Application of SUDS3 gene as combined chemotherapy anti-tumor target

Abstract

The invention relates to the technical field of biology, and particularly discloses application of an SUDS3 gene as a combined chemotherapy anti-tumor target. According to the application, the anti-tumor activity of chemotherapeutic drugs (such as cis-platinum, gemcitabine, hydroxyurea and the like) is remarkably improved by specifically inhibiting the expression or function of SUDS3; the application also overcomes the acquired or inherent drug resistance of tumor cells to conventional chemotherapeutic drugs; the application also reduces the dosage of chemotherapeutic drugs, thereby reducing systemic toxicity.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to an application of SUDS3 gene as a combined chemotherapy anti-tumor target, more particularly to a combined treatment strategy for enhancing the anti-tumor effect of chemotherapy drugs by targeting SUDS3 gene and the application thereof in cancer treatment. BACKGROUND

[0002] Chemotherapy is one of the standard treatment options for many solid tumors at present, and plays an important role especially in patients with advanced or inoperable tumors. However, chemotherapy often faces various problems, such as primary and acquired drug resistance, greater toxic side effects on rapidly proliferating normal cells due to lack of targeting, and lack of mature transformation targets to help improve the effect of chemotherapy. In existing studies, HDAC inhibitors (such as Vorinostat and Panobinostat) have been confirmed to open chromatin structure and activate apoptosis signals, thereby enhancing the effect of chemotherapy drugs. In addition, activating the p53 pathway (such as MDM2 inhibitor Nutlin-3) can also improve the response to chemotherapy.

[0003] However, most HDAC inhibitors have a wide range of effects, affecting the acetylation state of the whole genome, which is easy to cause toxic side effects. Moreover, the sensitizing effect of HDACi on chemotherapy drugs varies significantly in different tumor types and cell lines. Some HDACi were terminated due to efficacy and tolerability problems after entering clinical trials. Drugs targeting the activation of p53 also have some defects. Due to the high mutation rate of p53 in many tumors (such as lung adenocarcinoma > 50%), the scope of application of this strategy is limited. Moreover, the downstream regulation of the p53 pathway is complex, and activation does not necessarily lead to tumor cell apoptosis. In addition, simply activating p53 cannot solve the problem of expression silencing caused by chromatin inhibition.

[0004] Although existing treatment methods (including chemotherapy, HDAC inhibitors, p53 activators, etc.) have improved the efficacy of some tumor patients to some extent, the following key problems have not been effectively solved: 1) lack of specific and low-toxicity combined chemotherapy sensitization targets: existing HDAC inhibitors have a wide range of targets and non-specific effects, which are easy to cause off-target effects and systemic toxic side effects, limiting their clinical use with chemotherapy drugs. 2) No synergistic mechanism has been established that can be widely used for various tumors: such as the p53 pathway activation strategy, which is only applicable to wild-type p53 tumors, and the anti-tumor effect after activation is unstable, limiting the clinical universality and treatment consistency. 3) Lack of "sensitization factors" targeting chromatin state regulation: the insensitivity of tumor cells to chemotherapy drugs is often associated with epigenetic characteristics such as chromatin closure and enhanced DNA repair, but there is currently no clinically available drug targeting the regulation of this mechanism to enhance the response to chemotherapy.

[0005] The SUDS3 gene concerned by the present application, as one of the subunits of the Sin3 / HDAC core complex, has long been considered as a "structural regulatory factor" for maintaining chromatin homeostasis. Recent studies have shown that it also plays a key role in DNA replication regulation and cell cycle maintenance, suggesting that it may have important value as a chemotherapy sensitivity regulation node. SUMMARY

[0006] The present application aims to overcome the deficiencies of the prior art and provide a combination therapy strategy taking SUDS3 as a joint chemotherapy target. This method significantly reduces the DNA replication rate and replication fork stability of tumor cells by down-regulating or functionally inhibiting SUDS3, thereby inducing stronger DNA damage response and replication stress accumulation under the action of chemotherapy drugs, and improving the sensitivity of tumor cells to commonly used chemotherapy drugs such as hydroxyurea, cisplatin, and gemcitabine. The present application also provides a construction method for knocking out or interfering with SUDS3, a verification method, and experimental examples of combined treatment with chemotherapy drugs, which prove that this technical strategy has wide applicability and excellent synergistic anti-tumor effect in multiple tumor types.

