Application of PDE4DIP as biomarker in preparation of reagent kit and medicine for adjuvant therapy of kidney podocyte injury and podocytosis

Abstract

According to the application of the PDE4DIP serving as the biomarker in preparation of the reagent kit for adjuvant therapy of the kidney podocyte injury and the podocytosis, the reagent kit comprises a reagent for detecting the PDE4DIP, and in a word, it is confirmed for the first time that the expression of the PDE4DIP can be reduced under the conditions of the kidney podocyte injury and the podocytosis; on one hand, the invention provides the application of the PDE4DIP transcription factor or the functional fragment thereof as a target spot for improving the renal podocyte injury and the podocytosis, and on the other hand, the invention provides the new application of the PDE4DIP as a biomarker (pathological diagnosis) in the diagnosis of the renal podocyte injury and the podocytosis renal injury. The invention solves the blank of no specific targeted treatment tool in the field of kidney diseases, discovers the new application of the PDE4DIP as a biomarker in the treatment of kidney podocyte injury and podocytosis, provides a specific verification method and experimental data, and has very positive significance.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of kidney diseases, and particularly relates to application of PDE4DIP as a biomarker in preparation of a kit and a medicine for assisting in treating kidney podocyte injury and podocyte diseases. BACKGROUND

[0002] Podocyte injury is common in most kidney diseases, and abnormal function of podocytes is a key factor for occurrence and development of many kidney diseases. Diseases with podocyte injury as a core pathological change are collectively referred to as podocyte diseases. Common clinical features mainly include edema, hypoproteinemia and massive proteinuria. These symptoms usually indicate that the glomerular filtration barrier function is severely damaged, and the disease is very serious. At present, the treatment of podocyte diseases mainly depends on glucocorticoids, immunosuppressants and supportive treatment. However, these means do not have specific targeted treatment programs, and the lack of specific targeted treatment programs makes the treatment of podocyte diseases face great challenges. Therefore, developing early diagnosis, targeted treatment and prognosis evaluation methods for podocyte injury and podocyte diseases has become a hot and difficult point in the research of kidney diseases, and has a very positive significance for the research of kidney diseases.

[0003] Meanwhile, PDE4DIP (phosphodiesterase 4D interacting protein) is an anchor protein that plays a key role in cell signal transduction and disease occurrence. By regulating the two core signal pathways of cAMP-PKA and RAS-ERK, it affects cell proliferation, apoptosis and angiogenesis. Its therapeutic effect in KRAS mutant colorectal cancer and lung cancer has been proved. Targeting PDE4DIP has the functions of reversing drug resistance and inhibiting tumor growth. It is also a new biomarker for cardiovascular diseases, mainly used for rapid detection of acute myocardial infarction (AMI) and pathogenesis of Budd-Chiari syndrome (BCS). However, there is no corresponding research achievement in kidney diseases, and no research proves that PDE4DIP is used for diagnosis and treatment of kidney podocyte injury and podocyte diseases.

[0004] Therefore, it is urgent to use PDE4DIP as a biomarker in preparation of a kit and a medicine for assisting in treating kidney podocyte injury and podocyte diseases to solve the above problems. SUMMARY

[0005] Therefore, the application of PDE4DIP as a biomarker in preparation of a kit and a medicine for assisting in treating kidney podocyte injury and podocyte diseases is proposed, so as to solve the technical problem that there is no practical application of PDE4DIP as a biomarker in kidney podocyte injury and podocyte diseases at present.

[0006] In order to achieve the above technical purposes, the specific technical scheme adopted by the application is that: Use of PDE4DIP as a biomarker in the manufacture of a kit for aiding the treatment of kidney podocyte injury and podocytopathy, the kit comprising reagents for detecting PDE4DIP.

[0007] Further, the kit is manufactured using a tool for detecting the level of PDE4DIP biomarker for detecting the level of PDE4DIP biomarker.

[0008] Further, the tool for detecting the level of PDE4DIP biomarker uses one or more of nucleotides, antibodies and functional fragments thereof, ligands, test strips, chips, plates, membranes, nanoparticles, and sequencing libraries.

