Primer of canna polymorphic microsatellite molecular marker, application of primer and wetland ecological restoration method
By using canna polymorphic microsatellite molecular marker primers and double PCR amplification technology, the problem of identifying the kinship of canna populations was solved, and the efficiency of wetland ecological restoration was improved, especially when the planting area was 30-40%.
Patent Information
- Application Number
- CN202510939094.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-08
- Publication Date
- 2025-10-14
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify the kinship of canna populations and effectively screen canna populations with high water purification efficiency, resulting in low efficiency of wetland ecological restoration.
Double PCR amplification was performed using primers for polymorphic microsatellite molecular markers of canna, and combined with polyacrylamide gel electrophoresis and genetic analysis software, the genetic distance and relationship of canna populations were quickly evaluated, and canna populations with high water purification efficiency were selected for planting.
It has achieved rapid and accurate identification of the kinship of canna groups and improved the efficiency of wetland ecological restoration, especially when the canna planting area is 30-40%.
Smart Images
Figure CN120776032A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of biological detection and ecological restoration, and particularly relates to a primer for Canna indica polymorphic microsatellite molecular marker and application and a wetland ecological restoration method. BACKGROUND
[0002] Canna indica L. is a perennial herbaceous plant of the Canna indica L. family. It has a beautiful shape, wide leaves, and bright flowers, with a long flowering period and high ornamental value. Canna indica L. has strong adaptability, prefers warm and humid climates, and has strong waterlogging resistance. It has no strict requirements for soil and plays an important role in wetland ecosystems. Canna indica L. has strong absorption and degradation capacity for various pollutants. Its root system can absorb nitrogen, phosphorus and other nutrients in water, reducing water eutrophication. Studies have shown that artificial wetlands planted with Canna indica L. have significant removal effects on total phosphorus (TP), total nitrogen (TN), chemical oxygen demand (COD) and other pollutants. In addition, Canna indica L. can also absorb heavy metals such as lead (Pb), cadmium (Cd), copper (Cu) in water, and has a repairing effect on heavy metal contaminated wetlands. The root system of Canna indica L. forms small air chambers and gaps in the wetland substrate, improving the water conductivity of the wetland and making the water flow more uniform. Its root system can also secrete oxygen, delaying wetland clogging and improving water efficiency. Studies have shown that the root system of Canna indica L. can increase the water efficiency of artificial wetlands from 64% to 83%. The leaves and flowers of Canna indica L. can provide habitats and foraging sites for insects, birds and other animals. Its root system provides a carrier for microbial growth and reproduction and biofilm formation, promoting rhizosphere remediation and providing a good living environment for other organisms in the wetland ecosystem.
[0003] As a plant with both ornamental value and ecological function, Canna indica L. plays an important role in wetland ecological restoration. Its absorption and degradation capacity for various pollutants, improvement of wetland hydraulic properties, and promotion of wetland biodiversity make it an important plant choice in wetland ecological restoration. Therefore, selecting Canna indica L. populations with good water purification effects for planting can effectively improve the efficiency of wetland ecological restoration. The present application provides a primer for Canna indica L. polymorphic microsatellite molecular marker and application and a method for improving the efficiency of wetland ecological restoration using Canna indica L., which has great application value. SUMMARY
[0004] In order to overcome the shortcomings of the prior art, the present application provides a primer for Canna indica L. polymorphic microsatellite molecular marker and application and a wetland ecological restoration method. The method can identify the genetic relationship of Canna indica L. populations and improve the efficiency of wetland ecological restoration.
[0005] The technical scheme adopted by the present application to solve its technical problems is:
[0006] The application provides primers of a Canna polymorphic microsatellite molecular marker, including the following five groups of primer pairs.
[0007]
[0008] The primer pair MRJ1 is used in cooperation with the primer pair MRJ2; the primer pair MRJ3 is used in cooperation with the primer pair MRJ4; the primer pair MRJ5 is used in cooperation with the primer pair MRJ6; the primer pair MRJ7 is used in cooperation with the primer pair MRJ8; and the primer pair MRJ9 is used in cooperation with the primer pair MRJ10. As a duplex PCR system, duplex PCR amplification is performed.
[0009] The application provides a kit for analyzing genetic diversity of a Canna population, which comprises at least the primers of the Canna polymorphic microsatellite molecular marker.
