Genetically engineered saccharomycetes capable of simultaneously producing baicalein and baicalin as well as construction method and application of genetically engineered saccharomycetes

Abstract

The invention provides genetically engineered saccharomycetes capable of simultaneously producing baicalein and baicalin as well as a construction method and application of the genetically engineered saccharomycetes. According to the invention, by weakening or deleting a glucose 5-phosphate dehydrogenase gene (ZWF1) and phenylpyruvate decarboxylase genes ARO10 and PDC5 in a saccharomyces cerevisiae genome and enhancing the expression of a pre-benzoic acid dehydratase gene Pha2, the metabolic flow of a shikimic acid pathway is increased, the aldrin pathway is blocked, and the yield of the shikimic acid pathway is increased. Therefore, the yield of L-phenylalanine serving as a starting material for synthesizing baicalein and baicalin is increased; meanwhile, exogenous genes PAL, 4CL, CHS, CHI, FNSII, F6H, CPR and F7GAT are integrated onto the genome by virtue of a gene recombination technology, so that baicalein and baicalin are produced from the beginning by taking glucose and glycerol as a mixed carbon source without adding precursor substances such as exogenous L-phenylalanine or malonyl CoA and the like.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a genetically engineered yeast capable of simultaneously producing baicalein and baicalin, and a construction method and application thereof. Background Art

[0002] Scutellaria baicalensis Georgi is a traditional Chinese medicine, used in its dried root form. Traditional Chinese medicine believes it has the effects of clearing heat and detoxifying, drying dampness and purging fire, and is used to treat ailments such as jaundice, conjunctivitis, dysentery, and eczema. Modern medical research has shown that chemical substances in Scutellaria baicalensis, such as baicalein and baicalin, can exert anti-inflammatory effects by accelerating the apoptosis of activated immune cells and regulating COX-2 protein expression. These key substances also have inhibitory effects on various pathogenic bacteria, fungi, and viruses. Furthermore, it exhibits certain anti-tumor, antioxidant, and lipid- and blood-sugar-lowering properties.

[0003] Analysis of the main chemical components of Scutellaria baicalensis revealed that its primary components are flavonoids. Baicalin is the most abundant and exhibits a wide range of biological activities, followed by baicalein and other substances. Therefore, the preparation of high-purity baicalin and baicalein is crucial for the development and utilization of pharmaceutical preparations.

[0004] Currently, the mainstream method for preparing baicalein and baicalin is to extract natural Scutellaria baicalensis or natural plants containing these components, such as Erigeron breviscapus and Scutellaria barbata. This method faces the challenges of slow plant growth and non-renewable medicinal resources. Furthermore, the complex composition of plant extracts leads to cumbersome subsequent separation processes, increasing industrial costs. Although chemical methods have enabled the synthesis of baicalein and baicalin, the raw materials involve toxic substances such as oxidized phenols, which limits their application in pharmaceuticals and food.

[0005] Recent advances in synthetic biology have provided new approaches for the preparation of baicalein and baicalin. By transferring the relevant synthetic genes into a base cell, such as Escherichia coli or yeast, and constructing recombinant strains, heterologous synthesis of the target substances is possible. Escherichia coli is a commonly used base cell for prokaryotic systems, but some studies have shown that plant-derived proteins for flavonoid synthesis exhibit poor expression levels in this base cell and often fail to fold effectively into functional proteins. Furthermore, its endotoxin content limits its application in food and pharmaceutical production. Yeast, the most commonly used base cell for eukaryotic systems, offers advantages such as ease of genetic manipulation, suitability for plant protein expression, and good protein secretion, making it a suitable candidate for the biosynthesis of baicalein and baicalin. Several studies have reported the production of a series of flavonoid derivatives from the genus Scutellariae, including baicalein, wogonin, and scutellarin, using recombinant yeast. However, the low natural production of their synthetic precursor, L-phenylalanine, limits the ultimate yield of baicalein and baicalin. If L-phenylalanine is added during the fermentation process, the overall cost will increase.

[0006] Therefore, there is an urgent need in this field to develop a new recombinant yeast and a corresponding production process using common carbon sources, such as glucose and glycerol, as starting materials to achieve high yields of baicalein and baicalin while reducing overall costs. Summary of the Invention

[0007] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide an engineered yeast of Saccharomyces cerevisiae that can efficiently produce baicalein and / or baicalin, so as to solve the problems in the prior art.

[0008] To achieve the above objectives and other related objectives, the present invention is achieved through the following technical solutions.

[0009] In a first aspect of the present invention, a Saccharomyces cerevisiae engineered bacterium for producing baicalein and / or baicalin is provided. The Saccharomyces cerevisiae engineered bacterium is based on Saccharomyces cerevisiae as a starting strain and is genetically modified to introduce exogenous genes. The exogenous genes include PAL, 4CL, CHS, CHI, FNSII, F6H, CPR and F7GAT.

[0010] In some embodiments of the present invention, the genetic modification further comprises knocking out or silencing the endogenous gene A of the Saccharomyces cerevisiae and overexpressing the endogenous gene B of the Saccharomyces cerevisiae, wherein the endogenous gene A comprises ZWF1, ARO10 and PDC5 genes, and the endogenous gene B is PHA2.

[0011] In some embodiments of the present invention, the CHS, CHI, FNSII and / or F6H are derived from Scutellaria baicalensis Georgi (Sb).

[0012] In some embodiments of the present invention, the GeneBank accession number of the CHS is EF512579.1; the GeneBank accession number of the CHI is KP064512.1; the GeneBank accession number of the FNSII is KT963453.1; and the GeneBank accession number of the F6H is JX127156.1.

[0013] In some embodiments of the invention, the F7GAT is from Erigeron breviscapus (Vaniot) Hand.-Mazz.

[0014] In some embodiments of the present invention, the GeneBank accession number of the F7GAT is KU237242.1.

[0015] In some embodiments of the present invention, the PAL is derived from Aspergillus udagawae (Ag); in some preferred embodiments of the present invention, the GeneBank accession number of the PAL is BLKC01000110.1.

[0016] In some embodiments of the present invention, the 4CL is derived from Arabidopsis thaliana (At); in some preferred embodiments of the present invention, the GeneBank accession number of the 4CL is AY250837.1.

[0017] In some embodiments of the present invention, the CPR is from Stevia rebaudiana (Sr); in some preferred embodiments of the present invention, the CPR (GeneBank accession number is DQ269454.4).

[0018] In some embodiments of the present invention, the 5' end of each of the endogenous gene and the exogenous gene is connected to a promoter, and the 3' end is connected to a terminator.

[0019] The second aspect of the present invention provides a method for constructing the above-mentioned engineered yeast Saccharomyces cerevisiae, the method comprising the following steps:

[0020] Saccharomyces cerevisiae is used as a starting strain, and exogenous genes including PAL, 4CL, CHS, CHI, FNSII, F6H, CPR and F7GAT are introduced to obtain an engineered Saccharomyces cerevisiae strain.

[0021] In some preferred embodiments of the present invention, the construction method further comprises the steps of knocking out or silencing the endogenous gene A and overexpressing the endogenous gene B.

[0022] In the construction method of the present invention, the present invention does not specifically limit the order of operations for introducing exogenous genes, knocking out or silencing endogenous gene A, and overexpressing endogenous gene B, and those skilled in the art can make adaptive adjustments according to actual conditions; in the present invention, the engineered bacteria are constructed in the order of first knocking out or silencing endogenous gene A, overexpressing endogenous gene B, and then introducing exogenous genes.

[0023] In some embodiments of the present invention, the introduction of exogenous genes is achieved through the CRISPR / Cas method.

[0024] In some embodiments of the present invention, the introduction of the exogenous gene specifically includes: introducing a Cas protein, an expression cassette containing the exogenous gene, and / or an sgRNA recombinant vector targeting the exogenous gene insertion site into the starting strain.

[0025] In some embodiments of the invention, the expression cassette comprises PAL, 4CL, CHS, CHI, FNSII, F6H, CPR and / or F7GAT gene segments.

[0026] In some embodiments of the present invention, the 5' end of each gene in the exogenous gene is connected to a promoter, and the 3' end is connected to a terminator, respectively constituting an expression module. The expression modules of different genes are combined into an expression cassette; and then the expression cassette is inserted into the Saccharomyces cerevisiae genome.