[0009] Further, the reagent detects the mRNA level by any one of polymerase chain reaction methods, nuclease protection analysis methods, in situ hybridization methods, nucleic acid microarray methods, and Northern blot methods, and the polymerase chain reaction methods use one or more of real-time fluorescent quantitative reverse transcription polymerase chain reaction methods, reverse transcription polymerase chain reaction methods, and competitive polymerase chain reaction methods.

[0010] Further, the reagent detects the protein level by any one of immunoblotting, enzyme-linked immunosorbent assay, radioimmunoassay, radioimmunodiffusion method, immunoelectrophoresis, tissue immunostaining, immunoprecipitation analysis method, complement fixation analysis method, fluorescence-activated cell sorting, mass analysis method, or protein microarray method.

[0011] Use of PDE4DIP as a biomarker in the manufacture of a drug for aiding the treatment of kidney podocyte injury and podocytopathy.

[0012] Further, PDE4DIP is used as a target in a drug that can increase the expression of PDE4DIP.

[0013] Further, the drug is one of an antibody or antigen-binding fragment thereof of PDE4DIP, and the drug can be used by injection or orally.

[0014] The present application finds that PDE4DIP is mainly highly expressed in kidney podocytes, and is related to the formation and maintenance of podocyte cytoskeleton normal physiological function, and under the conditions of kidney podocyte injury and podocytopathy, the expression of PDE4DIP in podocytes is significantly reduced, which is an important marker of podocyte injury and podocytopathy progression, and can be used as a pathological diagnostic marker of kidney podocyte injury and podocytopathy. The degree of reduction of PDE4DIP gene and protein level in the test sample is positively correlated with the degree of podocyte injury and glomerular sclerosis, and negatively correlated with the glomerular filtration rate. The present application can detect the content of PDE4DIP marker through the kit, and provide data support for the progression of podocyte injury and podocytopathy by detecting the content of PDE4DIP marker.

[0015] In addition, PDE4DIP can also be used as a risk assessment marker for kidney podocyte injury and podocytopathy, and the risk of kidney injury can be assessed according to the level of PDE4DIP in the test sample. PDE4DIP can also be used as a prognostic marker for kidney injury, and the prognosis of kidney podocyte injury and podocytopathy can be analyzed according to the level of PDE4DIP in the test sample.

[0016] PDE4DIP can also be used as a recurrence monitoring or efficacy evaluation marker for kidney podocyte injury and podocytopathy, and the recurrence and progression of kidney podocyte injury and podocytopathy can be evaluated according to the level of PDE4DIP in the test sample. The increase of PDE4DIP level in the test sample after treatment indicates the success of treatment, while the decrease of PDE4DIP level increases the probability of recurrence of kidney podocyte injury and podocytopathy. The present application provides data support for the recurrence of kidney podocyte injury and podocytopathy by detecting the level of PDE4DIP.

[0017] By adopting the above technical solution, the present application can also bring the following beneficial effects: 1. The PDE4DIP mentioned in the present application as a biomarker in the preparation of a kit for assisting the treatment of kidney podocyte injury and podocytopathy, by the principle that PDE4DIP is mainly significantly expressed in kidney podocytes, PDE4DIP is involved in the formation of podocyte cytoskeleton and maintains normal physiological function, and under the conditions of podocyte injury and podocytopathy, the expression of PDE4DIP in kidney podocytes is significantly decreased, PDE4DIP is an important marker and therapeutic target for podocyte injury and podocytopathy, so that the detection of PDE4DIP level by the kit can reflect the actual situation of podocyte injury and podocytopathy, and the present application provides a new solution for the prevention, treatment and monitoring of kidney podocyte injury and podocytopathy, and has a wide application prospect.