[0010] The application provides application of the primers of the Canna polymorphic microsatellite molecular marker or the kit in identifying the genetic relationship of a Canna population.
[0011] The application provides a method for identifying the genetic relationship of a Canna population, comprising the following steps:
[0012] (1) extracting Canna genomic DNA of a Canna population respectively;
[0013] (2) using the Canna genomic DNA obtained in step (1) as a template, performing duplex PCR amplification on the five groups of primer pairs respectively to obtain amplification products;
[0014] (3) performing electrophoresis and silver staining on the amplification products obtained in step (2) using a polyacrylamide gel;
[0015] (4) analyzing the silver staining result of step (3) through genetic analysis software, measuring the genetic distance between each individual, drawing a UPGMA cluster analysis diagram according to the genetic distance, and identifying and distinguishing the genetic relationship of the Canna population according to the cluster result.
[0016] In some embodiments, the reaction system of the duplex PCR amplification in step (2) is 25 μL: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL of each of the upper and lower primers of the two primer pairs, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 11.5 μL of ultrapure water.
[0017] In some embodiments, the reaction procedure of the double-PCR amplification in step (2) is as follows: pre-denaturation at 94 DEG C for 3 minutes; then 35 cycles of denaturation at 94 DEG C for 30 seconds, annealing at 56 DEG C for 30 seconds, and extension at 72 DEG C for 45 seconds; and finally extension at 72 DEG C for 10 minutes and preservation at 4 DEG C.
[0018] In some embodiments, the amplification product in step (3) is subjected to electrophoresis and silver staining using 12-15 wt% polyacrylamide gel.
[0019] In some embodiments, the amplification product in step (3) is subjected to electrophoresis and silver staining using 12 wt% polyacrylamide gel.
[0020] In some embodiments, the genetic analysis software in step (4) is MEGA software.
[0021] The present application provides a wetland ecological restoration method, and the planting scale of canna is increased to 30-40% of the total area of the wetland.
[0022] The canna is a canna population with high water purification efficiency or a canna population closely related to the canna population with high water purification efficiency; the genetic relationship is identified by the primers of the above-mentioned canna polymorphic microsatellite molecular marker or by the above-mentioned method.
[0023] In some embodiments, the specific screening method of the canna population closely related to the canna population with high water purification efficiency is as follows: the primers provided by the present application are used to analyze the genetic relationship of the canna population with high water purification efficiency and the canna population to be identified, and the canna population closely related to the canna population with high water purification efficiency is screened for planting, so as to improve the wetland ecological restoration efficiency.
[0024] The present application can quickly evaluate the genetic relationship of canna. The double-PCR system of the present method is used for canna genetic relationship analysis, and the system can greatly save drugs and time by about 50% compared with the traditional microsatellite analysis species genetic relationship PCR system. The present application first proposes a canna genetic relationship evaluation method, which provides technical support for relationship analysis between different regions and canna populations; and is helpful for quickly and accurately identifying the genetic relationship of different canna populations. The present application can quickly identify the genetic relationship of canna, and then judge the growth status of canna, and quickly find a canna population closely related to a known canna population with good water purification effect. The present application has high practicability and great popularization and utilization value.
[0025] The present application has the following beneficial effects:
[0026] The primer of the canna polymorphic microsatellite molecular marker can identify the canna population relationship, and is used for screening the canna population with close genetic relationship with the canna population with high known water purification efficiency.
[0027] The wetland ecological restoration method can improve the wetland ecological restoration efficiency. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 The numbers 1-24 in the canna UPGMA cluster analysis diagram in Example 2 correspond to the 1-24 samples in Example 2. DETAILED DESCRIPTION
[0029] The application will be further described below in combination with examples.
[0030] The concept, specific scheme and generated technical effects of the application will be described clearly and completely in combination with examples, so as to fully understand the purpose, features and effects of the application. Obviously, the described examples are only a part of the examples of the application, but not all the examples. Based on the examples of the application, other examples obtained by those skilled in the art without creative labor are within the protection scope of the application. Each technical feature in the application can be combined with each other on the premise of no contradiction and conflict.
