generates raw data.

[0047] 5. Data bioinformatics analysis The obtained chip raw data and sample grouping table were imported into R, and preprocessed using the ChAMP (version 2.29.1) software package in R to obtain raw data. The raw data were normalized using the BMIQ method, and subsequent methylation analysis was performed. Multiple differential methylation regions (DMRs) were screened between LTBI and HC, among which the DMR (RUFY1) showed clear differences. Figure 1 As shown, the methylation level of the target site in the LTBI group was significantly higher than that in the HC group.

[0048] The results showed that the blood biomarker cg14820908 (RUFY1) was highly methylated in LTBI patients.

[0049] The gene sequence of cg14820908 (RUFY1) is shown in SEQ ID NO. 1: TACCTACAGGAAGCCCTGCCCCAAGCTCTTAGAGGGCGTGCTGTGAAAGCGTCCCGCCCCCAAACATTCCTATTGGGCGAGTCCAGCTCAAGGCCTCTCCTACGGAGCTGGTGGGCGCCATTTTGCACCCTGTCCCGGACGGAGGAGGATGCGCACCCCGCCCAGAAGGCTTTTCCAGCCTTCTCCTTGCCGGATAGTGCCAGCCGGGTGCCTGCAGGGAAGCATTCCCCTCAGC TCCAGGCTCAAATTCTTGTTGCCGATCTTTCGTCCGCTACTAGTGGACAATTTTAGGTTTTACGCACACTTTGTTTTTTGGTAAGGAAAACCGTTGGAGTCAAATGAATTCAGAGAGTTCCATTTCAACTCCCATTATCTTGTCGCATTGCCTTGAGGGTGTAATAAAGACTGTCTGCAATTATCATCAGATATCTATACGTGCTGGCCAAATGTTCTCTGAAACCCAGTAAGCTGGTAT.

[0050] Example 2 Pyrosequencing to detect RUFY1 methylation levels Objective: To detect the methylation level of the candidate locus cg14820908 (RUFY1) using pyrosequencing in 40 patients with LTBI and 40 healthy controls, and to evaluate its diagnostic efficacy.

[0051] 1. DNA Extraction DNA was extracted using a genomic DNA extraction kit (QIAGEN).

[0052] 2. Methylation treatment Methylation was performed using the Qiagen EpiTect Bisulfite Kit (Qiagen 59104).

[0053] 3. PCR Amplification Pyrosequencing primers were designed using the software Pyro Mark Assay Design 2.0. The primer sequences are as follows: .

[0054] PCR amplification system (50 μL) .

[0055] The PCR amplification procedure is as follows: .

[0056] 4. Pyrosequencing test Q48 on the machine.

[0057] 5. Data processing.

[0058] The results are as follows Figure 2 As shown, the methylation level of cg14820908 (RUFY1) was significantly higher in the LTBI group than in the healthy control group (P < 0.05), with an area under the receiver operating characteristic (ROC) curve of 0.795 (95% CI = 0.70-0.89). Pyrosequencing achieved the highest Youden index, with a sensitivity of 0.700 and a specificity of 0.750, when the methylation level at this site was ≥25.42.

[0059] Example 3 Detection of RUFY1 methylation level by qMSP (methylation-specific quantitative PCR) Objective: To develop a reagent for detecting the methylation level of cg14820908 (RUFY1), including Taqman primers and probes for qMSP amplification and detection of the gene, to detect the methylation level of cg14820908 (RUFY1) in samples. qMSP detects the DNA methylation level of samples (ΔCT = CT 样本 -CT 参照 ), the higher the ΔCT, the lower the methylation level.

[0060] 1. Taqman Primer Design qMSP primers were designed and synthesized based on the DNA sequences of the candidate gene methylation sites. The Taqman primer sequences are as follows: .

[0061] 2. Positive and negative control design Fully methylated plasmid sequence (M, SEQ ID NO.11): GGAGGAGGATGCGTATTTCGTTTAGAAGGTTTTTTTAGTTTTTTTTTGTCGGATAGTGTTAGTCGGGTGTTTGTAGGGAAGTATTTTTTTTTTAGTTTTAGGTTTAAATTTTTGTTGTCGATTTTTCGTTCGTTATTAGTGGATAATTTTAGGTTTTACGTATAATTTTGTTTTTTGGTAAGGAAAATCGTTGGAGTTAAATGAATTTAGAGAGTTTTA.

[0062] Completely unmethylated plasmid sequence (U, SEQ ID NO.12): GGAGGAGGATGTGTATTTTGTTTAGAAGGTTTTTTTAGTTTTTTTTTGTTGGATAGTGTTAGTTGGGTGTTTGTAGGGAAGTATTTTTTTTTTAGTTTTAGGTTTAAATTTTTGTTGTTGATTTTTTGTTTGTTATTAGTGGATAATTTTAGGTTTTATGTATATTTTGTTTTTTGGTAAGGAAAATTGTTGGAGTTAAATGAATTTAGAGAGTTTTA.