[0018] 2, The application of the PDE4DIP as a biomarker in the preparation of a drug for the adjuvant treatment of kidney podocyte injury and podocytopathy, can provide support for the preparation of screening, prevention and / or treatment of kidney podocyte injury and podocytopathy drugs, PDE4DIP expression decreases is the characteristic of podocyte injury, and improving its expression is the key to treating kidney podocyte injury and podocytopathy, by increasing the expression of PDE4DIP in podocytes, not only can effectively stabilize the cytoskeleton of podocytes, but also can inhibit apoptosis, so as to fully illustrate that PDE4DIP can be used as a target to improve and treat kidney podocytopathy and podocyte injury. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0020] Figure 1 Figure for the expression of PDE4DIP in different cells of human and mouse kidney tissues in single nucleus transcriptome sequencing; Figure 2 Figure for the volcano plot of differential gene analysis of healthy and injured podocytes of human and mouse in single nucleus transcriptome sequencing; Figure 3 Figure for the expression of PDE4DIP in the surface of the wein chart of human and mouse injured podocytes in single nucleus transcriptome sequencing; Figure 4 Figure for the violin plot of the expression of PDE4DIP in the podocytes of five podocytopathy patients in single nucleus transcriptome sequencing; Figure 5 Figure for the violin plot of the expression of PDE4DIP in the podocytes of three podocytopathy mice in single nucleus transcriptome sequencing; Figure 6 Figure for the expression of PDE4DIP in the kidney puncture sample of the patient with kidney podocyte injury and podocytopathy; Figure 7 Figure for the western blot result change of PDE4DIP in podocytes induced by doxorubicin, angiotensin II and lipopolysaccharide in vitro respectively; Figure 8 Figure for the real-time quantitative PCR result of podocytes induced by doxorubicin, angiotensin II and lipopolysaccharide; Figure 9The flow cytometry apoptosis staining results of the podocytes obtained after treating the damaged podocytes using the PDE4DIP transcription factor are shown in the following figure, compared with the untreated group; Figure 10 The quantitative column chart of the flow cytometry apoptosis staining results of the podocytes obtained after treating the damaged podocytes using the PDE4DIP transcription factor is shown in the following figure, compared with the untreated group. DETAILED DESCRIPTION

[0021] The embodiments of the present application will be described in detail below with reference to the drawings.

[0022] The above and other advantages and features of the present application will become apparent from the following description of the embodiments, taken in conjunction with the accompanying drawings, which are shown by way of illustration. Various changes from the embodiments described herein can be made by persons with ordinary skill in the art without departing from the spirit and technical scope of the application, the scope of which is defined by the appended claims. It is therefore intended that such changes be included within the technical scope of the application. In the following description, like reference numerals refer to like elements. The embodiments described below are merely the best mode for carrying out or applying the present application and should not be construed as limiting the present application.

[0023] In order to make the objectives, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions of the embodiments of the present application will be described clearly and completely below. The specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturers. The reagents or instruments not mentioned by the manufacturers are all conventional products that can be purchased in the market.

[0024] In addition, in the following description, specific details are provided in order to facilitate a thorough understanding of the examples. However, one skilled in the art will understand that the described aspects can be practiced without these specific details.

[0025] The features and performances of the present application are further described below in combination with the embodiments.

[0026] In order to achieve the above technical purpose, the specific technical scheme adopted by the present application is as follows: Application of PDE4DIP as a biomarker in the preparation of a kit for diagnosing and treating podocyte injury and podocytopathy.

[0027] The PDE4DIP can serve as a biomarker to provide data support for the development of an auxiliary diagnostic product, a diagnostic product, a risk warning product, a prognosis evaluation product, a relapse monitoring product, and an efficacy evaluation product.

[0028] The tool for detecting the level of the PDE4DIP biomarker includes one or more of nucleotides, antibodies and functional fragments thereof, ligands, test strips, chips, plates, membranes, nanoparticles, and sequencing libraries.

[0029] The nucleotides include a primer pair, a probe, or an antisense nucleotide that specifically binds to the gene of the biomarker, the primer refers to a short nucleic acid sequence having a short free 3-hydroxyl nucleic acid sequence, which can form base pairs with a complementary template, and serves as a starting point for template strand replication. The primer can induce DNA synthesis in the presence of reagents for polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and different 4 nucleoside triphosphates under appropriate buffer and temperature, the probe refers to a nucleic acid fragment of several bases to several hundred bases that can specifically bind to mRNA, such as RNA or DNA, etc. Due to being labeled, it can be confirmed whether a specific mRNA exists. The probe can be manufactured in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, etc. In the present application, a probe complementary to the coding gene of the Asprosin protein can be hybridized, and the expression level of the above gene can be diagnosed by whether hybridization occurs.

[0030] The primer or probe of the present application can be chemically synthesized using a phosphoramidite solid support method or other well-known methods. Such nucleic acid sequences can be modified using various means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modification between nucleotides, such as modification to uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoramidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.).

