Biomarker for predicting solid tumor resisting curative effect of HDAC (histone deacetylase) inhibitor and application of biomarker
PFKL was discovered as a biomarker through whole-genome CRISPR-Cas9 screening, which solved the problems of poor efficacy and lack of markers of HDAC inhibitors in solid tumors, realized the prediction of the efficacy of HDAC inhibitors and personalized treatment, and improved the treatment effect and patient response.
Patent Information
- Application Number
- CN202510708221.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-29
- Publication Date
- 2025-10-03
AI Technical Summary
Existing HDAC inhibitors have poor efficacy in treating solid tumors, lack effective biomarkers to predict patient response and improve individualized treatment efficacy, and have cytotoxicity and side effects.
Through whole-genome CRISPR-Cas9 knockout library screening, it was found that liver-type phosphofructokinase (PFKL) expression is closely related to the sensitivity of HDAC inhibitors, providing PFKL as a biomarker for predicting the efficacy of HDAC inhibitors and developing corresponding detection methods.
Effectively predict the efficacy of HDAC inhibitors in various solid tumors, promote early efficacy evaluation and personalized diagnosis and treatment plans, improve treatment sensitivity, and reduce side effects.
Smart Images
Figure CN120741855A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to a biomarker for predicting the efficacy of HDAC inhibitors against solid tumors and its application. Background Art
[0002] Epigenetic-based therapies are considered to be a research direction with significant potential in the treatment of malignant tumors. Epigenetic drugs have demonstrated certain therapeutic advantages in monotherapy or in combination with chemotherapy / immunotherapy. Their underlying mechanisms may involve biological processes such as regulating tumor resistance phenotypes, reshaping the tumor immune microenvironment, and synergistically enhancing anti-tumor effects. In recent years, the role of histone deacetylase inhibitors (HDACi) in anti-tumor therapy has attracted widespread attention. HDACi inhibit intracellular HDAC activity, altering the acetylation status of histones and non-histone proteins, and inducing epigenetic changes in tumor cells, thereby leading to cell cycle arrest, senescence, and apoptosis in various tumor types, such as liver cancer, bile duct cancer, breast cancer, lung cancer, prostate cancer, renal cancer, and T-cell lymphoma.
[0003] It is worth noting that although HDACi have shown potential in clinical trials and cancer treatment, their application also has certain limitations, including: ① The single-agent treatment effect on solid tumors is poor; HDACi generally show good efficacy in hematologic tumors, but the response is poor in solid tumors such as breast cancer, kidney cancer, and pancreatic cancer. ② Lack of biomarkers: Currently, there is a lack of effective biomarkers to predict patient response to HDACi and improve the efficacy of personalized treatment. ③ High cytotoxicity and side effects: The clinical use of HDACi is often accompanied by various side effects such as fatigue, nausea, vomiting, and diarrhea, and may cause hematologic toxicity. Considering the current limitations of HDACi application, identifying specific typing targets and improving drug selection sensitivity are crucial for developing new HDACi and breaking through bottlenecks in solid tumor treatment.
[0004] Glycolysis is one of the most important metabolic pathways in cells, closely associated with the proliferation, drug resistance, and metastasis of malignant tumor cells. As a key rate-limiting enzyme in glycolysis, phosphofructokinase liver isoform (PFKL) catalyzes the irreversible phosphorylation of fructose-6-phosphate (F6P) to produce fructose-1,6-bisphosphate (F1,6BP). This process is a key rate-limiting step in the glycolysis metabolic flux. Summary of the Invention
[0005] This study, using genome-wide CRISPR-Cas9 knockout library screening, revealed that PFKL deficiency specifically confers resistance to HDAC inhibitors in solid tumors. Therefore, PFKL expression significantly impacts the efficacy of HDAC inhibitors and can be used as a biomarker to predict the efficacy of HDAC inhibitors in solid tumors. This study provides a scientific basis for addressing the current challenges of poor efficacy and biomarker-based treatments for solid tumors in the clinical application of HDAC inhibitors, and holds significant clinical significance.
