Improved p53 for enhancing p53 liquid-liquid phase separation capacity and activity

Abstract

The invention discloses a p53 protein liquid-liquid phase separation enhanced improved p53, namely an application of LLPSEp53 in inhibition of tumor cell proliferation. The invention firstly discloses a mechanism for enhancing the function of a wild type p53 tumor inhibition factor through p53 liquid-liquid phase separation, and finds that LLPSEp53 can obviously improve the transcriptional level of downstream target genes (such as CDKN1A, MDM2, PUMA, NOXA, BAF, DDB2 and RRM2B) in cells; the recombinant protein has a remarkable killing effect on various human tumor cell lines; in addition, knock-down of the DEF6 gene can further promote the anti-cancer activity of the LLPSEp53, which indicates that the LLPSEp53 can be used in combination with a DEF6 inhibitor to enhance the anti-cancer effect. Meanwhile, the LLPSEp53 protein is respectively combined with the FGFR inhibitor TAS-120 and the Wnt signal channel inhibitor IWR-1 for use, so that the tumor killing effect is obviously improved. The invention proves that liquid-liquid phase separation can enhance the transcriptional activity of p53 and inhibit the proliferation of tumor cells, and the tumor inhibition effect can be improved when the liquid-liquid phase separation is combined with drugs. The discovery shows that the LLPSEp53 has high clinical transformation potential, and meanwhile, a new thought is provided for application of the LLPSEp53 to clinical tumor treatment when the LLPSEp53 is used in cooperation with drugs.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, and in particular to a modified p53 with enhanced transcriptional activity and tumor suppression ability and its application in killing tumor cells. BACKGROUND

[0002] As an important tumor suppressor, p53 is one of the important molecules that inhibit the occurrence and development of tumors. Under normal circumstances, p53 protein is negatively regulated by MDM2 / MDMX, thereby maintaining a low expression level. However, when the cell is subjected to DNA damage, carcinogens, or stress, it can inhibit the occurrence of tumors through multiple pathways. p53 can block the progression of the cell cycle through the p21 pathway, thereby promoting the repair of DNA damage. When the damage is too severe to be repaired, p53 induces apoptosis and cell senescence by activating different target genes, thereby maintaining the stability of the genome and preventing the occurrence of cancer. p53 is mutated in more than 50% of human cancers, resulting in abnormal function. In the remaining cancers, the function of p53 is inhibited due to overexpression of MDM2, MDM4, or abnormality of the p53 downstream pathway.

[0003] Gene therapy based on p53 has become a hot spot in cancer research. Currently, the only clinically approved p53 gene therapy is Gendicine, which is used to treat head and neck squamous cell carcinoma. Gendicine delivers wild-type p53 gene to cancer cells through a recombinant defective adenovirus to activate tumor suppression function. Clinical trials show that it has significant efficacy and fewer side effects when used in combination with radiotherapy. Other gene therapies such as ONYX-015 are still in clinical trials, and SCH-58500 shows good potential for tumor treatment, but neither has been widely approved. In addition, the method of combining p53 gene therapy with immune checkpoint inhibitors (PD-1 / PD-L1 antibodies) to treat solid tumors has also entered clinical phase II trials and shown good therapeutic potential.

[0004] In recent years, mRNA level therapy has also made progress. The use of p53 mRNA nanoparticles can significantly inhibit the growth of non-small cell lung cancer, and the delivery of p53 mRNA restores tumor suppression function. In addition, strategies to inhibit the expression of mutant p53 by delivering small interfering RNA (siRNA) against mutant p53 are also under study, aiming to reduce the gain-of-function of mutant p53. However, the main challenge of current p53 gene therapy is that wild-type p53 gene cannot effectively function after being transferred into cells due to the influence of carcinogens or the inhibition of mutant p53 in tumors, which limits the therapeutic effect. Therefore, it is urgent to develop new p53 variants with stronger tumor suppression effect to improve the effectiveness of gene therapy.

[0005] Therefore, we designed a liquid-liquid phase separation ability and more active improved p53, LLPSEp53, compared with wild-type p53, LLPSEp53 has stronger phase separation ability, under the same protein concentration, can significantly improve the ability of p53 to kill tumor, so that LLPSEp53 has higher efficiency in killing tumor, which can greatly reduce the cost of protein therapy; in addition, LLPSEp53 (FUS-LC-p53) is combined with small molecule inhibitors TAS-120 and IWR-1, the tumor killing effect is better, which has good clinical transformation potential. SUMMARY

[0006] The purpose of the present application is to provide an improved p53 with stronger transcriptional activity and tumor inhibition effect and uses thereof.

[0007] The improved p53 with stronger transcriptional activity and tumor inhibition effect adds the disordered domain sequence FUS-LC of FUS protein to the sequence of wild-type p53, enhances the ability of wild-type p53 to undergo liquid-liquid phase separation, and has stronger transcriptional activation activity and tumor killing effect.

[0008] The phase separation enhancement sequence FUS-LC can be added to the amino terminus or carboxyl terminus of wild-type p53.

[0009] The improved p53 has transcriptional activation activity, wherein the phase separation enhancement sequence is shown as SEQ ID NO. 1.

[0010] The improved p53 has transcriptional activation activity, including human and non-human species.

[0011] The improved p53 can activate the transcription of CDKN1A target genes, and increase the transcription level of one or more of the downstream target genes of CDKN1A, MDM2, PUMA, NOXA, BAF, DDB2 and RRM2B.

[0012] The improved p53 is used in the preparation of a tumor treatment drug, and the applicable tumor types include non-small cell lung cancer, breast cancer, neuroblastoma, osteosarcoma, cervical cancer and human brain tumor; the drug includes nucleic acid level and protein level active drugs.