[0031] The antisense nucleotide in the present application includes antisense DNA and antisense RNA, wherein the antisense RNA refers to an RNA molecule having a complementary sequence to a target RNA, the antibody and functional fragment thereof include an antibody or functional fragment thereof that cannot specifically bind to Asprosin, the chip includes a gene chip and a microfluidic chip, the plate includes a glass plate, the membrane includes a nitrocellulose membrane and an acetic acid cellulose membrane, and the nanoparticles include magnetic beads, organic nanoparticles, quantum dot nanoparticles, rare earth complex nanoparticles, and isotope nanoparticles.

[0032] The reagents can be in the form of a liquid, a solid or a semi-solid. The reagents can be further selected from a lyophilized powder. The kit can comprise one or more of a pre-coated plate, a standard, a coating buffer, a sample diluent, a blocking solution, a horseradish peroxidase, an elution buffer and a chromogenic reagent.

[0033] The reagents can be used to detect the mRNA level by any one of a polymerase chain reaction method, a nuclease protection assay method, an in situ hybridization method, a nucleic acid microarray method, a Northern blot method. The polymerase chain reaction method can be one or more of a real-time fluorescent quantitative reverse transcription polymerase chain reaction method, a reverse transcription polymerase chain reaction method and a competitive polymerase chain reaction method.

[0034] The reagents can be used to detect the protein level by any one of an immunoblotting, an enzyme-linked immunosorbent assay, a radioimmunoassay, a radioimmunodiffusion method, an immunoelectrophoresis, a tissue immunostaining, an immunoprecipitation assay, a complement fixation assay, a fluorescence-activated cell sorting, a mass analysis method or a protein microarray method.

[0035] The kit can be used to detect the PDE4DIP biomarker level in a subject kidney tissue, serum, blood or urine sample. The subject kidney tissue sample can be a kidney biopsy sample, an open kidney tissue biopsy sample or a transvenous kidney tissue biopsy sample. The kidney podocyte injury can be a primary or secondary kidney podocyte injury and a kidney podocyte injury caused by a genetic, immune, infectious or metabolic abnormality. The in vivo and in vitro kidney podocyte injury model can be a podocyte injury caused by an adriamycin, an angiotensin II or a lipopolysaccharide.

[0036] The PDE4DIP can be used as a target to prepare a drug for screening, preventing and / or treating a kidney podocyte injury and a podocytopathy. The drug can increase the expression of the PDE4DIP. The drug can be a transcription factor of the PDE4DIP or a functional fragment thereof. The functional fragment can include a transcription factor binding domain, an activation domain or an inhibition domain. The transcription factor can bind to a promoter region of the PDE4DIP to regulate the transcriptional expression of the PDE4DIP. The drug can be one of an antibody of the PDE4DIP or an antigen binding fragment thereof. The drug can be used by any one of injection or oral administration. The drug can also be used by adding to a podocyte culture medium of a human in vitro culture.

[0037] The PDE4DIP drug can be used in the following applications in practical use: (1) reducing the fusion or disappearance of the podocyte foot process; (2) reducing the apoptosis of the podocyte; (3) reducing the glomerular sclerosis phenomenon; (4) reducing the protein level in the urine; (5) reducing the serum or urine creatinine content; (6) reducing the blood urea nitrogen content in serum or urine.

[0038] Podocyte refers to elongated protrusions of podocytes that cover the basement membrane of the renal tubule and form a tight connection with other parts of the basement membrane.

[0039] The specific implementation is as follows: Example 1: This example demonstrates that PDE4DIP is mainly expressed in kidney podocytes, and the expression decreases under the conditions of kidney podocyte injury and podocytopathy, thereby providing a theoretical basis for the preparation of the kit.

[0040] Kidney biopsy samples of patients with clinical kidney podocyte injury and podocytopathy (the samples are derived from the affiliated shao yifu hospital of zhejiang university medical college, ethical approval number: 20220606-016), and kidney cortex of podocytopathy mice and healthy mice are collected, and the expression of PDE4DIP is detected by single nucleus transcriptome sequencing technology: The single nucleus sequencing specifically includes the following steps: (1) Collecting mouse and human kidney tissues, preparing them into single nucleus suspension, the specific steps include using tissue homogenization, filtration and nuclear extraction method; (2) Using commercial 10X Genomics sequencing platform for single nucleus sequencing (snRNA-seq) of the sample to obtain high-throughput transcriptome data; (3) The raw data obtained by sequencing is subjected to quality control and removal of low-quality nuclei, and preliminary data processing is performed, including filtering, removing double nuclei and batch effect correction; (4) The processed single nucleus data is analyzed by using Seurat package in R language.