[0006] The present invention aims to provide a biomarker for predicting the efficacy of HDAC inhibitors against solid tumors and to promote its application in clinical efficacy assessment by developing corresponding detection methods to address the above-mentioned technical problems. This biomarker can effectively predict the efficacy of HDAC inhibitors in various tumors, especially solid tumors, and is of great value for early evaluation of the efficacy of HDAC inhibitors in clinical patients with solid tumors and the development of personalized diagnosis and treatment plans.
[0007] In a first aspect of the present invention, a biomarker for predicting the anti-tumor efficacy of HDAC inhibitors in solid tumors is provided, wherein the biomarker is liver-type phosphofructokinase PFKL.
[0008] The second aspect of the present invention provides the use of a reagent for detecting the expression level of liver-type phosphofructokinase (PFKL) in the preparation of a kit for predicting the efficacy of HDAC inhibitors against solid tumors.
[0009] Furthermore, the reagent for detecting the expression level of liver-type phosphofructokinase PFKL is a reagent for detecting the expression level of liver-type phosphofructokinase PFKL in solid tumor tissue.
[0010] Furthermore, the HDAC inhibitors include but are not limited to Romidepsin, Panobinostat, Vorinostat, Belinostat, Chidamide and Tucidinostat.
[0011] Furthermore, the solid tumor is selected from bile duct cancer, hepatocellular carcinoma, gastric cancer, colorectal cancer, breast cancer, lung cancer or ovarian cancer.
[0012] Furthermore, the bile duct cancer is intrahepatic bile duct cancer or extrahepatic bile duct cancer.
[0013] Furthermore, patients with high expression of liver-type phosphofructokinase (PFKL) in tumor tissue (scored by immunohistochemistry) are more sensitive to HDAC inhibitors and have better efficacy in HDAC inhibitor treatment; patients with low PFKL expression are more tolerant to HDAC inhibitors and have poorer efficacy in HDAC inhibitor treatment.
[0014] In a third aspect, the present invention provides a kit for predicting the therapeutic efficacy of HDAC inhibitors in solid tumors, comprising a reagent for detecting the expression level of liver-type phosphofructokinase (PFKL) in solid tumor tissues.
[0015] Furthermore, the solid tumor is selected from bile duct cancer, hepatocellular carcinoma, gastric cancer, colorectal cancer, breast cancer, lung cancer or ovarian cancer.
[0016] Furthermore, the bile duct cancer is intrahepatic bile duct cancer or extrahepatic bile duct cancer.
[0017] This study, using genome-wide CRISPR-Cas9 knockout library screening, bioinformatics functional analysis, in vitro drug sensitivity analysis, and in vivo CDX and PDX model construction, combined with cell and mouse models, confirmed the key role of PFKL in promoting the efficacy of HDAC inhibitors in solid tumors. It also confirmed that liver-type phosphofructokinase (PFKL) can be used as a biomarker to effectively predict the efficacy of HDAC inhibitors against solid tumors, providing a solid theoretical foundation for the clinical application of key biomarker-based prediction of HDAC inhibitor anti-tumor efficacy. This study has important clinical value for early assessment of HDAC inhibitor efficacy in clinical tumor patients, developing personalized treatment plans, and improving tumor patient survival.
[0018] The advantages and positive effects of the use of PFKL as a biomarker for predicting the efficacy of HDAC inhibitors in solid tumors are:
[0019] 1. Based on whole-genome CRISPR-Cas9 library screening technology, enrichment analysis, gene knockdown / overexpression technology, etc., this paper found that the expression of PFKL in tumor cells is closely related to their sensitivity to HDAC inhibitors, indicating that PFKL plays a key role in regulating the drug sensitivity response of HDAC inhibitors.