[0013] The recombinant protein expression system of the improved p53 includes E. coli expression host, animal cells, virus expression system and yeast protein expression system; the prokaryotic expression vector includes pET-24a and pET-28a(+); the eukaryotic expression vector includes: 1) pEGFP, pEYFP, pmcherry, pRFP, pECFP, pLenti, pLX, pCMV6, pCMV3, pcDNA3 and pcDNA6B animal cell expression vector; 2) insect cell expression vector includes pAc5.1-EGFP and the like; 3) virus expression system includes pAdeasy and pAdMAX and the like; 4) yeast expression vector includes pPIC3 and pPIC9.

[0014] The protein form of the improved p53 includes a full-length form and a mutant form retaining function.

[0015] The target molecule of the improved p53 mediating tumor cell apoptosis includes DEF6, and is used for treating tumors with high DEF6 expression.

[0016] The tumor treatment drug is a drug or a composite drug prepared by combination of the improved p53 with FGFR inhibitor TAS-120 and Wnt signaling pathway inhibitor IWR-1, and is used for improving the ability of killing tumor cells at a lower protein concentration.

[0017] The form of the drug includes injection, tablet, capsule, oral liquid dosage form, granule and ointment.

[0018] The present application has the following technical effects: (1) The improved p53, i.e. LLPSEp53 (FUS-LC-p53) designed innovatively in the present application has stronger liquid-liquid phase separation effect in cells and outside cells.

[0019] (2) The improved p53 with stronger liquid-liquid phase separation ability promotes the transcription level of p53 target genes CDKN1A and PUMA gene.

[0020] (3) The present application proves that LLPSEp53 (FUS-LC-p53) has significant killing effect on various tumor cells, which indicates that it has good clinical application potential for tumor treatment, and innovatively enhances the ability of p53 to inhibit tumor cell proliferation through phase separation.

[0021] (4) The present application first proposes that LLPSEp53 (FUS-LC-p53) combined with DEF6 protein molecule inhibitor can improve the tumor killing effect, and has good potential for tumor clinical treatment.

[0022] (5) The application proves that low concentration of LLPSEp53 (FUS-LC-p53) protein combined with drugs can improve the tumor killing effect, which provides a new theoretical basis for its application in clinical treatment of tumors. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 are microscope images of the phase separation ability comparison of WT-p53 and p53 (p53-EGFP) recombinant protein with C-terminal EGFP tag in vitro.

[0024] Figure 2 are detection results of CDKN1A transcriptional activation after transfection of human non-small cell lung cancer cell line H1299 with WT-p53 and p53 (YFP-p53) plasmid with N-terminal YFP tag.

[0025] Figure 3 are confocal images of WT-p53 and LLPSEp53 (FUS-LC-p53) involved in the application in human renal epithelial cell line HEK293T.

[0026] Figure 4 are confocal images of WT-p53, LLPSEp53 (FUS-LC-p53), LLPSEp53 (p53-FUS-LC) and p53-UTX involved in the application in human non-small cell lung cancer cell line H1299.

[0027] Figure 5 are confocal images of naked mole rat p53 and improved naked mole rat p53: WT-p53 (mr), p53 (mr)-FUS-LC and p53 (mr)-UTX involved in the application in human non-small cell lung cancer cell line H1299.

[0028] Figure 6 are qRT-PCR detection results of mRNA level regulation of p53 downstream target genes in human renal epithelial cell line HEK293T by WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids.

[0029] Figure 7 are qRT-PCR detection results of mRNA level regulation of p53 downstream target genes in human non-small cell lung cancer cell line H1299 by WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids.

[0030] Figure 8Figure 6 is a graph showing the results of detection of CDKN1A transcriptional activation after transfection of human non-small cell lung cancer cell line H1299 with WT-p53, LLPSEp53 (FUS-LC-p53), LLPSEp53 (p53-FUS-LC), and p53-UTX plasmids.

[0031] Figure 9 Figure 7 is a graph showing the results of detection of CDKN1A transcriptional activation after transfection of human non-small cell lung cancer cell line H1299 with WT-p53 (mr), p53 (mr)-FUS-LC, and p53 (mr)-UTX plasmids.

[0032] Figure 10 Figure 8 is a graph showing the results of ATP method detection of cell viability after transfection of human osteosarcoma cell line U2OS with WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids.

[0033] Figure 11 Figure 9 is a graph showing the results of CCK8 method detection of cell viability after transfection of human cervical cancer cell HeLa with WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids.

[0034] Figure 12 Figure 10 is a graph showing the results of CCK8 method detection of cell viability after transfection of human kidney epithelial cell line HEK293T with WT-p53 and LLPSEp53 (FUS-LC-p53) plasmids.

[0035] Figure 13 Figure 11 is a phase separation microscope image of WT-p53 and LLPSEp53 (FUS-LC-p53) recombinant proteins in vitro.

[0036] Figure 14 Figure 12 is a graph showing the results of CCK8 method detection of cell viability after delivery of WT-p53 and LLPSEp53 (FUS-LC-p53) recombinant proteins into human osteosarcoma cell line U2OS.

[0037] Figure 15 Figure 13 is a graph showing the results of CCK8 method detection of cell viability after delivery of WT-p53 and LLPSEp53 (FUS-LC-p53) recombinant proteins into human neuroblastoma cell line SH-SY5Y.

[0038] Figure 16 Figure 14 is a graph showing the results of CCK8 method detection of cell viability after delivery of WT-p53 and LLPSEp53 (FUS-LC-p53) recombinant proteins into human breast cancer cell line SKBR3.

[0039] Figure 17Figure 1 is a result chart of CCK8 method for detecting cell viability after WT-p53 and LLPSEp53 (FUS-LC-p53) recombinant proteins were delivered into human brain tumor cell line SF126.

[0040] Figure 18 Figure 2 is a result chart of ATP method for detecting cell viability after WT-p53 and LLPSEp53 (FUS-LC-p53) were overexpressed in human non-small cell lung cancer cell line H1299 after control group (Vector) and DEF6 were knocked down, respectively.