[0007] To achieve the above-mentioned object, the technical solution adopted by the present application is as follows:

[0008] The present application provides an application of a substance for inhibiting the expression of SUDS3 protein in the preparation of a product for improving the sensitivity of tumor treatment to chemotherapy drugs.

[0009] The present application first identifies SUDS3 protein as a specific anti-tumor target for joint chemotherapy; by inhibiting the expression or function of SUDS3, the DNA replication rate can be accelerated, the genomic instability can be improved, and the DNA damage response can be enhanced, thereby improving the sensitivity of tumors to chemotherapy drugs.

[0010] Specifically, the present application also verifies that SUDS3 inhibition can widely enhance the anti-tumor effect of various commonly used chemotherapy drugs (such as cisplatin, gemcitabine, hydroxyurea, etc.), making tumor cells more sensitive to low concentrations of chemotherapy drugs, and being suitable for various tumor types and different background cells.

[0011] As a preferred embodiment of the application described in the present application, the SUDS3 protein inhibitor includes shRNA.

[0012] The nucleotide sequence of the shRNA is shown in any one of SEQ ID NO: 1-3.

[0013] The present application also provides an application of a substance for knocking out SUDS3 gene in the preparation of a drug for improving the sensitivity of tumor treatment to chemotherapy drugs.

[0014] In the present application, it is found that knocking out SUDS3 can accelerate the DNA replication rate, and that complementing SUDS3 in the knockout cells can slow down the DNA replication rate. Further, SUDS3 knockout reduces the stability of replication forks, and SUDS3 knockout significantly slows down the replication rate under the condition of replication stress. Further, it is found that SUDS3 knockout combined with chemotherapy drug treatment of tumor cells activates the ATR-CHK1 signaling pathway, SUDS3 knockout causes tumor cells treated with chemotherapy drugs to produce more DNA damage and increase genomic instability, and it is further found that the expression level of SUDS3 affects the sensitivity of tumor cells to chemotherapy drugs (hydroxyurea, gemcitabine, cisplatin), and inhibiting the expression and function of SUDS3 can enhance the anti-tumor effect of chemotherapy drugs.

[0015] As a preferred embodiment of the application described in the application, the substance for knocking out the SUDS3 gene is a CRISPR gene editing system for knocking out the SUDS3 gene.

[0016] As a preferred embodiment of the application described in the application, the nucleotide sequence of the sgRNA in the CRISPR gene editing system for knocking out the SUDS3 gene is as shown in any one of SEQ ID NOs: 4-5.

[0017] SUDS3 of the present application can be used as a molecular target for combination chemotherapy against tumors. It has been proved by experiments that inhibiting the expression of SUDS3 by RNA interference, gene knockout, etc. can accelerate DNA replication, improve genomic instability and DNA damage response, thereby significantly enhancing the anti-tumor effect of first-line chemotherapy drugs such as gemcitabine, cisplatin, and hydroxyurea (HU).

[0018] Preferably, the delivery mode for inhibiting the function and expression of SUDS3 can be selected from various drug delivery systems such as AAV9, lipid nanoparticles (LNP), virus-like particles (VLP), etc.

[0019] As a preferred embodiment of the application described in the application, the chemotherapy drug includes at least one of gemcitabine, cisplatin, and hydroxyurea.

[0020] As a preferred embodiment of the application described in the application, the tumor includes at least one of colorectal cancer, breast cancer, and cervical cancer.

[0021] The technical solution of the present application is applicable to various solid tumors, including colorectal cancer, breast cancer, cervical cancer, etc., and is not dependent on the wild-type state of p53, is suitable for a wide range of people, and has good clinical universality and conversion prospects.

[0022] The application also provides a SUDS3 protein inhibitor, which comprises shRNA, sgRNA or a vector expressing shRNA or sgRNA.

[0023] The nucleotide sequence of the shRNA is shown in any one of SEQ ID NOs: 1-3.

