UTP-glucose-1-phosphate uridine monophosphate transferase mutant and application thereof

Abstract

The invention discloses a UTP-glucose-1-phosphate uridine monophosphate transferase mutant and application thereof, and belongs to the technical field of biological engineering. The problem of low salidroside yield in the prior art is solved. The invention provides a UTP-glucose-1-phosphate uridylic acid transferase mutant, which is obtained by taking an amino acid sequence as shown in SEQ ID NO.2 as a starting sequence and mutating any one of the 6th site, the 126 site, the 134 site, the 140th site, the 177th site, the 180th site, the 214th site, the 249th site, the 284th site, the 289th site, the 296th site, the 298th site and the 300th site. The invention is mainly used for high-efficiency UTP-glucose-1-uridine phosphate transferase and application of the UTP-glucose-1-uridine phosphate transferase in de novo synthesis of salidroside.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of bioengineering, and particularly relates to a UTP-glucose-1-phosphate uridylyltransferase mutant and application thereof. BACKGROUND

[0002] Salidroside is the core active component of Rhodiolaceae plants, and belongs to natural phenylethanoid glycosides. It takes tyrosol as a mother nucleus, connects a glucose group through a beta-glycoside bond to form a water-soluble small molecule. Its most prominent feature is multi-target physiological activity: it can not only improve cell energy metabolism (anti-fatigue) and scavenge free radicals (antioxidation), but also protect nerve cells and regulate mood (antidepressant), and has cardiovascular protection and immune enhancement. With low toxicity and clear mechanism of action, it is widely used in anti-fatigue drugs, antidepressant preparations and functional foods, and is known as "highland adaptation golden molecule".

[0003] The supply problem of salidroside derived from Rhodiolaceae is a structural imbalance between resource scarcity, technology maturity and market demand growth. The annual collection of wild resources of salidroside is limited, and the artificial cultivation base is still difficult to meet the demand. The chemical synthesis method can reduce the consumption of natural resources, but there is a serious environmental pollution problem. The biological fermentation method has the advantages of high yield, easy to scale, environmental friendly, low cost and other advantages, and is a relatively economic, environmentally friendly and sustainable production method. SUMMARY

[0004] The purpose of the application is to solve the problem of low yield of salidroside in the prior art.

[0005] The application provides a UTP-glucose-1-phosphate uridylyltransferase mutant, which is obtained by mutating any one of positions 6, 126, 134, 140, 177, 180, 214, 249, 284, 289, 296, 298 and 300 in the amino acid sequence shown in SEQ ID NO. 2.

[0006] The application provides a UTP-glucose-1-phosphate uridylyltransferase mutant, which is any one of the following: (1) the threonine at position 6 is replaced by arginine based on the amino acid sequence shown in SEQ ID NO. 2; (2) the valine at position 126 is replaced by isoleucine based on the amino acid sequence shown in SEQ ID NO. 2; (3) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the isoleucine at position 134 with valine; (4) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the leucine at position 140 with isoleucine; (5) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the alanine at position 177 with serine; (6) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the valine at position 180 with isoleucine; (7) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the isoleucine at position 214 with valine; (8) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the isoleucine at position 249 with methionine; (9) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the aspartic acid at position 284 with proline; (10) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the glutamic acid at position 289 with aspartic acid; (11) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the glutamic acid at position 296 with glutamine; (12) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the methionine at position 298 with isoleucine; (13) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the isoleucine at position 300 with alanine.

[0007] The present invention provides a gene encoding the above-mentioned UTP-glucose-1-phosphate uridylyl transferase mutant.

[0008] The present invention provides a recombinant vector containing the gene.

[0009] It is further defined that the starting vectors are pRSFDuet series and pETDuet series.

[0010] The present invention provides a recombinant microbial cell containing the gene.