[0041] Figure 19 Figure 3 is a result chart of CCK8 method for detecting cell viability after WT-p53 and LLPSEp53 (FUS-LC-p53) were delivered into human osteosarcoma cell line U2OS, and then DMSO (control), TAS-120 and IWR-1 were added. DETAILED DESCRIPTION

[0042] The design, method and technical effects of the present application will be illustrated below in combination with specific examples. The present application includes but is not limited to the representative examples disclosed below, and can also be illustrated in various ways. The specification is intended to help relevant skilled persons to comprehensively understand the details of the present application.

[0043] Example 1 Comparison of in vitro liquid-liquid phase separation ability of WT-p53 and EGFP-p53 recombinant proteins Since the tag protein can affect the structure of the protein, in order to detect whether the addition of the tag will affect the liquid-liquid phase separation of WT-p53, EGFP was added as a tag at the C-terminal of p53, and then the liquid-liquid phase separation ability of WT-p53 and p53-EGFP recombinant proteins without fluorescent tag protein was compared. The experimental results show that under the same conditions, compared with WT-p53 without fluorescent tag, when WT-p53 has occurred liquid-liquid phase separation, p53-EGFP has not formed obvious droplet-like structure, which indicates that EGFP tag has obvious inhibitory effect on the liquid-liquid phase separation of p53 protein. Figure 1

[0044] Implementation steps: 1. Clone the two target genes into pET-24a(+) prokaryotic expression vector, transform into C41 expression strain, and culture overnight in 37°C constant temperature incubator. 2. Pick single colonies, culture at 37°C, 220 rpm to OD600=0.6; 3. Add 200-500 μM IPTG, 100 μM ZnCl2, culture overnight at 25°C, 220 rpm; 4. Centrifuge at 4500 rpm, 4°C for 30 min;​ 5. Add cell lysate, high pressure crushing, 17000 rpm, 4°C centrifugation for 30 min; 6. Take supernatant for HisTrap HP medium purification; 7. The eluate is subjected to HiTrap Heparin HP medium purification; 8. Finally, gel filtration is further purified; 9. Prepare phase separation system, take pictures with fluorescence inverted microscope, and compare the phase separation ability of the two.

[0045] The results show that under the same conditions, WT-p53 has formed obvious droplet-like structure, while p53-EGFP has not formed obvious droplet structure, indicating that adding tag protein EGFP at one end of p53 sequence can inhibit the liquid-liquid phase separation of p53 protein.

[0046] Example 2 Comparison of transcriptional activation activity of YFP-p53, WT-p53 and LLPSEp53 (FUS-LC-p53) In order to investigate whether adding different tags at the C-terminal will change the transcriptional activation activity of p53, we added YFP tag at the C-terminal of wild type p53 to construct pCMV3-YFP-p53 eukaryotic expression vector, and transfected pCMV3-YFP-p53, pCMV3-p53 and pCMV3-LLPSEp53 (FUS-LC-p53) into cells, and detected the influence of the three on the transcriptional activation ability of CDKN1A. The experimental results show that compared with WT-p53, YFP-p53 has no significant influence on the transcriptional activation ability of CDKN1A, and LLPSEp53 (FUS-LC-p53) is better than YFP-p53 and WT-p53 in the transcriptional activation ability of CDKN1A. Figure 2 ).

[0047] Implementation steps: 1. Inoculate an appropriate amount of cells in a 96-well cell culture plate, and when the cell density reaches 60-70%, co-transfect the above-mentioned plasmid with CDKN1A luciferase reporter gene plasmid, and continue to culture in the incubator for 24 h; 2. Perform chemiluminescence detection according to the dual luciferase reporter system detection kit produced by Promega and M5 enzyme-labeled instrument; 3. Data processing and analysis are performed using Graphpad5 software.

[0048] The results show that YFP-p53 is weaker in CDKN1A transcription activation activity compared with WT-p53, indicating that adding YFP tag can inhibit the transcription activation activity of wild-type p53, and LLPSEp53 (FUS-LC-p53) can significantly enhance the transcription activation ability of wild-type p53 on CDKN1A.

[0049] Example 3 Comparison of WT-p53 and LLPSEp53 (FUS-LC-p53) liquid-liquid phase separation ability at the cellular level in human renal epithelial cell line HEK293T cells To verify that the phase separation ability of LLPSEp53 (FUS-LC-p53) designed in the application is better than that of WT-p53, the sizes of the liquid droplets formed by the two in cells are detected by eukaryotic cell transfection and immunofluorescence technology, and the phase separation abilities of the two are preliminarily evaluated.

[0050] Implementation steps: 1. One day before transfection, 6-8 x 10^5 cells were inoculated in a 35 mm confocal dish, and 2 ml of complete culture medium was added; 2. After the cell confluence reached 60-70%, 2-2.5 μg of plasmid was transfected per well, and the cells were continuously cultured at 37°C in a 5% CO2 constant temperature incubator for 24 h; 3. 1 ml of complete culture medium was aspirated, 1 ml of 4% paraformaldehyde was added, and the cells were fixed at room temperature for 10 min; 4. All supernatant was aspirated, and 1 ml of PBS was added for rinsing 3 times, each time for 5 min; 5. 0.2% Triton X-100 was added for permeation at room temperature for 15 min; 6. All supernatant was aspirated, and 1 ml of PBS was added for rinsing 3 times, each time for 5 min; 7. 1 ml of 5% BSA was added for blocking at room temperature for 1 h; 8. The diluted p53 primary antibody (dilution ratio 1:1000) was added, and the cells were incubated on a horizontal shaker at 4°C overnight; 9. The primary antibody was recovered, and 1 ml of PBS was added for rinsing 3 times, each time for 5 min; 10. The diluted secondary antibody (dilution ratio 1:1000) was added, and the cells were incubated at room temperature in the dark for 1 h; 11. The secondary antibody was aspirated, and 1 ml of PBS was added for rinsing 3 times, each time for 5 min; 12. The confocal microscope was used for photographing and detecting, and the photographing parameters of different samples were consistent.