[0020] 2. Through nude mouse tumor-bearing experiments and PDX models, the present invention found that high expression of PFKL in tumor tissue significantly promotes the killing effect of HDAC inhibitors on tumor cells, while low expression of PFKL inhibits the efficacy of HDAC inhibitors in various tumors, indicating that PFKL can be used as a molecular marker to predict the efficacy of HDAC inhibitors in solid tumors. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1This figure shows the use of genome-wide CRISPR-Cas9 library screening to identify key genes regulating HDAC inhibitor efficacy. Figure A shows a schematic diagram of the genome-wide CRISPR-Cas9 in vitro screening process. Cholangiocarcinoma cells TFK1 and 783C-6 were transfected with a lentiviral gRNA library, followed by puromycin selection (2 μg / mL). They were then treated with DMSO (Tun-treated) or the HDAC inhibitor Romidepsin / Panobinostat (T-treated) for 7 days. Genomic DNA was then extracted and used for sequencing analysis. The experiment was repeated three times. Figure B shows the intersection analysis of the enriched hits shared by the sgRNAs in TFK1 and 783C-6 cells after sequencing analysis. Figure C shows the knockdown efficiency of the synthesized siRNA sequences against four candidate genes, as assessed by qPCR. si-#1 and si-#2 refer to the two siRNA sequences targeting the target genes. Figure D shows the effect of knockdown of different candidate genes on HDAC inhibitor efficacy, assessed by in vitro drug sensitivity assays (ATP-Glo assay, 72 hours).
[0022] Figure 2 The following figure demonstrates the regulatory effect of PFKL on the efficacy of HDAC inhibitors, as demonstrated by the construction of PFKL knockdown and knockout cholangiocarcinoma cell lines. A shows the sensitivity of cholangiocarcinoma cells to HDAC inhibitors after PFKL knockout (sgPFKL) using the CRISPR-Cas9 viral system (ATP-Glo assay, 72 hours). B shows the knockout efficiency of the PFKL-targeting CRISPR-Cas9 viral system in cholangiocarcinoma cells, as assessed by immunoblotting. C shows the sensitivity of cholangiocarcinoma cells to HDAC inhibitors after PFKL knockdown (shPFKL) using a lentiviral system (ATP-Glo assay, 72 hours). D shows the knockdown efficiency of the PFKL-targeting lentiviral system in cholangiocarcinoma cells, as assessed by immunoblotting. E shows the effect of PFKL knockout (sgPFKL) in TFK1 on the efficacy of HDAC inhibitors, as assessed by a plate-based clonal proliferation assay.
[0023] Figure 3 This study demonstrates the effect of PFKL knockout on the in vivo efficacy of HDAC inhibitors, confirming that PFKL knockout significantly reduces the therapeutic efficacy of HDAC inhibitors against mouse xenograft tumors. The top image shows tumor size and volume in CDX models established with control (sgNC) and PFKL-knockout (sgPFKL) TFK1 cells, following treatment with saline and an HDAC inhibitor. Scale bar, 1.5 cm. The bottom image shows tumor growth and volume in CDX models established with control (sgNC) and PFKL-knockout (sgPFKL) TFK1 cells.
[0024] Figure 4 The correlation between PFKL expression and HDAC inhibitor efficacy was assessed in various solid tumor cell lines. Figure A shows immunoblotting analysis of PFKL expression in different cholangiocarcinoma cells. Figure B shows in vitro chemosensitivity assays evaluating the sensitivity of cholangiocarcinoma cells with high PFKL expression (TFK1, SK-CHA-1, and 783C-6) and low PFKL expression (RBE, 1405R3, and HuCCT1) to HDAC inhibitors. Figure C shows plate-based cloning assays evaluating the sensitivity of cholangiocarcinoma cells with high PFKL expression (TFK1, SK-CHA-1, and 783C-6) and low PFKL expression (RBE, 1405R3, and HuCCT1) to HDAC inhibitors. Figure D shows in vitro chemosensitivity assays evaluating the sensitivity of breast, lung, and ovarian cancer cells with differential PFKL expression to HDAC inhibitors. Figure E shows in vitro chemosensitivity assays evaluating the sensitivity of breast, lung, and ovarian cancer cells with differential PFKL expression to the HDAC inhibitor romidepsin.