[0031] Example 1
[0032] Influence of canna planting area on wetland ecological restoration
[0033] Six wetland areas with equal area are selected, and the wetland greening area is 80%. The green plants are randomly replaced by canna (canna is randomly selected), and the area of canna accounts for 10%, 20%, 30%, 40%, 50% and 60% of the total area respectively. After planting for three months, the water quality of each wetland area is measured. The specific data are shown in Table 1.
[0034] Table 1:
[0035]
[0036]
[0037] Through the experiment of different planting areas of canna, it is concluded that the optimal planting area of canna is 30-40%, and the ecological restoration effect is the best.
[0038] Example 2
[0039] Screening of canna population with high water purification efficiency:
[0040] (1) Selection of canna population with high water purification efficiency.
[0041] Selection of Canna indica samples:
[0042] Select the group of Canna indica mature individuals with longer body length, lush growth, and faster growth as the basic group (this group is assumed to be a Canna indica group with high water purification efficiency), select Canna indica seedlings from different wetlands as the to-be-identified Canna indica group, and detect the direct genetic relationship between the to-be-identified Canna indica group and the basic group.
[0043] (2) Extraction of Canna indica genomic DNA:
[0044] Select the group of Canna indica mature individuals with longer body length, lush growth, and faster growth as the basic group 6 Canna indica (sample marked as 1-6), randomly select 6 Canna indica in Huizhou wetland water (sample marked as 7-12), randomly select 6 Canna indica in Dongguan wetland water (sample marked as 13-18), and randomly select 6 Canna indica in Shantou wetland water (sample marked as 19-24).
[0045] Extraction of Canna indica genomic DNA uses Tiangen new plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd., Beijing), and the specific operation process is as follows:
[0046] 2.1. Use tweezers to take about 100 mg of plant dry weight tissue of 1-24 Canna indica samples obtained in step (1) into a 2 mL centrifuge tube (to avoid cross contamination, the tweezers for taking plant tissue each time need to be burned on an alcohol lamp), add two quartz sands, and place on a shaker for crushing treatment. One minute forward and reverse to make the plant tissue into powder, after centrifugation for 30 s, add 500 μL of buffer LP1 and 6 uRNase A (10 mg / mL), vortex for 1 min (check whether it is wall-hung, if it is wall-hung, add 100 uL of buffer LP1), after 65℃ dry bath oscillation for 10 min (300 rpm), place in an ice box for ice bath for 2 min.
[0047] 2.2. Add 150 μL of buffer LP2, vortex for 1 min to mix thoroughly, centrifuge at 12000 rpm for 5 min, and transfer the supernatant (take 150 μL each time, twice) to a new 2 mL centrifuge tube.
[0048] 2.3. Add 450 μL of buffer LP3 (1.5 times the volume of the supernatant), vortex for 15 s.
[0049] 2.4. Put the adsorption column CB3 into the collection tube, and pour the mixture obtained in 2.3 into the adsorption column CB3, centrifuge at 12000 rpm for 1 min, and keep the adsorption column CB3 in the collection tube.
[0050] 2.5. Add 600 μL of rinse solution PW to the remaining adsorption column CB3 in the collection tube of 2.4, centrifuge in a centrifuge at 12000 rpm for 1 min, and retain the adsorption column CB3 in the collection tube.
[0051] 2.6. Repeat the rinse solution PW rinse process of 2.5 (if the filter membrane of the adsorption column CB3 appears green, rinse once with 500 μL of anhydrous ethanol, and the rinse process is consistent with the rinse solution PW) until the filter membrane of the adsorption column CB3 appears colorless.
[0052] 2.7. After centrifuging the collection tube of 2.6 at 12000 rpm for 2 min, open the cover of the adsorption column CB3 and place it horizontally to dry, which can be directly placed at room temperature for 30 min or placed in a 32℃ oven for 10 min to completely dry the remaining rinse solution in the adsorption column CB3. (The filter membrane is slightly wrinkled, and the alcohol smell is almost not noticeable at close range.)
[0053] 2.8. Collect the canna genome DNA in the adsorption column CB3 into a centrifuge tube by elution buffer (TE) (ensure that its pH value is in the range of 7.0-8.5), and obtain 24 canna genome DNAs.
[0054] Before amplification, the 24 canna genome DNAs obtained above also need to be detected and stored by the following steps:
[0055] a. Detect whether the extraction is successful by 1% agarose gel electrophoresis, and determine the concentration by a micro spectrophotometer.