[0051] The experimental results show that, compared with WT-p53, LLPSEp53 (FUS-LC-p53) has stronger liquid-liquid phase separation in HEK293T cells, and more and larger liquid droplet structures are formedFigure 3 ).

[0052] Example 4 WT-p53, LLPSEp53 (FUS-LC-p53), LLPSEp53 (p53-FUS-LC) and p53-UTX liquid-liquid phase separation in non-small cell lung cancer cell line H1299 To verify the improved p53 (LLPSEp53) designed in the application has better phase separation ability than WT-p53, and to investigate whether there is a difference between adding FUS-LC sequence at the N-terminus or C-terminus of p53 protein, and the difference between adding different disordered structure sequences, we constructed eukaryotic expression vectors of pCMV6-p53, pCMV6-FUS-LC-p53, pCMV6-p53-FUS-LC and p53-UTX. After transfection in human non-small cell lung cancer cell line H1299, the number and size of liquid droplets formed by the four in the cells were detected by immunofluorescence technology.

[0053] Implementation steps: 1. One day before transfection, inoculate 6-8 x 10^5 H1299 cells in a 35 mm confocal dish, add 2 ml complete culture medium; 2. After the cell density reaches 60-70%, transfect 2-2.5 μg of plasmid per dish, continue to culture at 37°C in a 5% CO2 constant temperature incubator for 24 h; 3. Aspirate 1 ml of complete culture medium, add 1 ml of 4% paraformaldehyde, fix at room temperature for 10 min; 4. Aspirate all supernatant, add 1 ml of PBS and rinse 3 times, each time for 5 min; 5. Add 0.2% Triton X-100 and permeate at room temperature for 15 min; 6. Aspirate all supernatant, add 1 ml of PBS and rinse 3 times, each time for 5 min; 7. Add 1 ml of 5% BSA and block at room temperature for 1 h; 8. Add diluted p53 (DO-1) primary antibody (dilution ratio 1:1000), place on a horizontal shaker and incubate at 4°C overnight; 9. Recover the primary antibody, add 1 ml of PBS and rinse 3 times, each time for 5 min; 10. Add diluted secondary antibody (dilution ratio 1:1000), incubate at room temperature in the dark for 1 h; 11. Aspirate the secondary antibody, add 1 ml of PBS and rinse 3 times, each time for 5 min; 12. Take pictures for detection using a confocal microscope, and the shooting parameters of different samples are consistent.

[0054] The experimental results show that, compared with WT-p53, LLPSEp53(FUS-LC-p53) forms the largest number of droplet-like structures in H1299, followed by LLPSEp53(p53-FUS-LC), which indicates that, compared with WT-p53, the phase separation ability of LLPSEp53(FUS-LC-p53) is the strongest, and adding the phase separation enhancement sequence to different ends will affect the phase transition ability; and p53-UTX does not form obvious droplet-like structures, which indicates that different disordered domains have different effects on the phase separation of p53 protein. In summary, the LLPSEp53(FUS-LC-p53) in which the FUS-LC is added to the N terminus is the most preferred improved p53 with enhanced liquid-liquid phase separation ability Figure 4 ) in the non-small cell lung cancer cell line H1299.

[0055] Example 5 Comparison of p53(mr), p53(mr)-FUS-LC and p53(mr)-UTX liquid-liquid phase separation in non-small cell lung cancer cell line H1299

[0056] Implementation steps: 1. One day before transfection, 6-8x10^5 H1299 cells were inoculated in a 35mm confocal dish, and 2ml complete culture medium was added; 2. After the cell density reached 60-70%, 2-2.5μg plasmid was transfected into each dish, and the cells were continuously cultured at 37℃ in a 5% CO2 constant temperature incubator for 24h; 3. Discard 1ml complete culture medium, add 1ml 4% paraformaldehyde, and fix at room temperature for 10min; 4. Discard all supernatant, add 1ml PBS, and rinse 3 times, each time for 5min; 5. Add 0.2% Triton X-100 and permeate at room temperature for 15min; 6. Discard all supernatant, add 1ml PBS, and rinse 3 times, each time for 5min; 7. Add 1ml of 5% BSA and block at room temperature for 1h; 8. Add diluted p53(DO-1) primary antibody (dilution ratio 1:1000), and incubate on a horizontal shaker at 4℃ overnight; 10. Add diluted secondary antibody of immunofluorescence (dilution ratio 1:1000), incubate at room temperature for 1 hour in the dark; 11. Aspirate the secondary antibody, add 1 ml PBS for rinsing 3 times, each time for 5 minutes; 12. Take pictures for detection using a confocal microscope, and the shooting parameters are consistent for different samples.

[0057] The experimental results show that, compared with WT-p53(mr), the droplets formed by p53(mr)-FUS-LC are the most and largest, and p53(mr)-UTX does not form obvious droplet-like structures, indicating that the optimal disordered domain FUS-LC has certain interspecies universality in promoting the liquid-liquid phase separation of p53 of different species. Figure 5 )

[0058] After proving that the LLPSEp53(FUS-LC-p53) phase separation ability is better than that of WT-p53, we constructed pEGFP-N1-p53 and pEGFP-N1-LLPSEp53(FUS-LC-p53) eukaryotic expression vectors, and detected the transcription regulation ability of WT-p53 and LLPSEp53(FUS-LC-p53) on their downstream target genes by qRT-PCR in HEK293T cells. The results show that, compared with WT-p53, the transcription level of LLPSEp53(FUS-LC-p53) on CDKN1A, MDM2 and PUMA is obviously improved Figure 6 ), indicating that the phase separation enhances the transcription activity of p53.

[0059] Implementation steps: 1. Inoculate cells in a 12-well cell culture plate, and after the cell density reaches 70-80%, transfect 1 μg plasmid, and continue to culture for 24 hours; 2. Extract total RNA from cells using Trizol method; 3. Reverse transcribe the extracted total RNA into cDNA, and prepare the qRT-PCR system according to the standardization process; 4. Detect using a real-time fluorescence quantitative PCR instrument; 5. Use Graphpad5 software for data processing and analysis.