[0025] Figure 5 Figure 1 shows the application of PFKL typing to assess the efficacy of HDAC inhibitors in cancer cell line-derived xenograft (CDX) and patient-derived tumor xenograft (PDX) models. Figure A shows a flow chart for CDX and PDX model construction. Well-growing human cholangiocarcinoma cell lines (CDX models) or fresh tumor tissue (PDX models) were inoculated subcutaneously in nude mice. After tumor growth, mice were treated intraperitoneally with saline or HDAC inhibitors for 3-5 weeks. Tumor tissue was then harvested for subsequent experimental analysis. Figure B shows images of tumor size and volume obtained from CDX models constructed from different cholangiocarcinoma cell lines. Scale bar, 1.5 cm. Figure C shows images of tumor growth volume in CDX models constructed from different cholangiocarcinoma cell lines. Figure D shows H&E staining (morphological characterization) and CK19 immunohistochemical staining of tumor tissue. Scale bar, 100 μm. E shows immunohistochemical analysis of PFKL expression in six PDX tumor tissues. F shows images of tumor size and volume obtained from different cholangiocarcinoma PDX models. Scale bar, 1.5 cm. G shows images of tumor growth volume in different cholangiocarcinoma PDX models. DETAILED DESCRIPTION
[0026] The specific embodiments of the present invention are described in detail below with reference to the examples. Where specific conditions are not specified in the examples, conventional conditions or conditions recommended by the manufacturer shall be followed.
[0027] The genome-wide CRISPR knockout library (CRISPR-PoolTMKOUT-Human-Single vector) (targeting 20,914 genes and 123,411 sites) was purchased from GeneCare. DMSO (HY-Y0320C) was purchased from MCE, and the HDAC inhibitors Romidepsin (S3020) and Panobinostat (S1030) were purchased from Selleck. Gene-targeting siRNA sequences were synthesized by Shanghai GeneCare, and PFKL knockdown (shPFKL) and knockout (sgPFKL) transfection viruses were constructed and synthesized by GeneCare. In vitro drug susceptibility testing of cells was performed using the Novozymes Cell Viability Assay kit. Human lung cancer cell lines A549 and NCI-H596, human cholangiocarcinoma cell lines RBE and HuCCT1, human breast cancer cell lines MCF-7 and BT-549, and human ovarian cancer cell lines RMG-I and TOV21G were purchased from the Cell Bank of the Chinese Academy of Sciences. The human cholangiocarcinoma cell line SK-CHA-1 was purchased from Shanghai Guandao Bioengineering Co., Ltd.; the human cholangiocarcinoma cell line TFK1 was purchased from Shanghai Yaji Biotechnology Co., Ltd.; and human cholangiocarcinoma primary cells 1405R3 and 783C-6 were isolated and cultured in our laboratory (see references). Feng F, Cheng Q, Li B, Liu C, Wang H, Li B, Xu X, Yu Y, Chen Z, Wu X, Dong H, Chu K, Xie Z, Gao Q, Xiong L, Li F, Yi B, Zhang D, Jiang X. Establishment and characterization of 38 novel patient-derived primary cancer cell lines using multi-region sampling revealing intra-tumor heterogeneity of gallbladder carcinoma. Hum Cell. 2021May;34(3):918-931.
[0028] Six-week-old BALB / c (nu / nu) female nude mice (SPF grade) were purchased from Jicui Yaokang Biological Co., Ltd. A human cholangiocarcinoma xenograft (PDX) model was established (for cell line culture and PDX model establishment, see Jiang, TY, Pan, YF, Wan, ZH, Lin, YK, Zhu, B., Yuan, ZG, Ma, YH, Shi, YY, Zeng, TM, Dong, LW, et al. (2020). PTEN status determines chemosensitivity to proteasome inhibition in cholangiocarcinoma. Sci Transl Med). All other reagents and instruments used, unless the manufacturer is indicated, are commercially available.