[0024] The nucleotide sequence of the sgRNA is shown in any one of SEQ ID NOs: 4-5.

[0025] The SUDS3 inhibition of the application can be achieved in various forms such as RNA interference, small molecule inhibitors, antisense oligonucleotides, etc., which has good flexibility in drug design and is easy to integrate with existing chemotherapy regimens, facilitating clinical promotion and industrial transformation.

[0026] In some embodiments, the vector comprises AAV or VLP.

[0027] The application also provides a pharmaceutical composition comprising the above-mentioned SUDS3 protein inhibitor and a chemotherapeutic drug.

[0028] The application uses the above-mentioned SUDS3 protein inhibitor combined with a chemotherapeutic drug to better significantly enhance the anti-tumor effect of first-line chemotherapeutic drugs such as gemcitabine, cisplatin, hydroxyurea (HU), etc.

[0029] As a preferred embodiment of the pharmaceutical composition of the application, the chemotherapeutic drug comprises at least one of gemcitabine, cisplatin and hydroxyurea.

[0030] In some embodiments, the chemotherapeutic drug further comprises other common chemotherapeutic drugs in the art.

[0031] Compared with traditional broad-spectrum HDAC inhibitors, the application targets the core regulatory factor SUDS3 for more precise intervention with less off-target effects, thus having a higher safety margin for drug development.

[0032] The application also provides that the expression level of SUDS3 protein in tumor cells is significantly negatively correlated with the response to chemotherapeutic drugs, which can support the development and dynamic monitoring of precision treatment regimens and meet the clinical needs of future individualized medicine. The detection methods include: immunohistochemistry (IHC) for detecting SUDS3 protein level; RT-qPCR for detecting SUDS3 mRNA expression; and Western blot for quantifying protein expression changes. This scheme is suitable for patient typing, chemotherapeutic drug selection, efficacy prediction and follow-up monitoring.

[0033] Compared with the prior art, the application has the following beneficial effects:

[0034] The application provides an application of a SUDS3 gene as an anti-tumor target of combined chemotherapy. The application significantly improves the anti-tumor activity of a chemotherapy drug (such as cisplatin, gemcitabine, hydroxyurea, etc.) by specifically inhibiting the expression or function of SUDS3. The application also overcomes the acquired or inherent drug resistance of tumor cells to conventional chemotherapy drugs. The application also reduces the dosage of the chemotherapy drug, thereby reducing systemic toxicity. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 Figure for SUDS3 interference and gene knockout cell line construction and verification results Figure 1 A is the Western blot result showing the expression of SUDS3 protein in the SUDS3 knockdown cell line; Figure 1 B is the Western blot result showing the expression of SUDS3 protein in the SUDS3 knockout cell line;

[0036] Figure 2 Figure for the effect of SUDS3 knockout on DNA replication rate Figure 2 A is the Western blot result showing the expression of SUDS3 protein in the WT group and the SUDS3 KO group; Figure 2 B is the Western blot result showing the expression in the SUDS3 stable cell line; Figure 2 C is the DNA fiber assay result showing the difference in DNA replication rate between the WT group and the SUDS3 KO group (n>150, p<0.001); Figure 2 D is the DNA fiber assay result showing the difference in DNA replication rate between the SUDS3 stable cell line and the control group (n>150, p<0.001);

[0037] Figure 3 Figure for the effect of SUDS3 knockout on replication fork stability Figure 3 A is the DNA fiber assay result showing that after 4mM HU treatment, there is a significant difference in the IdU / CldU ratio between the WT group and the SUDS3 KO group (n>150, p<0.001); Figure 3 B is the DNA fiber assay result showing that when low concentration HU (50μM) is added, there is a significant difference in the IdU / CldU ratio between the WT group and the SUDS3 KO group (n>150, p<0.001);

[0038] Figure 4Figure 4. SUDS3 knockout combined with chemotherapy drug treatment increases DNA damage and causes genomic instability in tumor cells Figure 4 A. Western blot results showing significant differences in CHK1 phosphorylation levels between WT and SUDS3 KO groups, and between SUDS3 stable expression and control groups after 30 minutes and 1 hour of 2mM HU treatment (*, p<0.05; **, p<0.01; ***, p<0.001; n=3); Figure 4 B. Immunofluorescence staining results showing significant differences in γH2AX and p-RPA32 signal intensity between WT and SUDS3 KO groups, and between SUDS3 stable expression and control groups after 2 hours of 2mM HU treatment (*, p<0.05; ****, p<0.0001; n>100);