[0056] b. Dilute the canna genome DNA 5 times according to the experimental requirements as a working solution and place it in a 4℃ refrigerator for standby, and place the remaining mother liquor in a -20℃ refrigerator for long-term storage.
[0057] (3) Canna PCR product amplification reaction and electrophoresis detection:
[0058] 3.1 Acquisition of microsatellite primers
[0059] Use microsatellite search software to search for microsatellite fragments in the canna genome and the simplified genome obtained by the applicant's previous sequencing, select 500 microsatellite molecular marker sequences with more than 2 base pairs of repeating units from the fragments containing microsatellites, design microsatellite primers using Primer6 software and conventional design methods, a total of 500 pairs of primers, and send the primers to a primer company for synthesis.
[0060] 3.2 Screening of microsatellite primers
[0061] The 24 Canna genomic DNAs obtained in step 2.8 were randomly selected as templates to perform preliminary screening on the microsatellite primers synthesized in step 3.1, and the microsatellite marker sequences with good polymorphism, less deletion and stable amplified bands were selected;
[0062] The reaction system of PCR amplification was 25 μL: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL of each of the upstream and downstream primers, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template and 13.5 μL of ultrapure water.
[0063] The reaction procedure of PCR amplification was as follows: pre-denaturation at 94℃ for 3 minutes; then denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, extension at 72℃ for 45 seconds, for a total of 35 cycles; finally, extension at 72℃ for 10 minutes and preservation at 4℃.
[0064] 3.3 Detection of the universality of polymorphic site primers
[0065] Based on the microsatellite marker sequences with good polymorphism, less deletion and stable amplified bands selected in step 3.2, the 24 Canna genomic DNAs obtained in step 2.8 were subjected to PCR amplification again, and the microsatellite marker sequences were evaluated.
[0066] The reaction system of PCR amplification was 25 μL: 3 μL of 10×PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL of each of the upstream and downstream primers, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template and 13.5 μL of ultrapure water.
[0067] The reaction procedure of PCR amplification was as follows: pre-denaturation at 94℃ for 3 minutes; then denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, extension at 72℃ for 45 seconds, for a total of 35 cycles; finally, extension at 72℃ for 10 minutes and preservation at 4℃.
[0068] 3.4 Double PCR amplification
[0069] After amplification of the 24 Canna genomic DNAs based on step 3.3, the microsatellite molecular marker sequences with good polymorphism, less deletion and stable amplification bands are still able to be amplified for re-screening. The specific screening method is as follows: the microsatellite primer pairs screened based on step 3.3 are randomly combined into duplex PCR primer groups in pairs, and the 24 Canna genomic DNA samples are amplified using the duplex PCR amplification system to screen out 5 groups of duplex PCR systems which can stably amplify the microsatellite molecular marker sequences with good polymorphism, less deletion and stable amplification bands for 18 Canna genomic DNA samples. Finally, the primer of the microsatellite molecular marker sequence is selected as shown in Table 2.
[0070] Table 2:
[0071]
[0072]
[0073] Among them, primer pair MRJ1 is used in cooperation with primer pair MRJ2; primer pair MRJ3 is used in cooperation with primer pair MRJ4; primer MRJ5 is used in cooperation with primer pair MRJ6; primer pair MRJ7 is used in cooperation with primer pair MRJ8; and primer pair MRJ9 is used in cooperation with primer pair MRJ10.