[0027] For example: PAL, 4CL, CHS and CHI expression modules constitute expression cassette 1, which is inserted into site 1 of chromosome X; FNSII and F6H expression modules constitute expression cassette 2, which is inserted into site 1 of chromosome XI; F7GAT and CPR constitute expression cassette 3, which is inserted into site 2 of chromosome XI.

[0028] In some embodiments of the present invention, the sequence of the sgRNA targeting site 1 of chromosome X is shown as SEQ ID NO. 10;

[0029] In some embodiments of the present invention, the sequence of the sgRNA targeting chromosome XI site 1 is shown as SEQ ID NO. 11;

[0030] In some embodiments of the present invention, the sequence of the sgRNA targeting chromosome XI site 2 is shown as SEQ ID NO.12.

[0031] In some embodiments of the present invention, the nucleotide sequence of the expression cassette 1 is shown as SEQ ID NO.7.

[0032] In some embodiments of the present invention, the nucleotide sequence of the expression cassette 2 is shown as SEQ ID NO.8.

[0033] In some embodiments of the present invention, the nucleotide sequence of the expression cassette 3 is shown as SEQ ID NO.9.

[0034] In some embodiments of the present invention, the method for knocking out endogenous genes includes homologous recombination technology, zinc finger nuclease technology, and CRISPR / Cas system.

[0035] In some embodiments of the present invention, the silencing method is RNA interference or antisense oligonucleotide technology.

[0036] In some preferred embodiments of the present invention, the knockout, silencing and / or overexpression of the endogenous gene is achieved by CRISPR / Cas method.

[0037] In some embodiments of the present invention, the specific knockout, silencing and / or overexpression methods include: introducing Cas protein, sgRNA recombinant vector and / or donor sequence targeting ZWF1, ARO10 and PDC5 into the starting strain.

[0038] In some embodiments of the present invention, the Donor sequence further includes an endogenous gene B sequence. In the present invention, the Donor sequence targeting ARO10 and PDC5 preferably includes an endogenous gene B sequence, but is not limited thereto.

[0039] In some embodiments of the present invention, the donor sequence targeting ZWF1 is shown as SEQ ID NO.4; and / or, the donor sequence targeting ARO10 is shown as SEQ ID NO.5; and / or, the donor sequence targeting PDC5 is shown as SEQ ID NO.6.

[0040] In some embodiments of the present invention, the sgRNA sequence targeting ZWF1 is shown as SEQ ID NO.1; and / or, the sgRNA sequence targeting ARO10 is shown as SEQ ID NO.2; and / or, the sgRNA sequence targeting PDC5 is shown as SEQ ID NO.3.

[0041] The third aspect of the present invention provides a method for producing baicalein and / or baicalin, comprising culturing the engineered yeast Saccharomyces cerevisiae as described above to ferment and produce baicalein and / or baicalin.

[0042] In some embodiments of the present invention, the fermentation medium of the engineered Saccharomyces cerevisiae bacteria includes a carbon source.

[0043] In some embodiments of the present invention, the carbon source includes glucose and glycerol.

[0044] In some embodiments of the present invention, the initial fermentation medium includes 10-30 g / L glucose, 10-30 g / L glycerol, 50-100 g / L ammonium sulfate, 15-20 g / L potassium dihydrogen phosphate, and 150-250 mL / L metal ion mother liquor.

[0045] In some embodiments of the present invention, the metal ion mother solution includes: 2-6 g / L FeSO4·7H2O, 3-6 g / L ZnSO4·7H2O, 3-6 g / L CaCl2, 1-3 g / L MnCl2·4H2O, and 0.1-0.5 g / L CuSO4·5H2O.

[0046] In some embodiments of the present invention, during the fermentation process, glycerol with a final concentration of 1-5% (v / v) is added when glucose is consumed to 6 g / L, and then glycerol with a final concentration of 1-5% (v / v) is supplemented every 6-8 hours.

[0047] In some embodiments of the present invention, the pH value during fermentation is 6 to 6.8.

[0048] In some embodiments of the present invention, the fermentation time is 48 to 60 hours.

[0049] In some embodiments of the present invention, the fermentation temperature is 28-35°C.

[0050] In some embodiments of the present invention, the step of activating the engineered Saccharomyces cerevisiae bacteria is further included before fermentation, and the activation conditions are: culturing at 28-35° C. and 100-400 r / min for 10-15 hours.

[0051] In some embodiments of the present invention, the activated engineered Saccharomyces cerevisiae bacteria are inoculated into a fermentation medium for fermentation.

[0052] Beneficial effects:

[0053] The present invention constructs a yeast strain capable of simultaneously producing baicalein and baicalin by genetic engineering methods. The original strain is Saccharomyces cerevisiae S288C. The present invention first discovers that by integrating exogenous genes PAL, 4CL, CHS, CHI, FNSII, F6H, CPR and F7GAT into its genome through gene recombination technology, baicalein and baicalin can be produced de novo using glucose and glycerol as a mixed carbon source without adding exogenous precursors such as L-phenylalanine or malonyl-CoA. The yields of baicalein and baicalin can reach 36.7 mg / L and 15.1 mg / L, respectively, after 48 hours of fermentation.

[0054] On this basis, the present invention further weakens or deletes the 5-phosphate glucose dehydrogenase gene (ZWF1) and the phenylpyruvate decarboxylase genes ARO10 and PDC5 in the Saccharomyces cerevisiae s288c genome, and simultaneously strengthens the expression of the prephenate dehydratase gene PHA2 to increase the metabolic flux of the shikimate pathway and block the Ehrlich pathway, thereby increasing the yield of L-phenylalanine, the starting material for the synthesis of baicalein and baicalin; and further improves the yield of baicalein and baicalin to 40.2 mg / L and 17.4 mg / L, respectively. In addition, the fermentation cycle is short and the cost is low, and the invention has great potential in the production and application of baicalein and baicalin. DETAILED DESCRIPTION

[0055] The following describes the implementation of the present invention through specific embodiments. People skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0056] Before further describing the specific embodiments of the present invention, it should be understood that the scope of the present invention is not limited to the specific embodiments described below. It should also be understood that the terminology used in the examples is intended to describe specific embodiments and is not intended to limit the scope of the present invention. The experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions or according to the conditions recommended by the respective manufacturers.

[0057] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0058] This study constructed a yeast strain that simultaneously produces baicalein and baicalin through genetic engineering. The original strain, Saccharomyces cerevisiae S288C, was modified by weakening or deleting enzymes in key metabolic pathways to increase production of the precursor L-phenylalanine. Furthermore, a series of exogenous genes were integrated into the yeast genome through genetic recombination techniques. Ultimately, the yeast achieves de novo production of baicalein and baicalin using a mixed carbon source of glucose and glycerol, without the addition of exogenous precursors such as L-phenylalanine or malonyl-CoA.

[0059] The strains or genes described are briefly described as follows:

[0060] 1. Genetically engineered strains for high L-phenylalanine production

[0061] In an embodiment, the protein encoded by the 5-phosphate glucose dehydrogenase gene (ZWF1) in the original Saccharomyces cerevisiae S288C genome catalyzes the flow of glucose 6-phosphate, a product of the glycolytic pathway, to the pentose phosphate pathway, thereby reducing the metabolic flux of the shikimate pathway, a precursor for the synthesis of baicalein and baicalin, and the synthesis of L-phenylalanine. By weakening or deleting the enzyme directly on the original strain genome through CRISPR technology, the carbon flow of the L-phenylalanine synthesis branch can be effectively increased, thereby increasing its yield. The end product of the shikimate pathway, chorismate, is further converted into prephenate and synthesized into phenylpyruvate, a direct precursor of L-phenylalanine, through the prephenate dehydratase gene (Pha2). Therefore, enhancing the expression of this gene is conducive to increasing the yield of L-phenylalanine. At the same time, since phenylpyruvate is converted into phenylacetaldehyde through the Ehrlich pathway, it competes with L-phenylalanine synthesis. Therefore, weakening or deleting the phenylpyruvate decarboxylase genes ARO10 and PDC5 by CRISPR technology can also increase the yield of L-phenylalanine.