[0041] Figure 1 It is shown that PDE4DIP is mainly expressed in podocytes, Figure 2 and Figure 3 It is shown that the expression of PD4E4DIP in podocytopathy patients and mice is significantly down-regulated, Figure 4 The five kinds of podocytopathy in the above-mentioned five kinds of podocytopathy include diabetic nephropathy, focal segmental glomerulosclerosis, minimal change nephropathy, membranous nephropathy and obesity nephropathy, which shows that the expression of PDE4DIP in the podocytes of the five kinds of podocytopathy patients is significantly reduced, Figure 5 The three kinds of podocytopathy in the above-mentioned three kinds of podocytopathy include adriamycin nephropathy, diabetic nephropathy and obesity nephropathy, which shows that the expression of PDE4DIP in the podocytes of the three kinds of podocytopathy mice is significantly reduced, and the above-mentioned shows that in the kidney tissues of humans and mice, PDE4DIP is mainly expressed in podocytes, and the expression of PDE4DIP in the podocytes of podocyte injury and podocytopathy patients and mice is significantly decreased.

[0042] Example 2: This example demonstrates that PDE4DIP expression is decreased in podocytes of patients with renal podocyte injury and podocytopathy.

[0043] Paraffin-embedded kidney tissues of patients with clinical renal podocyte injury and podocytopathy were collected (samples from the affiliated shao yifu hospital of zhejiang university medical college, ethical approval number: 20220606-016), and the expression of PDE4DIP was detected by multiplex immunofluorescence, respectively. The method of multiplex immunofluorescence detection is as follows: (1) Use a microtome to prepare paraffin-embedded kidney tissues into 4um thick sections, and carry out) deparaffinization and hydration, washing; (2) Antigen repair: Put the section into the pre-prepared antigen repair solution, the commonly used repair solution is 0.1 mM sodium citrate buffer. Use the microwave oven to heat to boiling, and put the section into it, heat for 1-2 minutes at high fire, heat for 3 minutes at medium fire, cool to room temperature, and wash the section with PBS buffer for 3 times, 3 minutes each time.

[0044] (3) Block endogenous fluorescence: In order to avoid the interference of endogenous fluorescence on the experimental results, appropriate blocking agent (such as 5% BSA) can be used for blocking, covering on the surface of the section, incubating at room temperature for 20 minutes. Wash the section with PBS buffer for 3 times, 5 minutes each time, to ensure thorough washing.

[0045] (4) Blocking: Use 5% BSA for blocking, incubate at room temperature for 1 hour to prevent non-specific binding.

[0046] (5) Incubation of primary antibody: Select appropriate multiplex primary antibody according to needs, ensure that each antibody has different fluorescent label. Add 50-100 microliters of primary antibody working solution on the section, incubate at room temperature for 1 hour. After completion of incubation, wash the section with PBS buffer for 3 times, 3 minutes each time, gently shake off the excess liquid, and avoid drying the section.

[0047] (6) Incubation of secondary antibody: Add appropriate secondary antibody working solution (for example, anti-mouse, anti-rabbit IgG antibody labeled with different fluorescent molecules) according to experimental needs. Add 50 microliters of secondary antibody working solution on the section, incubate at room temperature for 30 minutes. After completion of incubation, wash the section with PBS buffer for 3 times, 3 minutes each time.

[0048] (7) Fluorescent color development: according to the fluorescent dye used, select appropriate fluorescent color developing agent for staining. Place the fluorescent labeled section under the fluorescence microscope for observation, to ensure that the staining effect is clear and visible.

[0049] (8) Nuclei counterstaining: Counterstaining with nuclear dyes such as DAPI or Hoechst, incubate at room temperature for 2-5 minutes. Wash the sections 3 times for 3 minutes each to ensure clear visualization of the nuclei.