[0039] Figure 5 Figure 5. Effect of SUDS3 knockout combined with chemotherapy drug treatment on tumor cell proliferation Figure 5 A. CCK8 results showing significant differences in cell survival rates between WT and SUDS3 KO groups under different concentrations of hydroxyurea (HU) treatment (n=3); Figure 5 B. CCK8 results showing significant differences in cell survival rates between SUDS3 stable expression and control groups under different concentrations of hydroxyurea (HU) treatment (n=3); Figure 5 C. CCK8 results showing significant differences in cell survival rates between WT and SUDS3 KO groups under different concentrations of gemcitabine (Gemcitabine) treatment (n=3); Figure 5 D. CCK8 results showing significant differences in cell survival rates between SUDS3 stable expression and control groups under different concentrations of gemcitabine (Gemcitabine) treatment (n=3); Figure 5 E. CCK8 results showing significant differences in cell survival rates between WT and SUDS3 KO groups under different concentrations of cisplatin (Cisplatin) treatment (n=3); Figure 5 F. CCK8 results showing significant differences in cell survival rates between SUDS3 stable expression and control groups under different concentrations of cisplatin (Cisplatin) treatment (n=3). DETAILED DESCRIPTION

[0040] In order to better illustrate the purpose, technical scheme and advantages of the present application, the present application will be further described below in conjunction with the drawings and specific embodiments.

[0041] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are commercially available unless otherwise specified, and the components used in each parallel experiment are the same.

[0042] By inhibiting the expression or function of SUDS3, the present application can accelerate the DNA replication rate, increase the genomic instability, and further enhance the DNA damage response, thereby improving the sensitivity of tumors to chemotherapeutic drugs.

[0043] Example 1, SUDS3 interference and gene knockout cell line construction and verification

[0044] 1.1 SUDS3 interference cell line construction (KD):

[0045] 1) SUDS3-shRNA sequence information:

[0046] shSUDS3-1: GCAGTTGCAACAACTGCAAGA (SEQ ID NO: 1);

[0047] shSUDS3-2: GCTGAAAGAGAACCTGATTGC (SEQ ID NO: 2);

[0048] shSUDS3-3: GCGTCCTCACAACTCTTAATT (SEQ ID NO: 3);

[0049] Synthetic shRNA oligonucleotides were cloned into pLKO.1-Puro vectors to obtain pLKO.1-SUDS3-shRNA.

[0050] 2) Virus packaging:

[0051] pLKO.1-SUDS3-shRNA was co-transfected with packaging plasmids (psPAX2, pMD2.G) into 293T cells using PEI transfection reagent. The cell culture supernatant was collected 48 hours later, filtered with a 0.45 μm filter, and used to infect target cells, while adding poly cation (8 μg / mL Polybrene) to improve infection efficiency. After 48 hours of infection, puromycin (2 μg / mL) was used to screen stable integration cell lines.

[0052] 3) Verification:

[0053] Western blot detection of SUDS3 expression down-regulation efficiency Figure 1 A), it was found that shSUDS3-2 and shSUDS3-3 had better effects, with a knockdown efficiency of 80%, as shown in Figure 1 .

[0054] 1.2 SUDS3 gene knockout cell line construction (KO):

[0055] 1) sgRNA design and vector construction:

[0056] Select sgRNA sequences targeting SUDS3 exons using online CRISPR design tools such as CHOPCHOP:

[0057] sgSUDS3-1: TGGTATGTTATGGGAAAACC (SEQ ID NO: 4);

[0058] sgSUDS3-2: GAGGCGACATGAGTGCCGCG (SEQ ID NO: 5);

[0059] 2) RNP complex assembly:

[0060] Mix sgRNA and Cas9 protein at a 1.5:1 molar ratio (e.g., sgRNA 90 pmol + Cas9 60 pmol) in an RNase-free environment, incubate at room temperature for 20 minutes to form an RNP complex.