[0074] The microsatellite molecular marker sequence (SEQ ID NO. 21) corresponding to primer pair MRJ1 is:
[0075] accagtcagtttaggttctgagactaacttgctggaactgatccattgatattggattgtcatgtggagaaacattctgcagagccttgcagtccttcagaagattttctgggagctgctaaaactactttggatcagtaaattgagaccTATATATATATATATATATAtgacatatataattaaggaatgaccaattcgtgctaacagtgaaatcttaaaacacttcccagtatgtagtggtgcatctgggaagtgttacatttccgtggaattatttataagttatctatgagaagaagttaatttggtgtcaacaa
[0076] The microsatellite molecular marker sequence (SEQ ID NO. 22) corresponding to primer pair MRJ2 is:
[0077] atagacaagaacatgtgtatttgtagatataaaaatatattaaaagatgatttaaattaatataactatatatatatgcacagaaggttaagctgtgtgtgggaaactagaaattctaaaataaattcttttgtattattattttttaaaAATAATAATAATAATaacatattaataacttaagttactagactcaatcttaataacatcttaatcctcgtttagaacattttatctgtaagagtgaaaaggcaaaattcccctcccctttttatatatttcaatatattcttttttaaaataaaattattttat
[0078] The microsatellite molecular marker sequence (SEQ ID NO. 23) corresponding to the primer pair MRJ3 is:
[0079] aatttcatggatagaaccagtgacggagccaaaaatcaaattgaggagggggggggggggcagactctcaaatcaatagatgatcaacgatattgtacttgtgaatcaattcaatttaaataacatcaacgtatatgatagttgatatatGAGAGAGAGAtgaacaaattaggaatttgggagaagggagtaatttcaaattttaggggggcaaaattctcattattgcatatataatgaaggaattttaaaattctaggggggcaatttcaaattttaagggagcaaaaacctcattactgaaggaatt
[0080] The microsatellite molecular marker sequence (SEQ ID NO. 24) corresponding to the primer pair MRJ4 is:
[0081] tagggtttaatgccttttatttgcaataattgatcattggcaatgtgttcggggttcggggtcctcggggtttgagggtttggggtttcaatggcaatttgagtttgtcagccaccgcggatttcttctacaagtcttgtggcgtttgctTCTCTCTCTCTCttggggtgcgggcttcatcttaactcggcgtatggtggacctttgatctttttctacgatccggtgcgaacaggtggcgtttatggtccttggagcagcggagttccaatggccgcaagagaggacaagagcgtggacttctacgcggtc
[0082] The microsatellite molecular marker sequence (SEQ ID NO. 25) corresponding to the primer pair MRJ5 is:
[0083] gtcttgctgcagaattcattgtggccgagatttcttccaatagggaaggggaaaacaaggacatctctccacctattttattggtagaaattctcctttggaattagctgtcctatgacaagtagagagctaaggacagaacaagagagaAGAGAGAGAGAGAGAGatagagaggaacggagaggccgggagacagatttgagaagataaaagcagaactcctataacaagacaactcatatttatacaatgttttctttgtttgaattgttcagtccttaatccccactaacccataattcgaacaagaataaag
[0084] The microsatellite molecular marker sequence (SEQ ID NO. 26) corresponding to the primer pair MRJ6 is:
[0085] tcaatagttaacatggattcctacaaacaggggcgaagcccgaaaattattttaggagaggcaaaatataaaatcgcatcttatgagggcaattacatggtaaaaatatatttttagagggggcaaatatagttaaatattaatgtatatTATATATATAgtaatatatatgtaatggggggaccaatgtgagggggggcaattgcccctcctgccaaaacattggctccgcccctgcctacaaatgattggtgcgaaaatcaattttttaattttcttttagaatttttatccaggtcaattacataaa
[0086] The microsatellite molecular marker sequence (SEQ ID NO. 27) corresponding to the primer pair MRJ7 is:
[0087] aatacggtgcgtatacggatatgactttggatccacaccgtatccacaccgcctatccgcgtctttgaattactattttccccatataagttattaatatatataagagctatatggtaattttatgtcaagatgaattttgaagtatatTATATATATAttttggatcaatgaattggtaatttattattatttttaattaaatatattattgtaatattttttattaaatacagtgcagatacatatgcggtgcggatatccgcatttgaagcaatgcaaatatggatatccatattcacatccgtag
[0088] The microsatellite molecular marker sequence (SEQ ID NO. 28) corresponding to the primer pair MRJ8 is:
[0089] cgtcaaaatcattatttgtggccaagcatgtggataaacatctgattgtgtgagaccaatcagcacattcatcatgcattaatagtgcttagcaatgaataatgaaatagtcacattgaaagcaatccaagatcgcaaggctataatggcCTCTC TCTCTccctctctcaattctcttatattggaggcagtttagccaaagaaaacataacaattaactgtctaactagttaaagcaagagggctgacagtaggcaattaaaaataaccaaaccaaagtgcacattttatccaatgttaacgaaca
[0090] The microsatellite marker sequence corresponding to primer pair MRJ9 (SEQ ID NO.29) is:
[0091] tcataagtggtaccaaaataccccttcttacaagatatcattgcatgtctactgataccatacatgtcattctcaagaatatcatccagtatgccaattaacttatcctggtcaatggaatcaaatgcctttagtacatctgcaacaacaATATA TATATttggctttcctgattgtctaatttttactttggaaagaaattggtggatcttttggtacacatcattgtaaccaaaaacagaagatcccaggagttctggcttctcaaccttcactcttctcaaaattgtatctagttcattcagaacag
[0092] The microsatellite marker sequence corresponding to primer pair MRJ10 (SEQ ID NO.30) is:
[0093] ctgcaaaataaataaagctaaaaatgccaccaaaaacccagccagttatttacatcacaatgtagtcaaccttgtaccttctccctacctttcatgttacacctagttaatttgcagtgctccaagcctccaactctcttttatattcaa ATATATATAT ttatttatttttctcattgtgctgttaatttcatatgaatatgaattatatttattgactaaacataactttatctaatattttatatttctttataaaaaaaattcatattattaatcaaatatgttatttttttattaaccattccaa
[0094] The reaction system of PCR amplification was 25 μL: 3 μL of 10x PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL of each of the upper and lower primers of two pairs of primers, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 11.5 μL of ultrapure water.