[0050] (9) Mounting and observation: After dehydrating the sections with graded alcohol and clearing with xylene, mount the sections with appropriate fluorescent mounting medium. After ensuring the sections are completely dry, observe the fluorescent staining results under a fluorescent microscope and take images.

[0051] Figure 6 The results show that PDE4DIP expression is localized in kidney podocytes in human kidney tissues, and is decreased in the kidneys of four representative patients with podocyte injury and podocytopathy, providing support for the preparation of drugs to assist in the treatment of kidney podocyte injury and podocytopathy.

[0052] Example 3: This example demonstrates that PDE4DIP expression is decreased in an in vitro podocyte injury model.

[0053] Podocyte injury induced by doxorubicin, angiotensin II and lipopolysaccharide is the most typical in vitro model of podocytopathy. According to this embodiment, human podocytes (from Wuhan Ponsay Biotechnology Co., Ltd.) are cultured and doxorubicin (10 μM per mL of culture medium), angiotensin II (1 μM) or lipopolysaccharide (LPS, 1 μg / mL) is added, respectively. After these treatments, the degree of podocyte injury and the change in PDE4DIP expression are observed and evaluated. At the appropriate time point after injury, the expression level of PDE4DIP is detected by Western blot, real-time quantitative PCR and other methods.

[0054] The specific steps of Western blot are as follows: (1) Lysing the cells using RIPA buffer containing 1x protease inhibitor and 1x phosphatase inhibitor; (2) Then centrifuge the samples at 5000 rpm for 30 minutes; (3) Measure the protein concentration using the BCA Protein Assay Kit; (4) Equivalent samples are used for PDE4DIP (1:500), then HRP-labeled secondary antibody (1:5000) is added; (5) The immunoreactive bands are visualized by the Amersham Biosciences ECL detection system.

[0055] (6) Perform densitometric analysis by measuring the intensity of the bands and normalize them to the corresponding β-actin bands using Quantity One software.

[0056] The specific steps of real-time quantitative PCR are as follows: (1) Total RNA is extracted from cells using RNA isoPlus reagent; (2) Reverse transcription of cDNA is performed using PrimeScriptTM RT Master Mix; (3) Real-time PCR is performed by SYBR Green PCR Master Mix and ABI 7-time PCR detection system; Wherein, the temperature cycle condition is 10 min at 95℃, 15 s at 95℃, and 1 min at 60℃; Wherein, the relative expression level of mRNA is standardized relative to β-actin, and the 2-ΔΔCT method is used for calculation; (4) The required primers are designed and synthesized by Shenguo Bioengineering Co., Ltd., and the primer sequences are shown in Table 1 as follows: Table 1. Primer sequences used in the study Primer Sequence Human GAPDH forward primer GGAGTCCACTGGCGTCTTCA Human GAPDH reverse primer GTCATGAGTCCTTCCACGATACC Human PDE4DIP forward primer GAGAACTCCAGGACAAGAAACAGCAT Human PDE4DIP reverse primer GGATTCCTCCTGCAGAAGCTGG The statistical analysis includes the following: (1) All quantitative values are expressed as mean ± standard error of the mean (SEM); (2) Statistical differences between two groups are analyzed by two-tailed Student's t-test using GraphPad Prism; (3) One-way ANOVA is used for comparison between multiple groups; P<0.05 is considered statistically different.

[0057] As shown in Figure 7 and Figure 8 , Western blot and real-time quantitative PCR results show that the protein and mRNA levels of PDE4DIP in podocytes are significantly decreased after adriamycin, angiotensin II and lipopolysaccharide cause podocyte injury, which provides support for the preparation of drugs for the auxiliary treatment of kidney podocyte injury and podocytopathy.

[0058] Example 4: This example demonstrates that increasing the expression of PDE4DIP can inhibit podocyte injury.

[0059] Based on the condition of podocyte injury, human podocytes are inoculated in culture bottles and cultured to an appropriate density. According to experimental requirements, PDE4DIP transcription factors are introduced into podocytes by lentiviral transfection, and flow cytometry is used to detect the apoptosis of podocytes.

[0060] The specific steps of flow cytometry are as follows: (1) Cell collection: After 24h treatment, collect cells and centrifuge (1000 rpm, 5 min) to remove culture medium. Wash cells with PBS twice to remove residual culture medium and drugs.