[0061] 3) Electroporation operation:

[0062] Digest HeLa cells, count, and then centrifuge to collect. Resuspend in the corresponding Lonza SE Buffer electroporation buffer, about 2 x 10 5 cells per transfection. Use the DG-130 program of LONZA 4D-Nucleofector for electroporation. Immediately after electroporation, add pre-warmed medium containing 50% FBS, and after half an hour, transfer the cells to pre-warmed medium containing 10% FBS for continued culture.

[0063] 4) Collect cells 72 hours after electroporation, extract cell proteins, and perform Western blot to detect SUDS3 protein expression Figure 1 -B), and it was found that the protein level of SUDS3 in cells into which sgSUDS3 was introduced was significantly reduced compared to the sgGFP group.

[0064] Example 2, Effect of SUDS3 knockout on DNA replication rate

[0065] 1. SUDS3 KO monoclonal screening:

[0066] Dilute the cells after electroporation and plate them into a 96-well plate, with a single cell per well. Supplement fresh medium every week, and when the clones grow to a detectable size, perform Western blot to confirm the absence of SUDS3 protein expression, and reserve the single clones confirmed to be completely KO for subsequent functional experiments Figure 2 -A).

[0067] 2. Construction of SUDS3 stable expression cell line:

[0068] 1) Construction of SUDS3 stable expression vector:

[0069] The full-length human SUDS3 cDNA sequence (NM_022491.3) was obtained from the NCBI database. The complete open reading frame (ORF) was amplified by PCR and cloned into the pLenti-Flag-HA-puro lentiviral expression vector. Sequencing confirmed the absence of mutations. An empty vector, pLenti-Flag-HA-MCS-puro, containing a multiple cloning site, was also constructed as a negative control.

[0070] 2) Lentiviral packaging and infection:

[0071] 293T cells were co-transfected with pLenti-Flag-HA-SUDS3 or pLenti-Flag-HA-MCS and packaging plasmids (psPAX2, pMD2.G) using PEI transfection reagent. Cell culture supernatants were collected for 48 hours, filtered through a 0.45 μm filter, and then infected with SUDS3 KO HeLa cells. 8 μg / mL Polybrene was added. Fresh medium was replaced 24 hours after infection, and 48 hours later, puromycin (2 μg / mL) was used to select for stably integrated cells.

[0072] 3) Stable expression verification:

[0073] Total cell protein was extracted and semi-dry transferred after SDS-PAGE electrophoresis. After blocking with 5% skim milk, the primary antibody was incubated: SUDS3 (1:500), α-tubulin (internal reference, 1:5000), overnight at 4 degrees. Excess primary antibody was washed away with TBST, and fluorescent secondary antibody was incubated for 1 hour at room temperature. Excess secondary antibody was washed away with TBST, and the membrane was scanned with Odyssey. The results showed that the band size of SUDS3 in the SUDS3 overexpression group was in line with expectations ( Figure 2 B).

[0074] 3. DNA fiber stretching (DNA fiber assay) to detect replication fork speed:

[0075] 1) Double pulse labeling:

[0076] The cells were cultured to 60-70% confluence, and 25 μM CldU was added and incubated for 20 min. After washing twice with PBS, 125 μM IdU was added and incubated for 20 min.

[0077] 2) DNA fiber stretching:

[0078] Collect 105 Cells were resuspended with 100 μΐ^ PBS, 2 μΐ^ cell suspension was dropped on one end of the glass slide and spread evenly, after slightly air-drying, 7 μΐ^ lysis solution (200 mM Tris-HCl pH 7.4, 50 mM EDTA, 0.5% SDS) was added, after two minutes, the glass slide was tilted to stretch the fiber, and then air-dried, and soaked in fixative (methanol:acetic acid = 3:1) for 15 minutes.

[0079] 3) Immunofluorescence detection:

[0080] 2.5M HC1 denatured DNA for 30 min, and neutralized with 0.1M Na2B4O7. After blocking with 5% BSA, anti-CldU (rat origin), anti-IdU (mouse origin) primary antibody and fluorescent secondary antibody were added respectively for incubation.