[0011] Further defined, overexpression in Escherichia coli derived from Escherichia coli ( Escherichia coli ) phosphoglucomutase gene pgm and UTP-glucose-1-phosphate uridyltransferase mutant genes galU Mut 、 Derived from Saccharomyces cerevisiae ( Saccharomyces cerevisiaephenylpyruvate decarboxylase gene ARO10 and alcohol dehydrogenase gene ADH6 The recombinant plasmid pRSFDuet- pgm-galU-ARO10-ADH6 and overexpression of a mutant 3-deoxy-D-arabinoheptulose-7-phosphate (DAHP) synthase gene from Escherichia coli aroG fbr , derived from Zymomonas mobilis ( Zymomonas mobilis tyrC ) cyclohexadiene dehydrogenase gene Arabidopsis thaliana and from Arabidopsis thaliana ( AtUGT85A1 ) glycosyltransferase genes aroG The recombinant plasmid pETDuet- -tyrC-AtUGT85A1 fbr Escherichia coli .

[0012] The present invention provides an application of the UTP-glucose-1-phosphate uridylyl transferase mutant, the gene, the recombinant vector or the recombinant microbial cell in producing salidroside.

[0013] The present invention provides a method for producing salidroside, which comprises the following steps: fermenting the above-mentioned recombinant microbial cells at 30° C. for 72 hours.

[0014] It is further defined that the fermentation medium composition is 25 g / L glucose, 10 g / L glycerol, 7.5 g / L (NH4)2SO4, 3 g / L K2HPO4·3H2O, 2 g / L KH2PO4, 2.0 g / L MgSO4·7H2O, 1.0 g / L citric acid monohydrate, 0.1 g / L vitamin B1, 7 g / L yeast powder, and 10 g / L CaCO3 is used to maintain the pH of the fermentation medium. The culture medium was supplemented with 0.1% volume of trace elements, including 2.0 g / L Al2(SO4)3·18H2O, 0.75 g / L CoSO4·7H2O, 2.5 g / L CuSO4·5H2O, 0.5 g / L H3BO3, 24 g / L MnSO4·H2O, 2.5 g / L NiSO4·6H2O, and 15 g / L ZnSO4·7H2O, and the pH was adjusted to 7.0 using NaOH.

[0015] Beneficial effect: UTP-glucose-1-phosphate uridylyltransferase plays a key role in activating sugar donor in the biosynthesis of salidroside. Its role is to combine glucose-1-phosphate with UTP to generate UDP-glucose (UDPG), which is used as a glycosyl donor. The last step of the biosynthesis of salidroside is catalyzed by glycosyltransferase, which transfers the glucose group in UDPG to the C8 hydroxyl group of tyrosol to form salidroside. If the supply of UDPG is insufficient, it will directly limit the synthesis efficiency of salidroside. Therefore, modifying UTP-glucose-1-phosphate uridylyltransferase to obtain a high-efficiency UTP-glucose-1-phosphate uridylyltransferase mutant is another effective way for high-efficiency biosynthesis of salidroside.

[0016] The genetically engineered bacteria of the present application contain overexpression plasmids of UTP-glucose-1-phosphate uridylyltransferase genes with different site-directed mutations pgm , phenylpyruvate decarboxylase genes galU , ethanol dehydrogenase genes Saccharomyces cerevisiae , and phosphoglucomutase genes ARO10 , and overexpression plasmids of 3-deoxy-D-arabino-heptulosonic acid-7-phosphate (DAHP) synthase genes with mutations ADH6 fbr , cyclohexadiene dehydrogenase genes pgm-galU-ARO10-ADH6 , and glycosyltransferase genes aroG Such genetically engineered bacteria can efficiently catalyze the synthesis of salidroside using glucose as a carbon source, have good application prospects, and provide valuable resources for constructing high-efficiency salidroside-producing strains. DETAILED DESCRIPTION

[0017] In the examples, the fermentation medium for shake flask fermentation contains 25 g / L glucose, 10 g / L glycerol, 7.5 g / L (NH4)2SO4, 3 g / L K2HPO4·3H2O, 2 g / L KH2PO4, 2.0 g / L MgSO4·7H2O, 1.0 g / L citric acid monohydrate, 0.1 g / L vitamin B1, 7 g / L yeast powder, 10 g / L CaCO3, 2.0 g / L Al2(SO4)3·18H2O, 0.75 g / L CoSO4·7H2O, 2.5 g / L CuSO4·5H2O, 0.5 g / L H3BO3, 24 g / L MnSO4·H2O, 2.5 g / L NiSO4·6H2O, 15 g / L ZnSO4·7H2O, and the pH is adjusted to 7.0.