[0061] (2) Cell fixation: Fix cells with 70% ice-cold ethanol and incubate at room temperature for 30 min. Ethanol fixation can stabilize the cell membrane, facilitating subsequent staining operations.

[0062] (3) Staining: After fixation, wash cells with PBS three times for 3 min each time to remove excess ethanol. According to the experimental purpose of flow cytometry, use Annexin V-FITC dye labeling to label apoptotic and necrotic cells. Resuspend cells in buffer containing Annexin V-FITC (1:50) and incubate at room temperature for 10-15 min in the dark.

[0063] (4) Data collection: Collect data on a flow cytometer, select appropriate channels to analyze Annexin V-FITC staining results, and collect at least 10,000 cell events for quantitative analysis of apoptosis rate.

[0064] (5) Result analysis: Use flow cytometry data analysis software (FlowJo) to analyze data and calculate the apoptosis rate of each group of cells. According to different treatment groups, evaluate the improvement of PDE4DIP expression on the improvement of podocyte damage.

[0065] As shown in Figure 9 and Figure 10 , flow cytometry results show that after inducing podocyte damage, the apoptosis of podocytes significantly increases, and using PDE4DIP transcription factor to increase the expression of PDE4DIP can significantly reduce the apoptosis of podocytes. In summary, PDE4DIP can be used as a biomarker in the preparation of drugs for the adjuvant treatment of kidney podocyte damage and podocytopathy.

[0066] The present application first confirms that PDE4DIP can decrease expression under the condition of kidney podocyte damage and podocytopathy (genetic, immune, metabolic, hypoxia), on the one hand, provides PDE4DIP transcription factor or its functional fragment or as a target for improving kidney podocyte damage and podocytopathy, on the other hand, provides PDE4DIP as a biomarker (pathological diagnosis) for new application in kidney podocyte damage and podocytopathy kidney damage diagnosis, in summary, the present application solves the blank of no specific targeted treatment tool in the field of kidney disease, discovers the new application of PDE4DIP as a biomarker drug in the treatment of kidney podocyte damage and podocytopathy, and provides specific verification method and experimental data, which has very positive significance.

[0067] The above merely illustrates the specific embodiments of the present application, but the protection scope of the present application is not limited thereto, any person skilled in the art can easily think of the changes or replacements within the technical range disclosed by the present application, which should be covered in the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. Use of PDE4DIP as a biomarker in the preparation of a drug kit for adjuvant treatment of renal podocyte injury and podocyte disease, characterized in that: The kit comprises reagents for detecting PDE4DIP.

2. The use according to claim 1, characterized in that: The preparation kit is prepared using a tool for detecting the level of the PDE4DIP biomarker and is used for detecting the level of the PDE4DIP biomarker.

3. The use according to claim 2, characterized in that: The tool for detecting the level of the PDE4DIP biomarker uses one or more of nucleotides, antibodies and functional fragments thereof, ligands, test strips, chips, plates, membranes, nanoparticles and sequencing libraries.

4. The use according to claim 3, characterized in that: The reagent detects mRNA levels by any one of a polymerase chain reaction method, a nuclease protection analysis method, an in situ hybridization method, a nucleic acid microarray method, and a Northern blot method. The polymerase chain reaction method adopts one or more of a real-time fluorescence quantitative reverse transcription polymerase chain reaction method, a reverse transcription polymerase chain reaction method, and a competitive polymerase chain reaction method.

5. The use according to claim 4, characterized in that: The reagent is used to detect protein levels by any one of immunoblotting, enzyme-linked immunosorbent assay, radioimmunoassay, radioimmunodiffusion, immunoelectrophoresis, tissue immunostaining, immunoprecipitation analysis, complement fixation analysis, fluorescence-activated cell sorting, mass spectrometry or protein microarray.

6. Application of PDE4DIP as a biomarker in the preparation of drugs for the adjuvant treatment of renal podocyte injury and podocyte disease.

7. The use according to claim 6, characterized in that: The PDE4DIP is used as a target in a drug, and the drug can increase the expression of PDE4DIP.

8. The use according to claim 7, characterized in that: The drug is an antibody or antigen-binding fragment of PDE4DIP, and can be used by injection or oral administration.

Images