[0081] 4) Microscopy and measurement:

[0082] Fluorescence microscope was used to take images of DNA fiber, and ImageJ was used to measure the length of red and green double labeled segments, and calculate the replication fork elongation rate (kb / min).

[0083] The results showed that the average replication fork speed of WT group was 0.5784±0.1502 kb / min; the SUDS3-KO group was 1.069±0.2185 kb / min (increased by about 85%, p<0.001); the SUDS3-KO FH-MCS group was 1.179±0.3289 kb / min; the SUDS3-KO FH-SUDS3 group was 0.7924±0.2181 kb / min (decreased by about 33%, p<0.001) Figure 2 -C, Figure 2 -D). It showed that SUDS3 knockout could accelerate the DNA replication rate, and the complementation of SUDS3 in knockout cells could slow down the DNA replication rate (as Figure 2 ).

[0084] Example 3, Effect of SUDS3 knockout on replication fork stability

[0085] 1) SUDS3 knockout reduces the stability of replication fork:

[0086] Cells were cultured to 60-70% confluence, 25 μΜ CldU was first added for incubation for 30 min, washed twice with PBS, then 125 μΜ IdU was added for incubation for 30 min, and then 4 mM HU was added to treat the cells for 5 hours to block the replication fork, and the degradation of the replication fork was detected by DNA fiber assay. The results showed that the IdU / CldU ratio of the SUDS3 KO group was less than 1, which was significantly different from the WT group (p<0.001), indicating that the degradation rate of the replication fork was significantly faster Figure 3A).

[0087] 2) SUDS3 knockout leads to a significant slowdown of replication rate in the presence of replication stress:

[0088] Cells were cultured to 60-70% confluence, 25 mM CldU was added for 30 min, washed twice with PBS, then 50 mM HU and 125 mM IdU were added for 30 min, the change of replication rate in the presence of replication stress was detected by DNA fiber assay. The results showed that the IdU / CldU ratio of the SUDS3 KO group was less than 1, which was significantly different from the WT group (p < 0.001), indicating that the replication rate was significantly slowed down due to the instability of replication forks in the presence of replication stress Figure 3 B).

[0089] Example 4, SUDS3 knockout combined with chemotherapy drug treatment increases DNA damage and causes genomic instability in tumor cells

[0090] 1) SUDS3 knockout combined with chemotherapy drug treatment activates the ATR-CHK1 signaling pathway in tumor cells:

[0091] HeLa cells were cultured to 80% confluence, 2 mM HU was added for 2 hours, and the whole cell proteins of the WT group, SUDS3-KO group, and SUDS3 stable expression group were extracted for Western blot detection. The results showed that compared with the WT group, the CHK1 phosphorylation level of the SUDS3 KO group was significantly increased; compared with the control group, the CHK1 phosphorylation level of the SUDS3 stable expression group was significantly decreased, indicating that SUDS3 knockout can increase the activation level of the ATR-CHK1 signaling pathway Figure 4 A).

[0092] 2) SUDS3 knockout combined with chemotherapy drug treatment produces more DNA damage in tumor cells:

[0093] HeLa cells were seeded on cell slides and cultured to 60-70% confluence. After 2 mM HU treatment for 2 hours, immunofluorescence staining was performed. After fixation, permeabilization and blocking, the cells were incubated with γH2AX and p-RPA32 antibodies, and then incubated with corresponding fluorescent secondary antibodies. Finally, the cells were stained with Hoechst. The signal intensity of γH2AX (marker of DNA double-strand break) and p-RPA32 (marker of replication fork stalling) spots in the nucleus was observed under a fluorescence microscope and counted. The results showed that, compared with the WT group, the γH2AX and p-RPA32 signals in the SUDS3 KO group were significantly enhanced; compared with the control group, the γH2AX and p-RPA32 signals in the SUDS3 stable expression group were significantly down-regulated, indicating that SUDS3 knockout can cause more DNA damage to tumor cells treated with chemotherapeutic drugs, and enhance the genomic instability Figure 4 -B).