[0095] The reaction procedure of PCR amplification was as follows: pre-denaturation at 94°C for 3 min; then denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 45 s, for a total of 35 cycles; finally, extension at 72°C for 10 min, and preservation at 4°C.
[0096] 3.5 Detection and identification
[0097] The PCR products corresponding to the five groups of microsatellite primers screened in step 3.4 above were subjected to electrophoretic separation on a 12 wt% non-denaturing polyacrylamide gel, and then photographed after silver staining.
[0098] (4) Genetic structure analysis
[0099] The silver staining results of the double-PCR amplification obtained in step (3) were subjected to digital processing (PCR products were read using Gene Marker software), and a UPGMA clustering analysis diagram was constructed by MEGA software, and the results are as follows: Figure 1As shown, the 24 Canna are divided into three branches, wherein 1-6 are clustered together; 7-12 are clustered together; 13-18 and 19-24 are clustered together, and 19-24 are clustered together. The clustering analysis result is consistent with the sampling classification (1-6 are clustered together, which indicates that the 6 Canna of the base population with longer mature individual length, more vigorous growth and faster growth are closer in genetic relationship; 7-12 are clustered together, which indicates that the 6 Canna randomly selected from the wetland water area of Huizhou are closer in genetic relationship; 19-24 are clustered together, which indicates that the 6 Canna randomly selected from the wetland water area of Shantou are closer in genetic relationship; 13-18 and 19-24 are clustered together, which indicates that the 6 Canna randomly selected from the wetland water area of Dongguan are closer in genetic relationship, and the 6 Canna randomly selected from the wetland water area of Dongguan are closer in genetic relationship with the 6 Canna randomly selected from the wetland water area of Shantou; and the technology can accurately determine the genetic relationship of Canna. Therefore, the directional selection of Canna from the wetland water area of Huizhou as the standby Canna for wetland ecological restoration can effectively improve the efficiency of wetland ecological restoration.
[0100] It is illustrated that the 10 pairs of Canna microsatellite primers provided by the application can be used for evaluating the genetic relationship of Canna, and provide a new technical method and means for studying the genetic diversity and genetic relationship analysis of Canna.
[0101] Example 3
[0102] Verification of the influence of the planting area of Canna in different regions on wetland ecological restoration
[0103] (1) Six wetland areas with equal areas are selected, and the wetland greening area is 80%. The green plants are randomly replaced with Canna (the Canna is selected from the Canna in the wetland water area of Huizhou in Example 2), and the area of the Canna accounts for 10%, 20%, 30%, 40%, 50% and 60% of the total area, respectively. After three months of planting, the water quality of each wetland area is measured. The specific data are shown in Table 3.
[0104] Table 3:
[0105]
[0106]
[0107] Through the experiment of different planting areas of Canna, it is concluded that the most suitable planting area of Canna is 30-40%, and the ecological restoration effect is the best.
[0108] (2) Six wetland areas with equal areas are selected, and the wetland greening area is 80%. The green plants are randomly replaced with Canna (the Canna is selected from the Canna in the wetland water area of Dongguan in Example 2), and the area of the Canna accounts for 10%, 20%, 30%, 40%, 50% and 60% of the total area, respectively. After three months of planting, the water quality of each wetland area is measured. The specific data are shown in Table 4.