[0062] 2. Polynucleotides encoding CHS, CHI, FNSII, F6H, and F7GAT in the present invention

[0063] In the embodiment, the exogenous gene expression cassettes including CHS, CHI, FNSII, F6H and F7GAT are integrated into the genome of the engineered yeast Saccharomyces cerevisiae. They are all derived from Scutellaria baicalensis. The nucleotide fragments encoding each gene are directly obtained by gene synthesis. The proteins encoded by them are: chalcone synthase (CHS), chalcone isomerase (CHI), flavonoid synthase (FNSII), flavonoid 6-hydroxylase (F6H) and flavonoid 7-O-glucuronyl transferase (F7GAT), which catalyze the synthesis pathway from cinnamoyl-CoA to baicalein and baicalin. Each gene fragment is fused with the Saccharomyces cerevisiae promoter GAP and ADH1 terminator, and then integrated into the Saccharomyces cerevisiae genome of high-yield L-phenylalanine by CRISPR operation plasmid homologous recombination.

[0064] 3. Polynucleotides encoding PAL in the present invention

[0065] In the examples, the PAL exogenous gene expression cassettes incorporated into the genome of engineered Saccharomyces cerevisiae were derived from Aspergillus. Nucleotide fragments encoding each gene were directly obtained through gene synthesis. The protein encoded by each fragment is phenylalanine ammonia lyase, which catalyzes the synthesis of cinnamic acid from L-phenylalanine. Each gene fragment was fused to the Saccharomyces cerevisiae promoter GAP and ADH1 terminator, and then integrated into the genome of the high-L-phenylalanine-producing Saccharomyces cerevisiae via CRISPR-mediated plasmid homologous recombination.

[0066] 4. Polynucleotides encoding 4-CL in the present invention

[0067] In the examples, the 4-CL exogenous gene expression cassette integrated into the genome of an engineered yeast strain of Saccharomyces cerevisiae was derived from Arabidopsis thaliana. Nucleotide fragments encoding each gene were directly obtained by gene synthesis. The protein encoded by each fragment is p-coumaroyl-CoA ligase, which converts cinnamic acid to cinnamoyl-CoA. Each gene fragment was fused to the Saccharomyces cerevisiae promoter GAP and ADH1 terminator, and then integrated into the genome of the high-L-phenylalanine-producing Saccharomyces cerevisiae strain through CRISPR-mediated plasmid homologous recombination.

[0068] 5. Polynucleotides encoding CPRs in the present invention

[0069] In the examples, the CPR exogenous gene expression cassettes integrated into the genome of engineered Saccharomyces cerevisiae were derived from Stevia rebaudiana. Nucleotide fragments encoding each gene were directly obtained through gene synthesis. The protein encoded by each gene is cytochrome P450 reductase. Each gene fragment was fused to the Saccharomyces cerevisiae promoter GAP and ADH1 terminator to form a gene. The gene was then integrated into the genome of the high-L-phenylalanine-producing Saccharomyces cerevisiae strain via homologous recombination using a CRISPR-activated plasmid.

[0070] 6. Fermentation production method of baicalein and baicalin

[0071] The present invention provides a preferred method for producing baicalein and baicalin by fermentation. The recombinant bacteria are cultured in a liquid YPD culture at 30°C and 200 rpm for 12 hours and then transferred to a 5L fermentor at a final concentration of 10%. The initial liquid volume of the fermentation medium is 2.4L, the initial temperature is 30°C, and the ventilation volume is 1.5 vvm. When the glucose consumption reaches 6g / L at the beginning of the fermentation, 1-5% (v / v) final concentration of glycerol is added, and then added every 6-8 hours. During the fermentation stage, the pH is controlled between 6.0 and 6.8 by adding 28 (v / v) of ammonia water. The final fermentation time is 48-60 hours.

[0072] The fermentation medium components include: 20 g / L glucose, 20 g / L glycerol, 75 g / L ammonium sulfate, 17.5 g / L potassium dihydrogen phosphate, and 200 mL / L metal ion mother liquor.

[0073] The metal ion mother solution comprises: 4.0 g / L of FeSO4·7H2O, 4.5 g / L of ZnSO4·7H2O, 4.5 g / L of CaCl2, 2.0 g / L of MnCl2·4H2O, and 0.3 g / L of CuSO4·5H2O.

[0074] The contents of baicalein and baicalin in the fermentation broth can be analyzed and identified by high performance liquid chromatography to determine the content of the target product.

[0075] Example 1: Construction of a genetically engineered yeast strain that produces high levels of L-phenylalanine

[0076] 1. Construction of CRISPR gene knockout tools

[0077] First, a Cas9 nuclease expression plasmid was constructed. Using the plasmid Cas9-NAT as a template and NAT-F / NAT-R as primers, a fragment encoding the nourseothricin resistance gene was amplified. This fragment was then digested with SnaBI and MfeI and inserted into the plasmid p414-TEF1p-Cas9-CYC1t, replacing the TRP1 gene. This resulted in the Cas9 expression plasmid p414-Cas9-NAT.

[0078] The relevant primer sequences are shown in Table 1;

[0079] Table 1

[0080]

[0081]

[0082]

[0083] Subsequently, sgRNA expression plasmids were constructed for targeted knockout of the genes zwf1, PDC5, and ARO10. An sgRNA expression cassette containing the SNR52 promoter and SUP4 terminator was synthesized and inserted into the plasmid pRS42H using KpnI and SacI double digestion, resulting in the basic sgRNA expression plasmid pRS42H-sgRNA. N20 targeting sequences corresponding to the three knockout genes were then designed using the chop-chop online website. Rolling circle replication was performed using the pRS42H-sgRNA plasmid as a template using primers zwf1-F / R, PDC5-F / R, and ARO10-F / R, respectively, to generate the targeted knockout plasmids pRS42H-sgRNA-zwf1, pRS42H-sgRNA-PDC5, and pRS42H-sgRNA-ARO10. The key sequences for specific knockout of target genes, sgRNA-zwf1, sgRNA-PDC5, and sgRNA-ARO10, are as follows:

[0084] sgRNA_Zwf

[0085] GGTACCagacataaaaaacaaaaaaagcaccaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaacCCCCGTCAAATTCGAAAAAAATAgatcatttatctttcactgcggagaagtttcgaacgccgaaacatgcgcaccaactttcacttctacagcgtttgaccaaaatcttttgaacagaacattgtagggtgtgaaaaaatgcgcacctttaccgctagcccaagagggcactacaaaatctagagttgtacttcaaacgtacatgtaatcaccttgtatatactcgaaagaaaacatcaagtttctgtataaatatgagtgaaagcataatcatacattatcttttcaaagaGAGCTC(SEQ ID NO.1);

[0086] sgRNA_PDC5

[0087] GGTACCagacataaaaaacaaaaaaagcaccaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaacCCTTGTCTTGAGTCAACTTTTCCgatcatttatctttcactgcggagaagtttcgaacgccgaaacatgcgcaccaactttcacttctacagcgtttgaccaaaatcttttgaacagaacattgtagggtgtgaaaaaatgcgcacctttaccgctagcccaagagggcactacaaaatctagagttgtacttcaaacgtacatgtaatcaccttgtatatactcgaaagaaaacatcaagtttctgtataaatatgagtgaaagcataatcatacattatcttttcaaagaGAGCTC(SEQ ID NO.2);

[0088] sgRNA_ARO10

[0089] GGTACCagacataaaaaacaaaaaaagcaccaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctcta aaacCCGCATTGTTTCGTTCGTATATTgatcatttatctttcactgcggagaagtttcgaacgccgaaacatgcgcaccaactttcacttctacagcgtttg accaaaatcttttgaacagaacattgtagggtgtgaaaaaatgcgcacctttaccgctagcccaagagggcactacaaaatctagagttgtacttcaaacgt acatgtaatcaccttgtatatactcgaaagaaaacatcaagtttctgtataaatatgagtgaaagcataatcatacattatcttttcaaagaGAGCTC(SEQ ID NO.3).

[0090] Finally, a donor DNA fragment was constructed for knockout gene integration. The Zwf1 donor DNA was constructed as follows: The donor DNA consisted of 500 bp upstream and downstream of the target gene in the Saccharomyces cerevisiae genome. The upstream and downstream fragments of the target gene were amplified from the Saccharomyces cerevisiae S288C genome using the corresponding primers Donor_zwf1_up-F / R and Donor_zwf1_dn-F / R, respectively. Subsequently, the zwf1 donor DNA fragment was obtained by overlap-PCR using the corresponding Donor_zwf1_up-F / Donor_zwf1_dn-R primers.