[0029] All cholangiocarcinoma tissue samples used in the present invention were obtained from the Third Affiliated Hospital of Naval Medical University; the use of samples and clinical information was reviewed and approved by the hospital's ethics committee, and written informed consent was obtained from the patients.
[0030] PFKL expression in tumor tissues was assessed by immunohistochemistry (IHC). The score was calculated by combining the percentage of positive cells and staining intensity (positive proportion × staining intensity). The median value or receiver operating characteristic (ROC) curve was used to determine the cutoff for high and low PFKL expression. The frequency of PFKL-positive cells was defined as follows: 0 for <5%, 0.25 for 5%-25%, 0.5 for 26%-50%, 0.75 for 51%-75%, and 1 for >75%. The IHC score for PFKL expression intensity was defined as 0 = negative, 1 = weak, 2 = moderate, and 3 = strong. Tumor tissue with an IHC score <1.5 was defined as low PFKL expression.
[0031] The small interfering RNA (siRNA) used in the present invention was purchased from Shanghai GeneGene Co., Ltd., and its nucleotide sequence (sense strand sequence, 5'-3') is as follows:
[0032] siPFKL-1:GGUAAGAUCUCAGAGACUACA (SEQ ID NO.1)
[0033] siPFKL-2: CGGAGAAGAUGAAGACAGACA (SEQ ID NO. 2)
[0034] siPFKFB1-1:GCUCGAGGCAAGACCUAUAUC (SEQ ID NO.3)
[0035] siPFKFB1-2: GAAGGAUGUUCACAACUAUCU (SEQ ID NO.4)
[0036] siLHCGR-1:GGAAAUUUGUGAUAACUUACA (SEQ ID NO.5)
[0037] siLHCGR-2:GCACAGUAAGGAAAGUGAAUA (SEQ ID NO.6)
[0038] siNFIA-1: GAUUCAAGUCAAUCUGAAAGU (SEQ ID NO.7)
[0039] siNFIA-2: AGAGUGUCACAGACACCAUA (SEQ ID NO. 8).
[0040] The PFKL knockdown lentiviruses (shPFKL-1 and shPFKL-2) and knockout lentiviruses (sgPFKL-1 and sgPFKL-2) used in this invention were purchased from Shanghai GeneCare Biotechnology Co., Ltd. The nucleotide sequences of the PFKL knockdown lentiviruses (shPFKL-1, shPFKL-2) are as follows:
[0041] shPFKL-1: GGTAAGATCTCAGAGACTACA (SEQ ID NO.9)
[0042] shPFKL-2: CGGAGAAGATGAAGACAGACA (SEQ ID NO. 10)
[0043] The nucleotide sequences of the PFKL knockout lentivirus (sgPFKL-1 and sgPFKL-2) are as follows:
[0044] sgPFKL-1: ACTTACCAGGATCCGGTCGA (SEQ ID NO.11)
[0045] sgPFKL-2:TTGGCCTTACCTCGTAGATG (SEQ ID NO. 12).