[0109] Table 4:
[0110]
[0111] Through the planting area experiment of different canna, it is concluded that the most suitable planting area of canna is 30-40% and the ecological restoration effect is the best.
[0112] (3) Six equal area wetlands were selected, and the wetland greening area was 80%. The green plants were randomly replaced with canna (canna selected from Shantou wetland water area canna of example 2), and the area of canna accounted for 10%, 20%, 30%, 40%, 50% and 60% of the total area respectively. The water quality of each wetland area was measured after three months of planting. The specific data is shown in Table 5.
[0113] Table 5:
[0114]
[0115] Through the planting area experiment of different canna, it is concluded that the most suitable planting area of canna is 30-40% and the ecological restoration effect is the best.
[0116] The above experiments verify that the ability and efficiency of the wetland restoration of the canna selected in the experiment in Huizhou wetland water area are indeed higher than those of Dongguan and Shantou wetland water area canna. Using the technology to screen canna groups with longer individual body length, lush growth and faster growth can effectively improve the efficiency of wetland ecological restoration.
[0117] The above is a specific description of the preferred implementation of the present application, but the present application is not limited to the described embodiments. Those skilled in the art can make various equivalent modifications or replacements without deviating from the spirit of the present application, and these equivalent modifications or replacements are all included in the scope defined by the claims of the present application.
Claims
1. A primer for polymorphic microsatellite molecular markers of Canna indica, characterized in that: Includes the following 5 sets of primer pairs; Among them, primer pair MRJ1 is used in combination with primer pair MRJ2; primer pair MRJ3 is used in combination with primer pair MRJ4; primer pair MRJ5 is used in combination with primer pair MRJ6; primer pair MRJ7 is used in combination with primer pair MRJ8; primer pair MRJ9 is used in combination with primer pair MRJ10.
2. A kit for analyzing the genetic diversity of canna populations, characterized in that: The kit at least comprises the primers for the canna polymorphic microsatellite molecular marker according to claim 1.
3. Use of the primers for polymorphic microsatellite molecular markers of Canna according to claim 1 or the kit according to claim 2 in identifying the kinship of Canna populations.
4. A method for identifying the kinship of canna populations, characterized in that: The following steps are involved: (1) Extracting canna genomic DNA from canna populations; (2) using the canna genomic DNA obtained in step (1) as a template, performing duplex PCR amplification using the five primer pairs of claim 1 to obtain amplified products; (3) electrophoresis and silver staining of the amplified product obtained in step (2) using polyacrylamide gel; (4) The silver staining results of step (3) were analyzed using genetic analysis software to measure the genetic distance between each individual, and a UPGMA cluster analysis diagram was drawn based on the genetic distance. The kinship relationship of the canna population was identified and differentiated based on the clustering results.
5. The method according to claim 4, characterized in that The reaction system for duplex PCR amplification in step (2) is 25 μL: 3 μL of 10× PCR Buffer, 1 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL of each of the upstream and downstream primers of the two pairs of primers, 0.5 μL of 0.5 U / μL Taq enzyme, 2 μL of DNA template, and 11.5 μL of ultrapure water.
6. The method according to claim 4, characterized in that The reaction procedure for the double PCR amplification in step (2) is as follows: pre-denaturation at 94°C for 3 minutes; then denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 45 seconds, for a total of 35 cycles; finally extension at 72°C for 10 minutes, and storage at 4°C.
7. The method according to claim 4, characterized in that In step (3), the amplified product was electrophoresed using 12-15 wt% polyacrylamide gel and silver stained.
8. The method according to claim 7, characterized in that The amplified products in step (3) were electrophoresed using 12 wt% polyacrylamide gel and silver stained.
9. The method according to claim 4, characterized in that The genetic analysis software described in step (4) is MEGA software.
10. A wetland ecological restoration method, characterized in that: Increase the planting scale of canna to 30-40% of the total wetland area; The canna is a canna population with high water purification efficiency or a canna population that is closely related to the canna population with high water purification efficiency; the kinship is identified by using primers for canna polymorphic microsatellite molecular markers according to claim 1, or by using the method according to any one of claims 4 to 9.