[0091] The ARO10 / PDC5 donor DNA was constructed as follows: the Pha2 gene was inserted into the ARO10 / PDC5 knockout locus to simultaneously knock out ARO10 / PDC5 and enhance Pha2 expression. First, the Saccharomyces cerevisiae S288C genome was amplified using primers labeled "donor_ARO10 / PDC5_up-F / R" to obtain the upstream fragment corresponding to the knockout target gene. Next, the Saccharomyces cerevisiae S288C genome was amplified using primers labeled "donor_ARO10 / PDC5-Pha2-F / R" to obtain the Pha2 gene with ARO10 / PDC5 homology arms. Finally, the Saccharomyces cerevisiae S288C genome was amplified using primers labeled "donor_ARO10 / PDC5_dn-F / R" to obtain the downstream fragment corresponding to the knockout target gene. The three fragments were then ligated by overlap-PCR using primers labeled "Donor_up-F / Donor_dn-R" to generate the ARO10 / PDC5 donor DNA fragment.

[0092] The three donor gene fragments are as follows:

[0093] donorDNA_zwf1

[0094]

[0095] donorDNA_PDC5

[0096]

[0097] donorDNA_ARO10

[0098]

[0099] 2. Transformation of knockout plasmid to construct target gene-engineered yeast

[0100] Taking the knockout of the zwf1 gene as an example, the plasmid p414-Cas9-NAT was transformed into Saccharomyces cerevisiae S288C competent cells using the PEG-lithium acetate method, plated on YPD plates containing 100 μg / mL nourseoin resistance, and incubated at 30°C for 2 days. Positive transformants were selected to prepare competent cells. Subsequently, 100 ng of the knockout plasmid pRS42H-sgRNA-zwf1 and 200 ng of the donor DNA fragment donorDNA-zwf1 were simultaneously transformed into Saccharomyces cerevisiae competent cells containing the Cas9 expression plasmid using the PEG-lithium acetate method. The cells were plated on YPD plates containing 80 μg / mL nourseoin resistance and 200 μg / mL hygromycin B resistance, and incubated at 30°C for 2 days. Positive transformants were picked separately and colony PCR was performed using Donor_zwf1_up-F / Donor_zwf1_dn-R as primers. If the corresponding amplified band was 1000 bp, it indicated that the knockout was successful. If the band size was larger than 1500 bp, it indicated that the knockout was unsuccessful.

[0101] Yeast transformants with successful knockout were picked and replicated on YPD plates without resistance and YPD plates containing 80 μg / mL nourseoin resistance and 200 μg / mL hygromycin B resistance, respectively. Each round was cultured at 30°C for 2 days until colonies grew on the non-resistance plate but not on the corresponding resistance plate, indicating that the Cas9 and sgRNA expression plasmids were lost, thus completing one round of gene knockout.

[0102] The steps for knocking out the PDC5 and ARO10 genes are the same as for knocking out zwf1, with only the primers used being different. Repeat the above sequence to knock out the PDC5 and ARO10 genes in sequence to obtain the final genetically engineered yeast.

[0103] 3. Verification of the effect of genetically engineered yeast

[0104] Non-knockout yeast (WT), yeast with only the zwf1 gene knocked out (Δzwf1), yeast with the PDC5 and ARO10 genes knocked out (ΔPDC5 / ARO10), yeast with the zwf1, PDC5 and ARO10 genes knocked out (Δzwf1 / PDC5 / ARO10), yeast with the PDC5 and ARO10 knocked out and then overexpressed Pha2 (ΔPDC5 / ARO10::Pha2), and yeast with the zwf1, PDC5 and ARO10 knocked out and then overexpressed Pha2 (Δzwf1 / PDC5 / ARO10::Pha2) were inoculated into 5 mL of YPD medium, cultured at 30°C, 200 rpm for 1 day, and then inoculated into shake flasks containing 1 L of fermentation medium at a ratio of 1% (v / v). Fermentation was carried out at 30°C and 200 rpm. 2 mL of fermentation broth was taken at 8 h and 16 h, respectively, and the phenylalanine content was detected by high performance liquid chromatography to verify the effect of the genetically engineered yeast.

[0105] The fermentation medium formula is as follows: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and 17.5 g / L potassium dihydrogen phosphate.

[0106] The results of phenylalanine test in fermentation broth are as follows:

[0107] Table 2

[0108] sample Phenylalanine content (mg / L) WT-8h 1.4 Δzwf1-8h 2.12 ΔPDC5 / ARO10-8h 6.1 Δzwf1 / PDC5 / ARO10-8h 18.54 ΔPDC5 / ARO10::Pha2-8h 11.2 Δzwf1 / PDC5 / ARO10::Pha2-8h 21.51 WT-16h 3.45 Δzwf1-16h 8.92 ΔPDC5 / ARO10-16h 12.8 Δzwf1 / PDC5 / ARO10-16h 43.21 ΔPDC5 / ARO10::Pha2-16h 25.28 Δzwf1 / PDC5 / ARO10::Pha2-16h 48.4

[0109] The results showed that compared to the original strain, yeast strains with only the zwf1 gene knocked out showed a slight improvement in phenylalanine accumulation during fermentation, but it was not significant. The strain with only the ΔPDC5 / ARO10 gene knocked out still did not significantly increase phenylalanine production. However, the engineered yeast strains with all three genes knocked out showed a significant increase in phenylalanine production. Further overexpression of the Pha2 gene and simultaneous knockout of all three genes produced the highest phenylalanine production of all engineered strains, demonstrating that the deletion of one of the three genes alone, or the overexpression of Pha2 alone, could not effectively increase L-phenylalanine production. Furthermore, this genetic modification was shown to increase the accumulation of phenylalanine, a precursor substance for baicalein synthesis, which is beneficial for increasing the subsequent production of baicalein and baicalin.

[0110] Example 2: Construction of a genetically engineered yeast strain that produces high yields of baicalein and baicalin

[0111] 1. Construction of exogenous gene expression cassette

[0112] The genes related to baicalein and baicalin synthesis include CHS (GeneBank accession number EF512579.1), CHI (GeneBank accession number KP064512.1), FNSII (GeneBank accession number KT963453.1), and F6H (GeneBank accession number JX127156.1) from Scutellaria baicalensis Georgi (Sb); PAL (GeneBank accession number BLKC01000110.1) from Aspergillus udagawae (Ag); and FLS (GeneBank accession number BLKC01000110.1) from Arabidopsis thaliana. thaliana; At) 4CL (GeneBank accession number AY250837.1); CPR (GeneBank accession number DQ269454.4) from Stevia rebaudiana (Steviarebaudiana, Sr); and F7GAT (GeneBank accession number KU237242.1) genes from Erigeron breviscapus were synthesized by Jin Weizhi. A GAP promoter was added to the 5' end of each gene fragment and an ADH1 terminator was added to the 3' end to obtain eight gene expression modules.

[0113] Subsequently, expression cassettes were constructed for integration into the Saccharomyces cerevisiae genome. The eight gene expression modules were divided into three groups and integrated into three different sites on the Saccharomyces cerevisiae genome. Cassette 1, consisting of PAL, 4CL, CHS, and CHI, was inserted into chromosome X, locus 1; cassette 2, consisting of FNSII and F6H, was inserted into chromosome XI, locus 1; and cassette 3, consisting of F7GAT and CPR, was inserted into chromosome XI, locus 2.

[0114] The expression cassette cassette 1 was constructed as follows: first, the Saccharomyces cerevisiae S288C genome was amplified using primers X_1-up-F / R and X_1-dn-F / R to obtain the upstream and downstream homologous arms X_1-up and X_1-dn of the insertion site, respectively. Then, the synthetic PAL gene (both containing the GAP promoter and the ADH1 terminator) was amplified using primers X_1-up_GAP-F / GAP_ADH-R; the synthetic CHI gene was amplified using primers ADH_GAP-F / X_1-ADH_dn-R, and then the synthetic 4CL and CHS genes were amplified using primers ADH_GAP-F / GAP_ADH-R, respectively, and the gene fragments were purified by gel recovery. Then, using X_1-up-F / X_1-dn-R as primers and the homologous arms X_1-up and X_1-dn and PAL, 4CL, CHS and CHI genes purified in the previous step as templates, all fragments were connected into a complete gene expression cassette through overlap-PCR (X_1-OL-F / R), and the gene fragments were purified by gel recovery to complete the construction of expression cassette cassette 1.