[0060] The experimental results show that, compared with WT-p53, LLPSEp53(FUS-LC-p53) has stronger transcription activity.

[0061] Example 7 The improved p53 of the application has stronger transcription ability of its downstream target genes The method of qRT-PCR in HEK293T cells proves that phase separation can enhance the transcription activity of p53. We constructed pCMV6-p53 and pCMV6-LLPSEp53 (FUS-LC-p53) eukaryotic expression vectors, and further verified them in H1299 cells. The experimental results show that, compared with WT-p53, LLPSEp53 (FUS-LC-p53) significantly improves the transcription levels of CDKN1A, MDM2, and PUMA, etc. Figure 7 ).

[0062] Implementation steps: 1. Inoculate cells in a 12-well cell culture plate, and after the cell confluence reaches 70-80%, transfect 1 μg of plasmid, and continue to culture for 24 h; 2. Extract total RNA from cells using Trizol method; 3. Reverse transcribe the extracted RNA into cDNA, and prepare the qRT-PCR system according to the standard process; 4. Detect with a real-time fluorescent quantitative PCR instrument; 5. Process and analyze data using Graphpad5 software.

[0063] The experimental results show that, compared with WT-p53, LLPSEp53 (FUS-LC-p53) has stronger transcription activation activity.

[0064] Example 8 The improved p53 of the application has stronger transcription activation ability of its downstream target genes To further verify whether phase separation can affect the transcription activation activity of p53, we constructed pcDNA3.1-p53, pcDNA3.1-LLPSEp53 (FUS-LC-p53), pcDNA3.1-LLPSEp53 (FUS-LC-p53), and pcDNA3.1-p53-UTX eukaryotic expression vectors, and proved that phase separation enhancement can promote the transcription activation of p53 on CDKN1A in H1299 cells by double luciferase reporter assay Figure 8 ).

[0065] Implementation steps: 1. Inoculate an appropriate amount of cells in a 96-well cell culture plate, and when the cell density reaches 60-70%, co-transfect the above-mentioned plasmid with the CDKN1A luciferase reporter gene plasmid, and place it in the incubator for further culture for 24 h; 2. Perform chemiluminescence detection according to the double luciferase reporter system detection kit produced by Promega and M5 enzyme marker; 3. Process and analyze data using Graphpad5 software.

[0066] The experimental results show that, compared with WT-p53, the transcription activation ability of LLPSEp53 (FUS-LC-p53) is the strongest, followed by LLPSEp53 (p53-FUS-LC) and p53-UTX, which is consistent with the size of the phase separation structure formed in the cell.

[0067] Example 9 The improved p53 of the application also has stronger transcription activation ability on the downstream target gene of p53 (mr) of the naked mole rat p53 sequence To further verify whether phase separation can affect the transcription activation activity of p53 (mr), eukaryotic expression vectors of pcDNA3.1-p53 (mr), pcDNA3.1-p53 (mr)-FUS-LC and pcDNA3.1-p53 (mr)-UTX are constructed, and the dual luciferase reporter assay in H1299 cells proves that the phase separation enhanced sequence can promote the transcription activation of p53 on CDKN1A between different species. Figure 9 ).

[0068] Implementation steps: 1. Inoculate an appropriate amount of cells in a 96-well cell culture plate, and when the cell density reaches 60-70%, co-transfect the above-mentioned plasmid with the CDKN1A luciferase reporter gene plasmid, and continue to culture in the incubator for 24 h; 2. Perform chemiluminescence detection according to the dual luciferase reporter system detection kit produced by Promega and the M5 enzyme marker; 3. Data processing and analysis are performed using Graphpad5 software.

[0069] The experimental results show that, compared with WT-p53 (mr), the transcription activation ability of p53 (mr)-FUS-LC is the strongest, and the transcription activation activity of p53 (mr)-UTX does not change significantly, indicating that phase separation can enhance the transcription activation ability of p53 of different species.

[0070] Example 10 The improved p53 gene of the application has stronger killing ability on the osteosarcoma cell line U2OS To further explore the tumor killing effect of LLPSEp53 (FUS-LC-p53), pcDNA6B-p53 and pcDNA6B-LLPSEp53 (FUS-LC-p53) eukaryotic expression vectors are constructed, and cell viability detection is also performed in U2OS cells, and the experimental results show that the improved p53 can more effectively inhibit the proliferation of U2OS tumor cells Figure 10 ).

[0071] Implementation steps: 1. Inoculate 5000 cells per well in a 96-well cell culture plate, add 100 μl complete medium to each well, and continue to culture in an incubator for 12-24 h; 2. Transfect 100 ng of plasmid into the cells, 3 wells per group, and continue to culture in an incubator for 72 h; 3. Take out the cells and equilibrate at room temperature for 30 min, and equilibrate the reaction reporter solution at room temperature as well; 4. Remove 50 μl of complete medium, add 50 μl of reaction reporter solution, and place on a horizontal shaker to lyse at room temperature for 15 min; 5. Detect cell viability using ATP method and M5 enzyme marker; 6. Process and analyze the data using Graphpad5 software.

[0072] The results show that LLPSEp53 (FUS-LC-p53) has a more significant killing effect on U2OS tumor cells compared to WT-p53.

[0073] Example 11 The improved p53 gene of the application has a stronger ability to kill human cervical cancer cell line HeLa cells To further explore the tumor killing effect of LLPSEp53 (FUS-LC-p53), we constructed pcDNA6B-p53 and pcDNA6B-LLPSEp53 (FUS-LC-p53) eukaryotic expression vectors, and also detected cell viability in HeLa cells. The experimental results show that p53 phase separation inhibits the proliferation of HeLa tumor cells. Figure 11 ).