[0046] Example 1: Whole-genome CRISPR-Cas9 library screening to identify the key HDAC inhibitor drug-sensitive gene PFKL
[0047] Whole-genome CRISPR-Cas9 KO library screening can achieve genome-wide gene knockout, and combined with sequencing technology, it can quickly identify genes related to drug sensitization or drug resistance. Therefore, we used whole-genome CRISPR-Cas9 KO library screening technology to explore potential molecules that regulate the efficacy of HDAC inhibitors, providing an experimental basis for the application of HDAC inhibitors in the clinical treatment of solid tumors. We performed whole-genome CRISPR-Cas9 KO library screening in the bile duct cancer cell line TFK1 and the bile duct cancer primary cell 783C-6. Briefly, after the cells were stably transfected with the guide RNA lentiviral library, puromycin was used for resistance screening, and then the HDAC inhibitor Romidepsin or Panobinostat was added to treat the cells for two weeks. Finally, the cells containing sgRNA were collected for library construction and sequencing, and the expression changes of the library were analyzed ( Figure 1 A). In the final screening results, 85 positive enriched genes were found in TFK1 after treatment with Romidepsin and Panobinostat, while 67 positive enriched genes were found in 783C-6. Eight positive enriched genes were found in both cell lines, of which four were protein-coding genes, including PFKFB1, PFKL, LHCGR, and NFIA ( Figure 1 B).
[0048] We first investigated the effects of interfering with candidate genes on cellular drug sensitivity by constructing small interfering RNA (siRNA) targeting four genes. In vitro drug sensitivity testing was performed as follows: 6,000 cells were plated in 96-well white-bottomed transparent plates at a density of 100 μL / well. After attachment, the cells were treated with drugs and cultured for three days. At the end of the culture period, serum-free culture medium and ATP assay reagent were mixed in a 1:1 ratio to prepare the ATP assay working solution. The plate was removed from the incubator and allowed to warm to room temperature for 15 minutes. The old culture medium was removed from the plate, and 100 μL of ATP assay working solution was added to each well. The mixture was gently tapped to mix, and the cells were incubated for 10-15 minutes (at room temperature, protected from light). Luminescence was then measured.
[0049] The results showed that interference with PFKFB1, LHCGR, and NFIA did not affect the sensitivity of cells to Romidepsin and Panobinostat, and there was no significant difference in GI50 values; however, interference with PFKL caused a significant increase in the GI50 value of HDAC inhibitors and a significant decrease in drug sensitivity ( Figure 1C, D). Furthermore, by constructing PFKL stably knocked down (shPFKL) and knocked out (sgPFKL) cholangiocarcinoma cells, we observed similar results to those in the siPFKL experimental group: knocking down or knocking out PFKL significantly reduced the drug sensitivity of cholangiocarcinoma cells to the HDAC inhibitors Romidepsin and Panobinostat ( Figure 2 ).
[0050] To further verify the effect of PFKL knockout on the in vivo efficacy of HDAC inhibitors, we established a subcutaneous tumor-bearing model of TFK1 mice with control (sgNC) and PFKL knockout (sgPFKL). The results showed that PFKL knockout could significantly inhibit the in vivo efficacy of HDAC inhibitors and promote tumor proliferation and survival during drug treatment ( Figure 3 The above results indicate that the gene PFKL, identified based on whole-genome CRISPR-Cas9 KO library screening, is a key drug-sensitive gene for HDAC inhibitors Romidepsin and Panobinostat, and PFKL deletion reduces the sensitivity of cholangiocarcinoma cells to HDAC inhibitors.
[0051] Example 2: PFKL expression in solid tumor cells significantly affects the efficacy of HDAC inhibitors
[0052] To examine the correlation between PFKL expression in cholangiocarcinoma cells and the efficacy of HDAC inhibitors, we first examined the baseline expression level of PFKL in different cholangiocarcinoma cells. Western blot results indicated that PFKL expression varied significantly in different cells: PFKL was highly expressed in TFK1, SK-CHA-1, and 783C-6 (PFKL high expression group), while it was less expressed in RBE, 1405R3, and HuCCT1 (PFKL low expression group) ( Figure 4 A). Combined with in vitro drug sensitivity experiments, we found that the HDAC inhibitor GI50 values between the two groups of cells were significantly different: cells in the PFKL high-expression group were more sensitive to Romidepsin or Panobinostat, while cells in the PFKL low-expression group were more tolerant ( Figure 4 B). In addition, plate cloning experiments also showed that high expression of PFKL in cholangiocarcinoma cells significantly promoted the efficacy of Romidepsin or Panobinostat ( Figure 4 C).