[0115] The Cassette2 expression cassette was constructed as follows: First, the Saccharomyces cerevisiae S288C genome was amplified using primers XI_1-up-F / R and XI_1-dn-F / R to obtain the upstream and downstream homology arms XI_1-up and XI_1-dn, respectively. Subsequently, a synthetic FSII gene (containing the GAP promoter and ADH1 terminator) was used as a template to amplify the FSII gene fragment suitable for constructing Cassette2 using primers XI_1-up_GAP-F / GAP_ADH-R. Subsequently, a synthetic F6H gene (containing the GAP promoter and ADH1 terminator) was used as a template to amplify the F6H gene fragment suitable for constructing Cassette2 using primers ADH_GAP-F / XI_1-ADH_dn-R. After the above gene fragments were purified by gel recovery, XI_1-up-F / XI_1-dn-R were used as primers, and the homologous arms XI_1-up and XI_1-dn and FSII and F6H genes purified in the previous step were used as templates. All fragments were connected into a complete gene expression cassette by overlap-PCR (XI_1-OL-F / R), and the gene fragments were purified by gel recovery to complete the construction of expression cassette cassette 2.

[0116] The expression cassette Cassette3 was constructed as follows: first, the Saccharomyces cerevisiae S288C genome was amplified using primers XI_2-up-F / R and XI_2-dn-F / R to obtain the upstream and downstream homology arms XI_2-up and XI_2-dn of the insertion site, respectively. Then, the F7GAT gene fragment suitable for constructing Cassette3 was amplified using primers XI_2-up_GAP-F / GAP_ADH-R and the synthetic F7GAT gene (including the GAP promoter and the ADH1 terminator) as a template; then, the CPR gene fragment suitable for constructing Cassette3 was amplified using primers ADH_GAP-F / XI_2-ADH_dn-R and the synthetic CPR gene (including the GAP promoter and the ADH1 terminator) as a template. After the above gene fragments were purified by gel recovery, XI_2-up-F / XI_2-dn-R were used as primers, and the homologous arms XI_2-up and XI_2-dn purified in the previous step and the F7GAT and CPR genes were used as templates. All the fragments were connected into a complete gene expression cassette by overlap-PCR (XI_2-OL-F / R), and the gene fragments were purified by gel recovery to complete the construction of the expression cassette cassette 3.

[0117] cassette1:

[0118] GAGGATTCTTTGCAGCCGgcatcacaacgtcactaatggctcctactatccttattgtcggtgcaactggcaacacaggccgaag

[0119] tgttaccgaaactttgccaacattgctaaagtcttctaacactctgtcggatcaccgaatcatcggtctcacccgttctctgaacagtccagcagcac

[0120] aacagcttgctaaactgcctggtgttgaggtggtcgagcagaactgggtcgaaatcaccgctgactggctccgggaacacgaggtagtcagag

[0121] cttttattgcgtcacataacgaaccgaatcaattcgccgaagaatcagcattccaccttgccgccctcaaagctggcgtcaaatatgttgtgcgaat

[0122] ctcgaccactgctgcgaatgttcgcccggattgtgatgcgtactatccacgcacgcattgggcaatcgaggctctcctgagctcgccagaattca

[0123] acggcttgcagtggacttcactccagcccaatgtcttttcgccactgtatctctcttctgccgcagaattcatcaaacaataccgcaagactggaaat

[0124] caggagactcttaggttgatggcgtcaaaagatgctcctgtcggcatcattgaccctgatgaagttggagtccttgcagcccacctcttggctcag

[0125] gacgatcctgctgttcacaacaaagccaaatacgtcctgaatgggccagaggacatcaccgggagccagattgtcgacatgattgagcagcgg

[0126] attggtacgaaagtcaaggatgtgagctacaaagacatgtcgttcattgatacgatttatgagcacaagttcgcggcaactcagcaatcaaagaa

[0127] cattatattgtctatcaaacacgctccggagacggcgtgggaaggaaagtgcacagcttccacaaccagcaaggaagtattggagcttgctgca

[0128] ccaaaacgtacacctgctgaagtgttgagggccttattggaggagtagggaatagtgacgttgtgatgcgcatcacaacgtcactaatggtgctc

[0129] caacaacaaacgcattttctcacaaagaagatagatcaagaagacgaagaagaagaaccttctcatgatttcattttccgatctaagcttcctgatat

[0130] cttcatccctaaccacctccctctcaccgattacgtcttccaaaggttctccggcgatggcgacggagattcctcaacaacctgtatcatcgacggt

[0131] gccactggccgtattttgacctacgccgatgtgcaaatcaacatgcggaggatagctaccggaatccaccggctcgggatccgccacggtgac

[0132] gtcgtaatgcttctcctcccgaactcgccggagtttgctctgtcttttctagccgttgcataccttggagccgtttccactaccgcgaatccgttctac

[0133] actcagccggagatcgctaaacaggctaaagcctccgccgcgaagatgatcatcacgaagaaatgtttagtcgataaactaacaaacctcaaaa

[0134] acgacggcgttttgatcgtttgcctagacgatgacggtgacaacggcgttgtttcgtcgagtgatgatggttgcgtgagtttcacggaactgactc

[0135] aagcggacgaaacagaacttctaaaacctaaaatatcgccggaagacacggtggcgatgccgtactcttccggaacaacgggacttccaaag

[0136] ggagtgatgattactcacaagggtttagttacaagcatcgctcagaaagtcgacggagaaaaccctaacctcaacttcacggccaatgacgtcat

[0137] cctctgttttctcccaatgtttcacatttacgctctcgacgcgttgatgctttcggcgatgagaaccggtgcagcgttactgatcgtgccgaggttcg

[0138] agttaaatctggtgatggagctgattcaaaggtacaaagtcacggttgttccggtggctcctccggtggttttagcattcattaaatcccctgagacg

[0139] gagagatacgacttgagctcggtgagaattatgctatcaggtgcagctacactaaagaaggagcttgaagacgccgtgcgactcaagtttcctaa

[0140] tgccatttttggtcagggttatggaatgaccgagtccggaacggtagctaagtcattagcgtttgcaaagaacccatttaaaaccaagtccggtgc

[0141] atgtgggactgtgatcagaaacgccgagatgaaagtggtcgataccgaaaccggaatctccttgccgcgcaacaaatctggcgagatctgcgt

[0142] ccgaggtcatcagctcatgaaaggttatttgaatgatccggaagctactgcacgaaccatagacaaagacgggtggttacatacaggagatattg

[0143] ggtttgtggatgatgatgatgagatcttcattgttgatcggttgaaggaactgatcaaattcaaaggctaccaagtggctccagctgagcttgaagc

[0144] attgcttatttctcatccttctatcgatgatgccgcagttgttgcaatgaaggatgaagtagctgatgaggttccagtagcatttgtagcaagatctca

[0145] agggtctcagttaactgaagatgatgtcaagagttacgtaaacaaacaggtggttcactacaagcggattaagatggtgtttttcatagaagttata

[0146] ccaaaagcagtttcgggcaagattctgaggaaggatctgcgagctaaattggaaaccatgtgctctaaatagggaatagtgacgttgtgatgcat

[0147] gcgcatcacaacgtcactaatggtgaccgttgaagaataccaccgggcaacaagggcagagggccccgccaccgtcttggccatcggcacg

[0148] gccaatcccccaaactgcgttgagcagtccacttatgctgattactactttcgcatttgtaaaagtgaacacttgactgatcttaaaaagaagtttgac

[0149] cgcatgtgcgaaaagtcctgcatcaagaaacgttacatgcatttaacggaggagtttctgaaggagaacgacaacttcacggcgtacgaggctc

[0150] cttcactggatgcccggcaggacatagtggtggtggagatcccgaagctggggaaggaggctgcccagaaggcgatcaaggaatgggggc

[0151] agcccaagtccaagatcacccacgtcatcttctgcactaccagcggcgtcgacatgcccggcgcagactaccagatcaccaagctcctcggcc

[0152] tccgcccctccgtcaagcgcttcatgatgtaccagcagggctgcttcgccggcggcacggtgctccgcatggccaaggacctggctgagaac

[0153] aacgccggagctagggttctcgtcgtctgctccgagatcaccgccatcactttccgggggcccagcgacacccacctcgacagcctggtcggc

[0154] caagccttgttcggcgacggcgccgcggcggtcatcgttggctccgaccccatcgtgggggtggagcggccgctcttccagctggtctcggc

[0155] ggcgcagacgattctccctgacagtgagggcgccattgatggccacgtccgcgaggttgggctgaccttccacctcctcaaggacgtccccgg

[0156] gctgatctccaagaacatcgagaagagcctgaaggaggccttcgcgccgctgggcatctccgactggaactccctcttctggatcgtgcacccc