[0074] Implementation steps: 1. Inoculate 5000 cells per well in a 96-well cell culture plate, add 100 μl complete medium (without P / S), and continue to culture in an incubator for 12-24 h; 2. Prepare 50 μl protein delivery system according to the protein concentration of 6.5-10 μM, as follows: 6.5-10 μM protein + 5x transduction buffer + complete medium (without P / S); 3. Filter the above system through a 0.22 μm filter to remove bacteria; 4. Remove the complete medium in the well plate, add the above protein delivery system, and continue to culture in an incubator for 24 h; 5. Remove the protein delivery system, add complete medium, and continue to culture for 24 h; 6. Detect cell viability using CCK8 method and M5 enzyme marker; 7. Process and analyze the data using Graphpad5 software.

[0075] Results show that, compared with WT-p53, LLPSEp53 (FUS-LC-p53) gene significantly promotes apoptosis of HeLa cells.

[0076] Example 12 The modified p53 gene of the application has no toxicity to human normal cells human kidney epithelial cell line HEK293TTo further explore the tumor killing effect of LLPSEp53 (FUS-LC-p53), we constructed pcDNA6B-p53 and pcDNA6B-LLPSEp53 (FUS-LC-p53) eukaryotic expression vectors, and also detected the cell viability in HEK293T cells. The experimental results show that p53 phase separation has no effect on the proliferation of HEK293T cells. Figure 12

[0077] Implementation steps: 1. Seed 5000 cells per well in a 96-well cell culture plate, add 100 μl complete culture medium (without P / S), and continue to culture in the incubator for 12-24 h; 2. Prepare 50 μl protein delivery system according to the protein concentration of 6.5-10 μM as follows: 6.5-10 μM protein + 5x transduction buffer + complete culture medium (without P / S); 3. Filter the above system through a 0.22 μm filter to remove bacteria; 4. Remove the complete culture medium in the well plate, add the above protein delivery system, and continue to culture in the incubator for 24 h; 5. Remove the protein delivery system, add complete culture medium, and continue to culture for 24 h; 6. Detect cell viability by CCK8 method and M5 enzyme labeler; 7. Process and analyze the data using Graphpad5 software.

[0078] Results show that, compared with WT-p53, LLPSEp53 (FUS-LC-p53) gene has no effect on the proliferation of non-cancerous HEK293T cells.

[0079] Example 13 Comparison of in vitro phase separation ability of the modified p53 recombinant protein of the application and wild type WT-p53 recombinant protein After confirming the phase separation ability and function of LLPSEp53(FUS-LC-p53) at the level of eukaryotic cell expression, through prokaryotic expression and purification of WT-p53 and LLPSEp53(FUS-LC-p53) recombinant proteins and in vitro phase separation experiments, it was found that compared with WT-p53, LLPSEp53(FUS-LC-p53) could form more phase separation structures even at very low protein concentrations. Figure 13

[0080] Implementation steps: 1. Clone two target genes into pET-28a(+) prokaryotic expression vector, transform into BL21 expression strain, and incubate in 37°C constant temperature incubator overnight. 2. Pick single colonies, incubate at 37°C, 220 rpm, to OD600=0.6; 3. Add 1mM IPTG, 100μM ZnCl2, incubate at 22°C, 220 rpm overnight; 4. Centrifuge at 4500 rpm, 4°C for 30 min; 5. Add cell lysis solution, high-pressure crushing, centrifuge at 17000 rpm, 4°C for 30 min; 6. Take the supernatant for HisTrap HP medium purification; 7. Purify the eluate with HiTrap Heparin HP medium; 8. Finally, further purify with Gel filtration; 9. Prepare the phase separation system, take pictures under a fluorescence inverted microscope, and compare the phase separation abilities of the two.

[0081] The results show that compared with WT-p53, LLPSEp53(FUS-LC-p53) forms more and larger droplets, indicating that the liquid-liquid phase separation ability of LLPSEp53(FUS-LC-p53) is stronger than that of wild-type p53.

[0082] Example 14 LLPSEp53(FUS-LC-p53) recombinant protein enhances the killing effect of p53 on human osteosarcoma cell line U2OS To determine whether LLPSEp53(FUS-LC-p53) recombinant protein also has tumor killing effect, we verified the protein level on U2OS cells, and found that LLPSEp53(FUS-LC-p53) recombinant protein also had a significant killing effect on U2OS tumor cells Figure 14 ).

[0083] Implementation steps: ​1. Seed 5000 cells / well in 96-well cell culture plate, add 100 μl complete medium (without P / S), and place in incubator for 12-24 h of continuous culture; 2. Prepare 50 μl protein delivery system according to the protein action concentration of 6.5-10 μM as follows: 6.5-10 μM protein + 5x transduction buffer + complete medium (without P / S); 3. Filter the above system through a 0.22 μm filter to remove bacteria; 4. Remove the complete medium in the well plate, add the above protein delivery system, and place in the incubator for 24 h of continuous culture; 5. Remove the protein delivery system, add complete medium, and continue to culture for 24 h; 6. Detect cell viability by CCK8 method and M5 enzyme marker; 7. Process and analyze data by Graphpad5 software.

[0084] The results show that, in U2OS tumor cells, compared with WT-p53, the LLPSEp53 (FUS-LC-p53) recombinant protein promotes the apoptosis of U2OS tumor cells.

[0085] Example 15 The improved p53 protein of the application has stronger ability to kill human neuroblastoma cell line SH-SY5Y We further verified the protein level on SH-SY5Y cells, and found that the LLPSEp53 (FUS-LC-p53) recombinant protein also has a significant killing effect on SH-SY5Y tumor cells Figure 15 ).

[0086] Implementation steps: 1. Seed 5000 cells / well in 96-well cell culture plate, add 100 μl complete medium (without P / S), and place in incubator for 12-24 h of continuous culture; 2. Prepare 50 μl protein delivery system according to the protein action concentration of 6.5-10 μM as follows: 6.5-10 μM protein + 5x transduction buffer + complete medium (without P / S); 3. Filter the above system through a 0.22 μm filter to remove bacteria; 4. Remove the complete medium in the well plate, add the above protein delivery system, and place in the incubator for 24 h of continuous culture; 5. Remove the protein delivery system, add complete medium, and continue to culture for 24 h; 6. Detect cell viability by CCK8 method and M5 enzyme marker; 7. Data processing and analysis were performed using Graphpad5 software.