[0053] Next, we selected six solid tumor cell lines with different PFKL expression levels to verify the effect of PFKL expression on the sensitivity of other solid tumor cells to HDAC inhibitors. In vitro drug sensitivity and plate cloning experiments showed that among breast cancer, lung cancer, and ovarian cancer cell lines, cell lines with high PFKL expression were more sensitive to HDAC inhibitors, suggesting that PFKL expression significantly affects the sensitivity of other solid tumor cells to HDAC inhibitors ( Figure 4 D, E). These results suggest that the expression of PFKL in solid tumor cells is closely related to their sensitivity to HDAC inhibitors.
[0054] Example 3: PFKL can be used as a typing marker to predict the anti-tumor efficacy of HDAC inhibitors
[0055] Next, we inoculated different cholangiocarcinoma cells or fresh tumor tissues into the subcutaneous tissues of nude mice to construct cell line-derived xenograft (CDX) and patient-derived tumor xenograft (PDX) models to further investigate the correlation between PFKL expression and the efficacy of HDAC inhibitors in vivo. Figure 5 A).
[0056] The subcutaneous tumor-bearing experiment in mice was performed as follows: after cell digestion and centrifugation, the upper layer of culture medium in the centrifuge tube was discarded, the cell pellet was resuspended in PBS, and the cell suspension was filtered through a 70 μm cell strainer and counted using trypan blue staining solution; after re-centrifugation, the cells were resuspended in physiological saline and then mixed with the same volume of Matrigel and placed on ice; 100 μL (containing 1×10 6 The cell-Matrigel mixture was placed in a 1 mL syringe, and after the air in the syringe was expelled, it was injected into the dorsal side of the mouse. 3 After that, the drug administration experiment was started; the tumor size was measured every 3 days, and the tumor volume (0.5×L×W 2 When the tumor volume grows to 1500 mm 3 When the experiment was complete, the mice were killed by carbon dioxide asphyxiation, and experimental records such as taking photos and collecting materials were kept.
[0057] The results showed that compared with the control group, treatment with Romidepsin or Panobinostat significantly reduced the growth of TFK1, SK-CHA-1 and 783C-6 subcutaneous tumors. However, the intervention treatment with the two drugs failed to cause significant growth inhibition of 1405R3 and HuCCT1 subcutaneous tumors ( Figure 5These results indicate that subcutaneous tumors with high PFKL expression (TFK1, SK-CHA-1, and 783C-6) are more sensitive to HDAC inhibitors, which can significantly inhibit their proliferation and growth, while subcutaneous tumors with low PFKL expression (1405R3 and HuCCT1) exhibit a phenotype resistant to HDAC inhibitors.
[0058] Tumor tissues from different cholangiocarcinoma patients were implanted subcutaneously into NSG mice, and we subsequently successfully established 6 PDX models ( Figure 5 D), and immunohistochemistry was used to detect the expression of PFKL in tumor tissues ( Figure 5 E).
[0059] The steps for establishing a PDX model are as follows: ① Take a fresh tumor sample, store it at low temperature and quickly transfer it to a sterile operating table, wash off the blood stains on the tissue, and cut it into 1 mm3 small pieces; ② Soak the tissue in a culture medium / Matrigel mixture and fill it into a 20-gauge inoculation needle to prepare for inoculation; ③ Take a nude mouse or NSG mouse of appropriate age, use an instrument to cut a small incision in the middle of its waist, carefully insert the inoculation needle subcutaneously along the incision, and then push the tissue into the mouse's buttocks. After inoculation is completed, the mouse skin wound is sutured; ④ After 2-3 months of growth, the passaged tumor tissue (P2-Pn...) can be transplanted again and used for subsequent experimental research.