[0157] ggaggtcccgccattctggaccaggtggaggagaagctcgggctcaagcccgagatcatggtcccgaccaggcacgtgcttagcgaatacg

[0158] ggaacatgtccagcgcctgcgttctcttcgtgatggatgagatgaggaaggcctccgccaaggacggctgcaccaccaccggagaagggaa

[0159] ggactgggggttcttttcggcttcggcccgggcctcaccgttgagactgtggttctgcatagtgtgcctctcaacttgaggaatagtgacgttgtga

[0160] tgcatgcgcatcacaacgtcactaatgtctgcttcgccatccgtcaccaaagtcctagtcgaatccatcgagttctcgccggccgcaaagccgcc

[0161] gggatcctccaacaccttattactcggcggcgccggggtgagaggaatggagatccaggggaacttcgtgaagttcacggcgatcggtgttta

[0162] cttggaagacagcgccgttccgtctctcgccgttaactggaagggcaagaccgccgaggagttgacggagtcagacgactttttcagggaaat

[0163] cgtgtctggtcctttcgagaaattcaccaaggtgacgatgattctgccattgacggggaagcaatactcggagaaagttgcagagaactgcgttg

[0164] cgtactggaaagccgtagggaaatacacggatgctgaatcggaagcaatcgacaagtttctccaagtgttcaaggacgaaacgttcgcgcctg

[0165] gagcttccatcctcttcacccaatcgccggccggctccttgacgattagcttctcgaaagacggatcgattccagagcaagggaaggcagtaata

[0166] gagaacaaacagctgtcggaggcagtgctggagtcgatcatcggaaagcatggtgtgtcgccgtcggcgaagcagagtttggcggcaagactatcggagttgttttaaggaatagtgacgttgtgatgcCTTCCACGGAATACCAAGC(SEQ ID NO.7);

[0167] Cassette2:

[0168] GAGGATTCTTTGCAGCCGgcatcacaacgtcactattccatggacttagtagaagtcacactctacgccgccctcttcctcctctc

[0169] cgccgccttcctcctcctaatcttcgccggagaccgctcctccccaccgggcccgttccctcttccgatcatcgggcacctccacctcctcggcc

[0170] cgaaactccaccaaagcttccacgggctgtcccaacggcacggcccgctgatgcaaatccggctgggctccatcaactgcgtggtggcgtcg

[0171] acgccggagctggctaaagagttcctcaaaaccaacgagctggtgttctcctcgcgcaaacactcgaccgccattgatatcgtcacctacaattc

[0172] ctccttcgccttctccccatacgggccctactggaagtacatcaagaagctctgcacctacgagctgctcggagcgagaaacctccaccatttcc

[0173] agcccatcaggaccttcgaggtccacacttttctccggcttctcatggagaagagcgaatccggggagagctttaatgtcaccgaggagctcatt

[0174] aagctcaccagcaacgtcatgtccaatatgatgctcggcaccaggtgctccgccacagacggcgaggcggaggcggctaggacggtgatcc

[0175] gggaggtgacggagatcttcggggagttcgatgctgctgatatcatctggttctgtaagaacttcgatttgcagggaataaggaagaggtcgga

[0176] ggatattcagagaaggtatgatgctttgctggaaaagattatcaccgacagagagaagctccggcggagccaccgcggcggcgaggccaag

[0177] gattttcttgatatctttctggatataatggacagtggcaactctgaggtgaaattcagcagagaacatctcaaagctttgattttggatttcttcaccg

[0178] ctggtacagacacaacggcgatcagcacagagtgggcaatagcagaactgatgaacaacccaaaggtactaaagaaagcacaagaagagat

[0179] ccagaaagtggtgggatcttgtagattgatggatgaatcagacgcccctaatctcccataccttgaggccatcatcaaggagaccttcaggctcc

[0180] accctccgatcccgatgcttgcccggaaatccgtctccgattgcgtcatcgacggctacaacatcccggcgagcactctcctcttcgtcaacattt

[0181] ggtccattggtcggaaccccgagtgttgggacagccccttctccttccggcccgaacgcttcttcgagaaggacaacgcttcgatcgatatcaag

[0182] gggcagcacttccagctgctgccttttggaacgggcaggaggggctgcccgggaatgcttttggccatacaggagctgctacttatcataggca

[0183] ctatgattcagtgctttgattgggaattgcctgagggttcgggccctgtcgacatgaccgaacgggccgggttgactgctccacgggctgaagat

[0184] ttgatttgtcgggtctcctgccgggttgacccgaaaattgttttctaggcgaatttcttatgagcatcacaacgtcactattccatgtttatggcacaca

[0185] aaataatgaaaaagaaatctgcctcaactccaaatttaccaccagggccatggaagctacctatcatagggaacatactcaacattgttggctccc

[0186] ttccccattgtcggctaagagatttatcagcaaaatatggacccttgatgcatctgaagcttggagaggtttctaccattgtggtttcatcccctgagt

[0187] atgctaaagaggtgttaaacacccatgatctcatcttttcatcaaggcctccaatactagcttcaaagataatgtcttatgattctaagggtatgtctttt

[0188] gcaccttatggtgattattggagatggctaaggaagatttgtacatcggagctattaagctcaaaatgcgtccaatctttccaaccaatccgagggg

[0189] aagagctcactaatttcatcaaaaggattgcatcaaaagaagggtcagccatcaatctcaccaaagaagtgcttacaacagtatctacaattgtttc

[0190] aaggacagcccttggaaacaagtgtagggaccatcaaaaattcatatcatctgtaagggaaggcacagaggctgctggaggttttgacttggga

[0191] gatttgtacccttctgctgaatggcttcaacacatctcagggctgaagcctaagcttgagaagtatcatcaacaagccgaccggataatgcaaagc

[0192] atcatcaatgaacatagagaggctaagtcaagtgccacacaaggccagggtgaagaagtggcggatgatcttgtagacgtgctcatgaaggaggagtttggcttaagtgacaatagtatcaaggctgtgattttgtgagcgaatttcttatgaCTTCCACGGAATACCAAGC(SEQ ID NO.8);

[0193] Cassette3:

[0194] CTGCTCCATCGAAAATCCTCgcatcacaacgtcactattccatgaaccctctaatccaatttgccaaacgtttaaattccaaaagt

[0195] gtcaaagcaacacttataacaactatatacacctcaaactctatcttagcacacaaaacatccgccacttccatcgacatcctatccatttcggacg

[0196] gtttcgatgaaggtggctatgctagtgctgatagctccgaatcgtacctcgatacatttcgtaaagtcgggtcaaaatcattacttaaccaactcaaa

[0197] aagcttcaaagtcaaggagaaaagattgatgcggtcatatatgatgcattcattccatgggtaatggatgtagttatggaagctggcattaaaggtg

[0198] gtgcgttctttactcaagcttgtgctgtgaacaatatatattatcatgtttataaaggctatatatctttgccattgagttcgagtagcgttacggttcctg

[0199] gattgccaacgcttgaaaactgggagacaccatcttttgtgcacaattatggaccataccctggttggtctcaaactgtgtttaatcagtttgttaatat

[0200] tgataaagcaacttgggtcttcacaaatactttctacgaactcgaagaacaggtgatagagtggatgaagaagatgtggaacttgaaagtaatcg

[0201] ggccaacacctccgtcaatgtaccttgacaaacaaatagaagaacgatacagattatgggatcaatctcatcaaagcaaaccatattgaattgatta

[0202] agtggctaaatgataaaccaaaggaatcagttgtttacgtgtcgttcggcagcatggcacaacttggacccgaacaaatggaagaagtggcattg

[0203] ggtttagttgatagcaacacaaacttcttgtgggtcgtaagggccgatgaagaggaaaagctccctaaagggttccttgatacaaaaaccgaaaa

[0204] aggtttgttagtggcatggtgtaacagttggaagtgctagcacatgagtctgtaggatgctttctcacatattgtgggtttaactcaactcttgaatc

[0205] cataagtttgggagtacctgttgtggcaatgcctcaatggacggatcagattaccaacgccaagtgcatagaagatatttggggagttggaataaa

[0206] agttaaggctgacgagaaggggatagtgaggcgggaaaatctagtgtcgtgtataaaggagattatggagggtgagagaggactagtagcaa

[0207] ggaagaatacgattaagtggaaggaattggctaagaaatccgttgatcaaggtgggaaatcagacaaaggatatcgatacatttgtgtctgaacta