[0087] The results showed that, compared with WT-p53, the LLPSEp53 (FUS-LC-p53) recombinant protein significantly promoted the apoptosis of SH-SY5Y tumor cells.

[0088] Example 16 LLPSEp53 (FUS-LC-p53) recombinant protein enhances the killing effect of p53 on human breast cancer cell line SKBR3 We further verified the protein level on SKBR3 cells, and found that the LLPSEp53 recombinant protein also had a significant killing effect on SKBR3 tumor cells Figure 16 ).

[0089] Implementation steps: 1. Seed 5000 cells per well in a 96-well cell culture plate, add 100 μl complete medium (without P / S), and continue to culture in the incubator for 12-24 h; 2. Prepare 50 μl protein delivery system according to the protein concentration of 6.5-10 μM as follows: 6-10 μM protein + 5x transduction buffer + complete medium (without P / S); 3. Filter the above system through a 0.22 μm filter to sterilize; 4. Remove the complete medium in the well plate, add the above protein delivery system, and continue to culture in the incubator for 24 h; 5. Remove the protein delivery system, add complete medium, and continue to culture for 24 h; 6. Cell viability detection was performed using CCK8 method and M5 enzyme labeler; 7. Data processing and analysis were performed using Graphpad5 software.

[0090] The results showed that, compared with WT-p53, the LLPSEp53 (FUS-LC-p53) recombinant protein significantly promoted the apoptosis of SKBR3 tumor cells.

[0091] Example 17 LLPSEp53 (FUS-LC-p53) recombinant protein enhances the killing effect of p53 on human brain tumor cell line SF126 We further verified the protein level on SF126 cells, and found that the LLPSEp53 (FUS-LC-p53) recombinant protein also had a significant killing effect on SF126 tumor cells Figure 17 ).

[0092] Implementation steps: 1. Inoculate 5000 cells per well in a 96-well cell culture plate, add 100 μl of complete medium (without P / S), and continue to culture in the incubator for 12-24 h; 2. Prepare 50 μl of protein delivery system according to the protein concentration of 6.5-10 μM, as follows: 6.5-10 μM protein + 5x transduction buffer + complete medium (without P / S); 3. Filter the above system through a 0.22 μm filter to remove bacteria; 4. Remove the complete medium in the well plate, add the above protein delivery system, and continue to culture in the incubator for 24 h; 5. Remove the protein delivery system, add complete medium, and continue to culture for 24 h; 6. Detect cell viability by CCK8 method and M5 enzyme labeler; 7. Process and analyze the data using Graphpad5 software.

[0093] The results show that, compared with WT-p53, LLPSEp53 (FUS-LC-p53) recombinant protein significantly promotes the apoptosis of SF126 tumor cells.

[0094] Example 18. LLPSEp53 (FUS-LC-p53) exerts its tumor killing function by regulating DEF6 To further explore the mechanism of LLPSEp53 (FUS-LC-p53) in promoting tumor cell apoptosis, we screened by RNA-seq method, and found that overexpression of LLPSEp53 (FUS-LC-p53) could cause a decrease in the transcription level of DEF6 and other genes, compared with wild-type p53. After knocking down DEF6, it was found that the ability of LLPSEp53 (FUS-LC-p53) to inhibit tumors was enhanced, indicating that the combination of LLPSEp53 and drugs or molecules that can inhibit DEF6 activity can achieve better tumor killing effect. Figure 18 ).

[0095] Implementation steps: 1. Inoculate 5-6 x 10^5 cells in a 12-well cell culture plate, add 1 ml of complete medium, and continue to culture for 12-24 h; 2. Transfect 1 μg of shVector and shDEF6 plasmid into the cells, respectively, and continue to culture in the incubator for 48 h; 3. Digest and count the above two groups of cells, inoculate 5000 cells per well in a 96-well plate, and continue to culture for 24 h; 4. Transfect 150 ng of plasmid into each well, and continue to culture in the incubator for 72 h; 5. Cell viability was detected by ATP method and M5 enzyme label instrument; 6. Data processing and analysis were performed by Graphpad5 software.

[0096] The results showed that, without knocking down DEF6 gene, LLPSEp53(FUS-LC-p53) could hardly inhibit the viability of non-small cell lung cancer cell line H1299 at the gene level compared with wild type p53; after knocking down DEF6, LLPSEp53(FUS-LC-p53) could significantly inhibit the viability of H1299 cells at the gene level, indicating that the inhibition of DEF6 pathway could further promote the tumor killing function of LLPSEp53(FUS-LC-p53). This finding broadened the types of tumors killed by LLPSEp53(FUS-LC-p53) and enhanced the possibility of its clinical transformation.

[0097] Example 19 LLPSEp53(FUS-LC-p53) protein combined with TAS-120 and IWR-1 can enhance its tumor killing effect To further improve the tumor killing effect of LLPSEp53(FUS-LC-p53), we selected FGF / FGFR signaling pathway inhibitor and Wnt signaling pathway inhibitor IWR-1 to be combined with LLPSEp53(FUS-LC-p53) protein to detect its killing ability on human osteosarcoma cell line U2OS. The experimental results found that, compared with WT-p53, after LLPSEp53(FUS-LC-p53) protein was combined with TAS-120 and IWR-1, its tumor killing ability was improved Figure 19 ) compared with WT-p53.