[0060] Immunohistochemical detection was performed according to the following steps: (1) Human cholangiocarcinoma PDX tissues were fixed with 4% neutral formaldehyde for 24 hours, then dehydrated and embedded in paraffin; the paraffin samples were cut into 4 µm thick sections and adsorbed on polylysine-coated slides; (2) Before the staining experiment, the tissue sections were baked in a 60°C oven for 1 hour, and then conventional immunohistochemical staining was performed, including dewaxing, peroxidase inactivation, antigen retrieval, blocking, primary antibody incubation, secondary antibody incubation, DAB color development, hematoxylin staining, tap water anti-blueing, and finally dehydration and sealing.
[0061] PFKL immunohistochemical staining analysis was performed on 6 tumor tissues, and the results showed that PFKL was highly expressed in CC11, CC16, CC52 and CC57 tumors, and was less expressed in CC51 and CC56 tumors. Subsequently, the results of drug intervention experiments on 6 cholangiocarcinoma PDX models showed that compared with the control group (normal saline), treatment with Romidepsin or Panobinostat significantly reduced the growth of CC11, CC16, CC52 and CC57 tumors, showing a good inhibitory effect. In contrast, no significant differences were shown between the experimental and control groups in CC51 and CC56 tumors, indicating that the two PDX tumors were less sensitive to HDAC inhibitors. The above results suggest the potential value of PFKL as a biomarker for evaluating the efficacy of HDAC inhibitors ( Figure 5 F, G).
[0062] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the described embodiments. Those skilled in the art may make various equivalent modifications or substitutions without departing from the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.
Claims
1. Application of a reagent for detecting the expression of liver-type phosphofructokinase (PFKL) in the preparation of a kit for predicting the efficacy of HDAC inhibitors against solid tumors.
2. Use of the reagent for detecting the expression of liver phosphofructokinase PFKL according to claim 1 in preparing a kit for predicting the efficacy of HDAC inhibitors against solid tumors, characterized in that: The reagent for detecting the expression amount of liver-type phosphofructokinase PFKL is a reagent for detecting the expression amount of liver-type phosphofructokinase PFKL in solid tumor tissue.
3. Use of the reagent for detecting the expression of liver phosphofructokinase (PFKL) according to claim 1 in preparing a kit for predicting the efficacy of HDAC inhibitors against solid tumors, characterized in that: The HDAC inhibitor is selected from romidepsin, panobinostat, vorinostat, belinostat, cedamide and tedacestat.
4. Use of the reagent for detecting the expression of liver phosphofructokinase (PFKL) according to claim 1 in preparing a kit for predicting the efficacy of HDAC inhibitors against solid tumors, characterized in that: The solid tumor is selected from bile duct cancer, hepatocellular carcinoma, gastric cancer, colorectal cancer, breast cancer, lung cancer or ovarian cancer.
5. Use of the reagent for detecting the expression of liver phosphofructokinase (PFKL) according to claim 4 in preparing a kit for predicting the efficacy of HDAC inhibitors against solid tumors, characterized in that: The bile duct cancer is intrahepatic bile duct cancer or extrahepatic bile duct cancer.
6. Use of the reagent for detecting the expression of liver phosphofructokinase (PFKL) according to claim 1 in preparing a kit for predicting the efficacy of HDAC inhibitors against solid tumors, characterized in that: Patients with high expression of liver-type phosphofructokinase (PFKL) in tumor tissue are more sensitive to HDAC inhibitors and have better efficacy in HDAC inhibitor treatment; patients with low expression of PFKL are more tolerant to HDAC inhibitors and have poorer efficacy in HDAC inhibitor treatment.
7. A kit for predicting the therapeutic efficacy of HDAC inhibitors in solid tumors, characterized in that: The method comprises a reagent for detecting the expression level of liver-type phosphofructokinase (PFKL) in solid tumor tissue.
8. The kit according to claim 7, characterized in that The solid tumor is selected from bile duct cancer, hepatocellular carcinoma, gastric cancer, colorectal cancer, breast cancer, lung cancer or ovarian cancer.