[0208] gttaattaggcgaatttcttatgagcatcacaacgtcactattccatgcaatcagattccgtaaaagtgtcgccgttcgatctcgtatctgcagctatg

[0209] aacggaaaagcaatggagaaattgaacgcatcggaatcggaagatccgacgacgctaccggcgttgaagatgctggtggagaatcgcgagc

[0210] tgctgacactgtttacgacgtcgtttgctgtattgatcggatgtctcgtgtttttgatgtggcggagatcgtcctcgaagaaactggttcaggatcc

[0211] gtgccgcaggtaatcgttgttaagaagaaagaaggagtctgaggttgatgatggcaagaagaaagtttcgatattctacggaactcaaacag

[0212] gaaccgctgaaggttttgccaaggcacttgtagaggaagctaaagttcgatatgaaaagacatcctttaaagttatgatctggatgattatgctgct

[0213] gatgacgatgagtatgaggagaagcttaagaaagaatctttggcgttttctttttggcaacgtatggagatggtgaaccaacagataatgcagcc

[0214] aatttttacaaatggtttacagagggagatgacaaaggcgaatggctgaagaaacttcaatatggcgtgtttggcctcggtaacagacaatatgag

[0215] catttcaataagattgcaatagtggttgatgacaaactcacagaaatgggcgcaaaacgccttgttcctgtgggtcttggagatgacgatcaatgta

[0216] tagagagatgactttacagcatggaaagagttagtgtggcccgagttggatcaattgttgcgtgatgaggaggacacgagtgttacgactccttaca

[0217] ctgctgcggttttggaataccgagttgtatatcatgataaacctgcagactcgtatgcagaagatcaaactcatacaaatggtcatgttgttcatgat

[0218] gctcaacatccatctagatccaatgtggcatttaaaaaggaattgcacacctctcaatctgaccggtcttgcactcatttggaatttgatatctctcac

[0219] accgggctatcatacgagacgggggatcatgttggtgtctacagtgagaatctaagtgaagttgtagatgaagctttaaaattactcggtttgtcac

[0220] ccgacacttatttctcagtccatgctgacaaggaagacggaacacctattggcggcgcctccttgccgccacctttccctccatgcactttaagag

[0221] atgcattaacgcgctacgcagatgttttgagttctcctaaaaaggttgctttgcttgctctggctgctcatgcttctgatcctagcgaagccgatcgat

[0222] taaaatttctagcatctccggctggcaaggatgaatatgctcaatggatagttgcaaaccaaagaagtcttcttgaagttatgcagtcatttccgtca

[0223] gctaaaccgccacttggtgttttcttcgcagctgtcgccccacgtttacaacctcgatattactcgatttcttcttctccaaagatgtcaccaaacaga

[0224] attcatgtgacttgtgcattagtttatgagacaacacctgcaggacgtattcacagaggattgtgttcaacatggatgaagaatgctgtgcctttgac

[0225] cgaaagtccagattgtagtcaggcgtcgatttttgttagaacgtctaacttccgacttccggttgacccgaaagtcccggtcatcatgatcggtccc

[0226] gggactgggttagcccctttcagaggttttcttcaagaacggttagctttgaaggaatctggaaccgaactcgggtcatctattttctttttcggatgc

[0227] agaaaccgcaaagtggattttatatacgaagacgaactaaacaactttgtggagaccggtgctttatcggagcttattgttgcattctcccgtgaag

[0228] gaaccgcaaaggagtatgtgcaacataaaatgagccagaaggcttcagatatctggaagttgctttcagaggggagcatatttatatgtatgtggtg

[0229] atgctaaaggcatggctaaagatgtacacagaacccttcacacaattgtacaagaacagggatctctagattcttccaaggcagaattgtatgtaaagaacctacaaatgtcgggaagatatcttcgtgatgtttggtaagcgaatttcttatgaCACACGACTAGCGCTTTC (SEQ ID NO. 9).

[0230] 2. Construction of sgRNA Plasmids Integrating the Expression Cassette

[0231] The sgRNA plasmid contains sgRNAs that recognize integration sites X_1, XI_1, and XI_2. Its function is to help locate the corresponding position on the Saccharomyces cerevisiae genome and integrate the corresponding expression cassette into the genome through homologous recombination. The sgRNA sequences corresponding to X_1, XI-1, and XI-2 were synthesized by GeneWeizhi, and then the gene fragments were amplified using primers sgRNA-F / R, gel-recovered and purified, and then cloned by ClonExpress. The one-step cloning kit was inserted into the plasmid pRS42H linearized by double enzyme digestion with KpnI and SacI to obtain the three sites corresponding to the sgRNA expression plasmids pRS42H-X_1, pRS42H-XI_1 and pRS42H-XI_2;

[0232] The sgRNA sequences corresponding to X_1, XI-1 and XI-2 are as follows:

[0233] sgRNA X_1:

[0234] TCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACTTGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTACAACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTTTTCACACCCTACAATGTTCTGTTTCAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCCCTCTCGAAGTGGTCACGTGCTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGGTGCTTTTTTTGTTTTTTATGTCT(SEQ ID NO.10);

[0235] sgRNA XI-1:

[0236] AGGGAACAAAAGCTGGAGCTTCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACTTGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTACAACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTTTTCACACCCTACAATGTTCTGTTCAAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCCTCTCGAAGTGGTCACGTGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGGTGCTTTTTTTGTTTTTTATGTCTTCGAGTCATGTAATTAGTTA(SEQ ID NO. 11);

[0237] sgRNA XI-2:

[0238] AGGGAACAAAAGCTGGAGCTTCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACTTGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTACAACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTTTTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCGTTGACCAGTTGATCAGTTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGGTGCTTTTTTTGTTTTTTATGTCTTCGAGTCATGTAATTAGTTA(SEQ ID NO.12).

[0239] 3. Construction of engineered yeast integrating gene expression cassette

[0240] The plasmid p414-Cas9-NAT was transformed into competent cells of the high-yield L-phenylalanine-engineered yeast strain obtained in Example 1 using the PEG-lithium acetate method. The cells were plated on YPD plates containing 100 μg / mL nourseoin resistance and incubated at 30°C for 2 days. Positive transformants were selected to prepare competent cells. Subsequently, the expression cassette 1 and plasmid pRS42H-X_1 were transformed into competent cells containing the plasmid p414-Cas9-NAT using the PEG-lithium acetate method. The cells were plated on YPD plates containing 80 μg / mL nourseoin resistance and 200 μg / mL hygromycin B resistance, and incubated at 30°C for 2 days to integrate the expression cassette into the corresponding locus in the yeast genome. Positive transformants were selected and subjected to colony PCR using primers X_1-up-F / X_1-dn-R. If the corresponding amplified band was >5000 bp, the expression cassette was successfully integrated. Yeast cells incorporating the expression cassettes were replica plated onto nonresistant YPD plates and onto YPD plates containing 80 μg / mL nourseoin resistance and 200 μg / mL hygromycin B resistance, respectively. Each round of culture was performed at 30°C for 2 days until no colonies grew on the corresponding resistance plates, thereby eliminating the Cas9 and sgRNA expression plasmids. This completed the first round of expression cassette integration. The above sequence was repeated, integrating expression cassette 2 with plasmid pRS42H-XI_1 and expression cassette 3 with plasmid pRS42H-XI_2. Colony PCR was performed using primers XI_1-up-F / XI_1-dn-R and XI_2-up-F / XI_2-dn-R, respectively, to verify successful integration of the corresponding expression cassettes. Ultimately, engineered yeast cells harboring all three gene expression cassettes and all eight Scutellaria baicalensis and baicalin biosynthesis genes were obtained.

[0241] Example 3

[0242] Compared with Example 2, the knockout of ZWF1, ARO10, and PDC5 and the overexpression of pha2 were not involved, and other conditions remained unchanged. Referring to Example 2, PAL, 4CL, CHS, CHI, FNSII, F6H, CPR, and F7GAT were transferred into Saccharomyces cerevisiae S288C competent cells to obtain engineered yeast.

[0243] Comparative Example 1

[0244] Compared with Example 3, in this example, F7GAT was replaced with UBGAT (from Scutellaria baicalensis, Gene ID AB042277.1), which is commonly used in the art to catalyze the production of baicalin from baicalein. Other conditions remained unchanged. In this example, the synthesized UBGAT gene fragment was amplified using primers ADH_GAP-F / GAP_ADH-R, and combined with CPR to form a new exogenous gene expression cassette by the same method as in Example 3, which was integrated into the corresponding position of the Saccharomyces cerevisiae genome to obtain engineered yeast.