[0063] 3. qMSP amplification reaction system (18 μL) ; Each qMSP reaction included a positive control (fully methylated plasmid) and a negative control (fully unmethylated plasmid).

[0064] 4. qMSP Amplification Procedure .

[0065] 5. Interpretation of results The negative control Ct>35 or no detection is qualified, and the lower the ΔCt (Cttarget-Ct reference) value, the higher the degree of methylation of the site.

[0066] .

[0067] 6. Quality Control The plasmid was quantitatively diluted to 0.1 ng / μL and then serially diluted 10-fold. Taqman probe primers were used for amplification. The amplification specificity and accuracy of the Taqman probe primers were evaluated based on the Ct value and amplification melting curve.

[0068] The results are as follows Figure 3 As shown, quantitative methylation-specific PCR testing in a validation cohort (n = 80 for LTBI and n = 80 for healthy controls) revealed significantly higher methylation levels at cg14820908 (RUFY1) in the LTBI group compared with the healthy control group (P < 0.05). The area under the receiver operating characteristic (ROC) curve was 0.850 (95% CI = 0.79-0.91). qMSP detection of this locus achieved a maximum Youden Index (ADI) of 0.838 and a specificity of 0.850 at a ΔCt of 6.31. A similar maximum Youden Index was achieved at a ADI of 6.43, with a sensitivity of 0.875 and a specificity of 0.813.

[0069] Based on a large amount of clinical sample data, the diagnostic threshold was determined to be ΔCT=6.31-6.43 to judge the status of latent tuberculosis infection: a ΔCT value lower than this range indicates latent tuberculosis infection (LTBI), and a value higher than this range indicates health.

[0070] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a gene marker methylation level or a reagent for detecting the methylation level of a gene marker in the preparation of a product for diagnosing and / or assisting in the diagnosis of latent tuberculosis infection, wherein the gene marker is RUFY1; The reagents for detecting the methylation level of the gene marker include any reagents required for detecting the methylation level of the RUFY1 gene by any one or a combination of two or more of bisulfite sequencing, PCR, methylation-specific PCR, pyrophosphate sequencing, Sanger sequencing, high-throughput sequencing, third-generation sequencing or single-molecule sequencing.

2. The use according to claim 1, characterized in that The reagent for detecting the methylation level of the gene marker is selected from the reagent required for detecting the methylation level of the RUFY1 gene by gene methylation chip technology; or, The reagent for detecting the methylation level of the gene marker is selected from the reagent required for detecting the methylation level of the RUFY1 gene by pyrosequencing technology; or The reagent for detecting the methylation level of the gene marker is selected from the reagent required for detecting the methylation level of the RUFY1 gene by quantitative methylation-specific PCR technology.

3. The use according to claim 1, characterized in that The reagent for detecting the methylation level of the RUFY1 gene is a reagent required for detecting the methylation level of the RUFY1 gene by quantitative methylation-specific PCR technology, including primers shown in SEQ ID NO.5-6 and a probe shown in SEQ ID NO.

7.

4. A primer-probe combination, which is used to detect the methylation level of the RUFY1 gene based on quantitative methylation-specific PCR technology, and consists of the primers shown in SEQ ID NO.5-6 and the probe shown in SEQ ID NO.

7.

5. A kit for detecting the methylation level of the RUFY1 gene based on quantitative methylation-specific PCR technology, the kit comprising the primer-probe combination according to claim 4.

6. The kit according to claim 5, characterized in that The kit further comprises a primer-probe combination for detecting the methylation level of a reference gene, wherein the primer-probe combination consists of primers shown in SEQ ID NOs. 8-9 and a probe shown in SEQ ID NO.

10.

7. The kit according to claim 6, characterized in that The kit also includes common reagents based on quantitative methylation-specific PCR detection, including conversion reagent, DNA polymerase, dNTPs, Mg 2+ and buffer.

8. The kit according to claim 7, characterized in that The kit also includes a positive quality control product and a negative quality control product.

9. Use of the primer-probe combination according to claim 4 or the kit according to any one of claims 5 to 8 in the preparation of a product for diagnosing and / or assisting in the diagnosis of latent tuberculosis infection.

10. The use according to claim 9, characterized in that The product is used to detect the methylation level of the RUFY1 gene, and the detection includes the following steps: 1) Sample collection; 2) DNA extraction; 3) DNA sulfidation treatment; 4) Detection based on quantitative methylation-specific PCR technology, and determine the methylation level of the RUFY1 gene in the sample DNA according to the Ct value; Step 4) also includes performing simultaneous real-time quantitative methylation-specific PCR detection on the reference gene to obtain the ΔCT value, ΔCT = CT 样本 -CT 参照 .

Images