[0094] Example 5, Effect of SUDS3 knockout combined with chemotherapeutic drug treatment on tumor cell proliferation

[0095] Each well was seeded with 1000 cells in a 96-well plate (5 replicates for each group). 200 μL of complete culture medium was added, and after 24 hours of culture, different concentrations of chemotherapeutic drugs (hydroxyurea, gemcitabine, cisplatin) were added for 96 hours of treatment. Cell activity was determined by CCK8 method, and the absorbance (OD450) of each well at 450 nm wavelength was detected by an enzyme marker.

[0096]

[0097] The results showed that, under the treatment of chemotherapeutic drugs such as hydroxyurea, gemcitabine, and cisplatin, the cell survival rate of the SUDS3 KO group was significantly decreased compared with the WT group; compared with the control group, the survival rate of the SUDS3 stable expression group was significantly increased, indicating that the expression level of SUDS3 affects the sensitivity of tumor cells to chemotherapeutic drugs (hydroxyurea, gemcitabine, cisplatin), and inhibition of the expression and function of SUDS3 can enhance the anti-tumor effect of chemotherapeutic drugs Figure 5 ).

[0098] As shown in Figure 5 -A, the CCK8 results showed that there was a significant difference in cell survival rate between the WT group and the SUDS3 KO group under the treatment of different concentrations of hydroxyurea (HU) (n=3).

[0099] As shown in Figure 5 -B, the CCK8 results showed that there was a significant difference in cell survival rate between the SUDS3 stable expression group and the control group under the treatment of different concentrations of hydroxyurea (HU) (n=3).

[0100] As shown in Figure 5-C shows that CCK8 results show that there is a significant difference in cell survival rate between WT group and SUDS3 KO group under the treatment of different concentrations of Gemcitabine (n=3).

[0101] As Figure 5 -D shows that CCK8 results show that there is a significant difference in cell survival rate between SUDS3 stable expression group and control group under the treatment of different concentrations of Gemcitabine (n=3).

[0102] As Figure 5 -E shows that CCK8 results show that there is a significant difference in cell survival rate between WT group and SUDS3 KO group under the treatment of different concentrations of Cisplatin (n=3).

[0103] As Figure 5 -F shows that CCK8 results show that there is a significant difference in cell survival rate between SUDS3 stable expression group and control group under the treatment of different concentrations of Cisplatin (n=3).

[0104] Finally, it should be explained that the above examples are only used to illustrate the technical solutions of the present application and not to limit the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.

Claims

1. The use of substances that inhibit the expression of SUDS3 protein in the preparation of products for improving the sensitivity of tumor treatment to chemotherapy drugs.

2. The use according to claim 1, characterized in that The SUDS3 protein inhibitor includes shRNA; The nucleotide sequence of the shRNA is shown in any one of SEQ ID NOs: 1 to 3.

3. Use of substances that knock out the SUDS3 gene in the preparation of drugs for improving the sensitivity of tumors to chemotherapy drugs.

4. The use according to claim 3, characterized in that The substance for knocking out the SUDS3 gene is a CRISPR gene editing system for knocking out the SUDS3 gene.

5. The use according to claim 4, characterized in that The nucleotide sequence of the sgRNA in the CRISPR gene editing system for knocking out the SUDS3 gene is shown in any one of SEQ ID NOs: 4 to 5.

6. The use according to claim 1 or 3, characterized in that The chemotherapy drug includes at least one of gemcitabine, cisplatin and hydroxyurea.

7. The use according to claim 1 or 3, characterized in that The tumor includes at least one of colorectal cancer, breast cancer and cervical cancer.

8. A SUDS3 protein inhibitor, characterized in that The SUDS3 protein inhibitor includes shRNA, sgRNA or a vector expressing shRNA or sgRNA; The nucleotide sequence of the shRNA is shown in any one of SEQ ID NOs: 1 to 3; The nucleotide sequence of the sgRNA is shown in any one of SEQ ID NOs: 4 to 5.

9. A pharmaceutical composition, characterized in that The method comprises the SUDS3 protein inhibitor according to claim 8 and a chemotherapy drug.

10. The pharmaceutical composition according to claim 9, wherein The chemotherapy drug includes at least one of gemcitabine, cisplatin and hydroxyurea.

Images