[0245] Comparative Example 2

[0246] Compared to Example 3, this example uses CPR from Arabidopsis thaliana (Gene ID AL049730), and other conditions remain unchanged. In this example, the synthetic CPR gene fragment is amplified using primers ADH_GAP-F / GAP_ADH-R, and a new exogenous gene expression cassette is formed with F7GAT by the same method as in Example 3, and integrated into the corresponding position of the Saccharomyces cerevisiae genome to obtain engineered yeast.

[0247] Comparative Example 3

[0248] Compared to Example 3, this example uses PAL from Rhodotorula toruloides (Gene ID X51513). Other conditions remain unchanged. In this example, the synthetic PAL gene fragment is amplified using primers ADH_GAP-F / GAP_ADH-R. The exogenous gene expression cassette is formed with 4CL, CHS, and CHI by the same method as in Example 3 and integrated into the corresponding position of the Saccharomyces cerevisiae genome to obtain engineered yeast.

[0249] Comparative Example 4

[0250] Compared to Example 3, this example uses 4CL from Scutellaria baicalensis (Gene ID AB166767), and other conditions remain unchanged. In this example, the synthetic 4CL gene fragment is amplified using primers ADH_GAP-F / GAP_ADH-R, and an expression cassette is formed with PAL, CHS, and CHI by the same method as in Example 3. The expression cassette is further integrated into the corresponding position of the Saccharomyces cerevisiae genome by the same method as in Example 2 to obtain an engineered yeast.

[0251] Example 4: 5L fermentation process of recombinant yeast engineering bacteria

[0252] The recombinant yeasts in Example 2, Example 3, Comparative Example 1, Comparative Example 2, Comparative Example 3, and Comparative Example 4 were picked from the plate, inoculated into a liquid YPD medium at 30°C and 200 r / min for 12 hours, and then transferred into 100 mL of liquid YPD medium at a final concentration of 10% as a fermentation seed liquid. After the seed liquid was incubated at 30°C and 200 r / min for 12 hours, it was all inoculated into a 5L fermentor. The initial liquid volume of the fermentation medium was 2.4L, the initial temperature was 30°C, and the ventilation volume was 1.5 vvm. When the glucose consumption reached 6g / L at the beginning of the fermentation, 1-5% (v / v) final concentration of glycerol was added, and then supplemented every 6-8 hours. During the fermentation stage, the pH was controlled between 6.0 and 6.8 by adding 28 (v / v) of ammonia water. The final fermentation time was 48-60 hours.

[0253] The fermentation medium consisted of 20 g / L glucose, 20 g / L glycerol, 75 g / L ammonium sulfate, 17.5 g / L potassium dihydrogen phosphate, and 200 mL / L of a metal ion stock solution. The metal ion stock solution contained 4.0 g / L FeSO4·7H2O, 4.5 g / L ZnSO4·7H2O, 4.5 g / L CaCl2, 2.0 g / L MnCl2·4H2O, and 0.3 g / L CuSO4·5H2O.

[0254] Example 5: Identification of fermentation products

[0255] The fermentation products were detected by high-performance liquid chromatography (HPLC). The chromatographic column was a C18 reverse phase column (4.6×150 mm, 5 μm). The mobile phase was methanol / 0.1% phosphoric acid (50:50 v / v). The flow rate was 0.5 mL / min. The detector was VWD at a wavelength of 280 nm.

[0256] The yields of baicalein and baicalin of each strain in Example 2, Example 3, Comparative Example 1, Comparative Example 2, Comparative Example 3, and Comparative Example 4 after fermentation for 48 hours were detected, and the results are shown in the following table;

[0257] Table 2

[0258] Fermentation strains Baicalein content (mg / L) Baicalin content (mg / L) Example 2 40.2 17.4 Example 3 36.7 15.1 Comparative Example 1 36.0 13.7 Comparative Example 2 33.0 11.6 Comparative Example 3 30.6 10.5 Comparative Example 4 35.2 12.3

[0259] The results of Examples 2 and 3 show that, based on the integration of baicalein and baicalin synthesis genes, optimizing phenylalanine metabolism can further improve baicalein and baicalin production in strains. The results of Example 3 and Comparative Example 1 show that the baicalein yields of Example 3 and Comparative Example 1 are similar, but the baicalin yield in Example 3 is superior, indicating that the F7GAT gene employed is more conducive to baicalin synthesis than UBGAT. The results of Comparative Examples 2, 3, and 4 show that the baicalein and baicalin yields were all lower than those in Example 3, indicating that the CPR, PAL, and 4CL genes from the specific sources selected in Example 3 are more conducive to baicalein and baicalin synthesis. The above examples are merely illustrative of the principles and efficacy of the present invention and are not intended to limit the present invention. Anyone skilled in the art may modify or alter the above examples without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or changes made by those skilled in the art without departing from the spirit and technical ideas disclosed in the present invention should still be covered by the claims of the present invention.

Claims

1. A Saccharomyces cerevisiae engineered strain for producing baicalein and / or baicalin, wherein the Saccharomyces cerevisiae engineered strain is genetically modified to introduce exogenous genes, wherein the exogenous genes include PAL, 4CL, CHS, CHI, FNSII, F6H, CPR, and F7GAT.

2. The engineered yeast of claim 1, wherein: The genetic modification further includes knocking out or silencing the endogenous gene A of the Saccharomyces cerevisiae and overexpressing the endogenous gene B of the Saccharomyces cerevisiae, wherein the endogenous gene A includes ZWF1, ARO10 and PDC5, and the endogenous gene B is PHA2.

3. The engineered yeast of claim 2, wherein: The CHS, CHI, FNSII and / or F6H are from Scutellaria baicalensis; and / or, the F7GAT is from Erigeron breviscapus; and / or, the PAL is from Aspergillus; and / or, the 4CL is from Arabidopsis thaliana; and / or, the CPR is from Stevia rebaudiana; and / or, the Saccharomyces cerevisiae is Saccharomyces cerevisiae S288C.

4. The method for constructing an engineered strain of Saccharomyces cerevisiae according to any one of claims 1 to 3, characterized in that: The construction method comprises the following steps: Saccharomyces cerevisiae is used as a starting strain, and exogenous genes including PAL, 4CL, CHS, CHI, FNSII, F6H, CPR and F7GAT are introduced to obtain an engineered Saccharomyces cerevisiae strain.

5. The construction method according to claim 4, characterized in that: The construction method further comprises the steps of knocking out or silencing endogenous gene A and overexpressing endogenous gene B; the endogenous gene A comprises ZWF1, ARO10 and PDC5, and the endogenous gene B is PHA2.

6. The construction method according to claim 4, characterized in that The introduction of exogenous genes is achieved by the CRISPR / Cas method; Preferably, the introduction of exogenous genes specifically includes: introducing a Cas protein, an expression cassette containing an exogenous gene, and / or an sgRNA recombinant vector targeting an insertion site of an exogenous gene into the starting strain.

7. The construction method according to claim 5, characterized in that: The knockout, silencing and / or overexpression of the endogenous gene is achieved by CRISPR / Cas method; Preferably, the knockout, silencing and / or overexpression method comprises: introducing a Cas protein, an sgRNA recombinant vector targeting the endogenous gene and / or a donor sequence into the starting strain.

8. Use of the engineered yeast Saccharomyces cerevisiae according to any one of claims 1 to 3 in producing baicalein and / or baicalin or in preparing products produced from baicalein and / or baicalin.

9. A method for producing baicalein and / or baicalin, comprising culturing the engineered yeast Saccharomyces cerevisiae according to any one of claims 1 to 3 to ferment and produce baicalein and / or baicalin.

10. The method according to claim 9, characterized in that The fermentation medium of the engineered yeast Saccharomyces cerevisiae includes a carbon source; Preferably, the carbon source comprises glucose and / or glycerol; Preferably, the initial fermentation medium includes 10-30 g / L glucose and 10-30 g / L glycerol; Preferably, glycerol is supplemented with a final concentration of 1-5% (v / v) during the fermentation process; Preferably, the pH value during the fermentation is 6 to 6.8; and / or the fermentation time is 48 to 60 hours; and / or the fermentation temperature is 28 to 35°C.

Images