[0098] Implementation steps: 1. Inoculate 5000 cells per well in a 96-well cell culture plate, add 100 μl of complete culture medium (without P / S), and continue to culture in an incubator for 12-24 h; 2. Prepare 50 μl of protein delivery system according to the protein concentration of 3 μM as follows: 0.5-2 μM protein + 5x transduction buffer + complete culture medium (without P / S); 3. Filter the above system through a 0.22 μm filter to sterilize; 4. Remove the complete culture medium in the well plate, add the above protein delivery system, and continue to culture in the incubator for 24 h; 5. Remove the protein delivery system, add complete culture medium containing TAS-120 with a final concentration of 10 μM and IWR-1 with a final concentration of 10 μM, and add an equal volume of DMSO as a control, and continue to culture for 24 h; 6. Cell viability detection by CCK8 method and M5 enzyme label instrument; 7. Data processing and analysis by Graphpad5 software.

[0099] The results show that, in U2OS cells, compared with WT-p53, the combination of TAS-120 and IWR-1 can enhance the killing effect of LLPSEp53 recombinant protein on tumor cells, which provides a certain theoretical basis for LLPSEp53 (FUS-LC-p53) and its drug combination for tumor clinical treatment.

[0100] The above-described embodiments only express several embodiments of the present application, which are described in more detail and in detail, but should not be understood as limiting the scope of the application. It should be noted that, for those skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of protection of the present application. Therefore, the protection scope of the present application should be subject to the appended claims. The DNA sequence added in the improved p53 to promote phase separation: SEQ ID NO. 1 ATGGCCTCAAACGATTATACCCAACAAGCAACCCAAAGCTATGGGGCCTACCCCACCCA GCCCGGGCAGGGCTATTCCCAGCAGAGCAGTCAGCCCTACGGACAGCAGAGTTACAGT GGTTATAGCCAGTCCACGGACACTTCAGGCTATGGCCAGAGCAGCTATTCTTCTTATGGC CAGAGCCAGAACACAGGCTATGGAACTCAGTCAACTCCCCAGGGATATGGCTCGACTG GCGGCTATGGCAGTAGCCAGAGCTCCCAATCGTCTTACGGGCAGCAGTCCTCCTACCCT GGCTATGGCCAGCAGCCAGCTCCCAGCAGCACCTCGGGAAGTTACGGTAGCAGTTCTCA GAGCAGCAGCTATGGGCAGCCCCAGAGTGGGAGCTACAGCCAGCAGCCTAGCTATGGT GGACAGCAGCAAAGCTATGGACAGCAGCAAAGCTATAATCCCCCTCAGGGCTATGGACA GCAGAACCAGTACAACAGCAGCAGTGGTGGTGGAGGTGGAGGTGGAGGTGGAGGTAA CTATGGCCAAGATCAATCCTCCATGAGTAGTGGTGGTGGCAGTGGTGGCGGTTATGGCA ATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTATGGACAGCAGGACCGTGGA Amino acid sequence added in the modified p53 to promote phase separation: SEQ ID NO. 2 MASNDYTQQATQSYGAYPTQPGQGYSQQSSQPYGQQSYSGYSQSTDTSGYGQSSYSSYGQ SQNTGYGTQSTPQGYGSTGGYGSSQSSQSSYGQQSSYPGYGQQPAPSSTSGSYGSSSQSSSY GQPQSGSYSQQPSYGGQQQSYGQQQSYNPPQGYGQQNQYNSSSGGGGGGGGGGNYGQD QSSMSSGGGSGGGYGNQDQSGGGGSGGYGQQDRG.

Claims

1. A modified p53 with stronger transcriptional activity and tumor suppressor effect, characterized by The p53 sequence is enhanced by adding a sequence that promotes p53 phase separation, thereby enhancing the liquid-liquid phase separation ability of wild-type p53, resulting in stronger transcriptional activation activity and tumor killing effects. The phase separation-enhancing sequence is the disordered domain of the FUS protein, namely FUS-LC, the gene sequence of which is shown in SEQ ID NO.

1.

2. The improved p53 according to claim 1, characterized in that The phase separation enhancing sequence FUS-LC can be added to the amino or carboxyl terminus of p53.

3. The improved p53 according to claim 1, characterized in that The phase separation enhancing sequence FUS-LC may be in its full length or truncated form, and there may be a spacer sequence between it and the p53 sequence.

4. The improved p53 according to claim 1, characterized in that It can activate the transcription of CDKN1A target genes and increase the transcription levels of one or more downstream target genes including CDKN1A, MDM2, PUMA, NOXA, BAF, DDB2 and RRM2B.

5. A use of the modified p53 according to claim 1 in preparing a drug for treating tumors, characterized in that: Applicable tumor types include non-small cell lung cancer, breast cancer, neuroblastoma, osteosarcoma, cervical cancer and human brain tumors.

6. The drugs described include drugs that have active effects at the nucleic acid level and protein level.

7. The use of the improved p53 according to claim 6, characterized in that The recombinant protein expression system of the improved p53 includes Escherichia coli expression hosts, animal cells, viral expression systems and yeast protein expression systems; prokaryotic expression vectors include pET24a and pET28a(+); eukaryotic expression vectors include: 1) pEGFP, pEYFP, pmcherry, pRFP, pECFP, pLenti, pLX, pCMV6, pCMV3, pcDNA3 and pcDNA6B animal cell expression vectors; 2) insect cell expression vectors include pAc5.1-EGFP, etc.; 3) viral expression systems include pAdeasy and pAdMAX, etc.; 4) yeast expression vectors include pPIC3 and pPIC9.

8. The use according to claim 6, characterized in that The protein forms of the improved p53 include full-length forms and mutant forms that retain their functions.

9. The use according to claim 6, characterized in that The target molecule for the modified p53-mediated tumor cell apoptosis includes DEF6, and is used to treat tumors with high DEF6 expression.

10. The use according to claim 6, characterized in that The tumor therapeutic drug is a drug used in combination with the modified p53 protein, the FGFR inhibitor TAS-120, and the Wnt signaling pathway inhibitor IWR-1, or a prepared composite drug, which is used to enhance its ability to kill tumor cells at a lower protein concentration.

11. The use according to claim 7, characterized in that The forms of the medicine include injection, tablet, capsule, oral liquid dosage form, granule, and ointment.

Images