[0018] Example 1: Construction of genetically engineered bacteria containing different UTP-glucose-1-phosphate uridylyltransferase mutants The overexpression of UTP-glucose-1-phosphate uridylyltransferase derived from Escherichia coliZymomonas mobilis ) phosphoglucomutase gene tyrC and UDP-glucose pyrophosphorylase genes Arabidopsis thaliana Derived from Saccharomyces cerevisiae ( AtUGT85A1 phenylpyruvate decarboxylase gene aroG and alcohol dehydrogenase gene -tyrC-AtUGT85A1 The recombinant plasmid pRSFDuet- Escherichia coli and overexpression of a mutant 3-deoxy-D-arabinoheptulose-7-phosphate (DAHP) synthase gene from Escherichia coli pgm-galU-ARO10-ADH6 fbr , derived from Zymomonas mobilis ( galU ) cyclohexadiene dehydrogenase gene galU and from Arabidopsis thaliana ( galU ) glycosyltransferase genes galU The recombinant plasmid pETDuet- galU fbr galU From the Engineering galU forEfficient De Novo Synthesis of Salidroside ） .

[0019] The overexpression plasmid pRSFDuet- galU The wild-type UTP-glucose-1-phosphate uridyltransferase gene in galU Replaced with different site-directed mutations of the UTP-glucose-1-phosphate uridyltransferase mutant gene galU Mut Fragment (mutant UTP-glucose-1-phosphate uridylyltransferase gene galU A2S , mutant UTP-glucose-1-phosphate uridyltransferase gene galU I4Y , mutant UTP-glucose-1-phosphate uridyltransferase gene galU T6R , mutant UTP-glucose-1-phosphate uridyltransferase gene galU V8I , mutant UTP-glucose-1-phosphate uridyltransferase gene galU K9R , mutant UTP-glucose-1-phosphate uridyltransferase gene galU T55N , mutant UTP-glucose-1-phosphate uridyltransferase gene galU V58I , mutant UTP-glucose-1-phosphate uridyltransferase genegalU D92E , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU V94I , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU L111I , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU V119I , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU L120M , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU V125L , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU V126I , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU V131F , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU I134V , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU L140I , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU S148K , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU Q149K , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU A153S , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU I156L , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU R157Q , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU F159Y , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU D160E , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU E161Q , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU A173P , mutant UTP-glucose-1-phosphate uridylyltransferase genes galU T176S , mutant UTP-glucose-1-phosphate uridylyltransferase genesgalU A177S , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU V180I , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU K184Q , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU V186Y , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU E187D , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU A189Q , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU E192D , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU V194A , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU V199I , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU V207E , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU I214V , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU I249M , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU M259L , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU K262R , a mutant UTP-glucose-1-phosphate uridylyltransferase gene galU I281M , a mutant UTP-glucose-1-phosphate uridylyltransferase gene pgm-galU N284P , a mutant UTP-glucose-1-phosphate uridylyltransferase gene -ARO10-ADH6 T288K , a mutant UTP-glucose-1-phosphate uridylyltransferase gene pgm-galU E289D , a mutant UTP-glucose-1-phosphate uridylyltransferase gene -ARO10-ADH6 E295Q , a mutant UTP-glucose-1-phosphate uridylyltransferase gene pgm-galU E296Q , a mutant UTP-glucose-1-phosphate uridylyltransferase gene-ARO10-ADH6 E297T , mutant UTP-glucose-1-phosphate uridylyltransferase gene pgm- M298I , mutant UTP-glucose-1-phosphate uridylyltransferase gene galU I300A ) and 50 plasmids pRSFDuet- containing -ARO10-ADH6 mutants of plasmid pRSFDuet- pgm-galU A2S -ARO10-ADH6 , pRSFDuet- pgm-galU I4Y -ARO10- , pRSFDuet- ADH6 T6R pgm-galU , pRSFDuet- -ARO10-ADH6 pgm-galU V8I -ARO10-ADH6 , pRSFDuet- pgm-galU K9R -ARO10-ADH6 , pRSFDuet- pgm-galU T55N -ARO10-ADH6 pgm-galU , pRSFDuet- ARO10-ADH6 V58I pgm-galU , pRSFDuet- -ARO10-ADH6 D92E pgm-galU , pRSFDuet- -ARO10-ADH6 V94I pgm-galU , pRSFDuet- -ARO10-ADH6 L111I pgm-galU , pRSFDuet- -ARO10-ADH6 V119I - pgm-galU , pRSFDuet- -ARO10-ADH6 L120M pgm-galU , pRSFDuet- -ARO10-ADH6 V125L pgm-galU , pRSFDuet- ARO10-ADH6 V126I pgm-galU , pRSFDuet- -ARO10-ADH6 V131F pgm-galU , pRSFDuet- -ARO10-ADH6 I134V pgm-galU , pRSFDuet- -ARO10-ADH6L140I pgm-galU , pRSFDuet- -ARO10-ADH6 S148K - pgm-galU , pRSFDuet- -ARO10-ADH6 Q149K pgm-galU , pRSFDuet- ​ A153S ​ , pRSFDuet- ​ I156L ​ , pRSFDuet- ​ R157Q ​ , pRSFDuet- ​ F159Y - ARO10-ADH6 , pRSFDuet- pgm-galU D160E - ARO10-ADH6 , pRSFDuet- pgm-galU E161Q - ARO10-ADH6 , pRSFDuet- pgm-galU A173P - ARO10-ADH6 , pRSFDuet- pgm-galU T176S - ARO10-ADH6 , pRSFDuet- pgm-galU A177S - ARO10-ADH6 , pRSFDuet- pgm-galU V180I - ARO10-ADH6 , pRSFDuet- pgm-galU K184Q - ARO10-ADH6 , pRSFDuet- pgm-galU V186Y - ARO10-ADH6 , pRSFDuet- pgm-galU E187D - ARO10-ADH6 , pRSFDuet- pgm-galU A189Q - ARO10-ADH6 , pRSFDuet- pgm-galU E192D - ARO10-ADH6 , pRSFDuet- pgm-galU V194A - ARO10-ADH6 , pRSFDuet- pgm-galU V199I - ARO10-ADH6pRSFDuet-1 pgm-galU V207E - ARO10-ADH6 pRSFDuet-1 pgm-galU I214V - ARO10-ADH6 pRSFDuet-1 pgm-galU I249M - ARO10-ADH6 pRSFDuet-1 pgm-galU M259L - ARO10-ADH6 pRSFDuet-1 pgm-galU K262R - ARO10-ADH6 pRSFDuet-1 pgm-galU I281M - ARO10-ADH6 pRSFDuet-1 pgm-galU N284P - ARO10-ADH6 pRSFDuet-1 pgm-galU T288K - ARO10-ADH6 pRSFDuet-1 pgm-galU E289D ARO10-ADH6 pRSFDuet-1 pgm-galU E295Q - - ARO10-ADH6 pRSFDuet-1 pgm-galU E296Q - ARO10-ADH6 pRSFDuet-1 pgm-galU E297T - ARO10-ADH6 pRSFDuet-1 pgm-galU M298 - ARO10-ADH6 pRSFDuet-1 pgm-galU I300A - ARO10-ADH6 The 50 plasmids above were respectively combined with pETDuet-1 pgm-galU fbr ARO10-ADH6 The plasmids were introduced into the chassis strain Escherichia coli BL21 (DE3) to obtain 50 genetically engineered bacteria containing different UTP-glucose-1-phosphate uridylyltransferase mutants. The bacteria were named according to the mutant amino acid sites.

[0020] Based on the amino acid sequence shown in SEQ ID NO: 2, the corresponding base substitution results are A2S, I4Y, T6R, V8I, K9R, T55N, V58I, D92E, V94I, L111I, V119I, L120M, V125L, V126I, V131F, I134V, L140I, S148K, Q149K, A153S, I156L, R157Q, F159Y, D160E, E161Q, A173P, T176S, A177S, V180I, K184Q, V186Y, E187D, A189Q, E192D, V194A, V199I, V207E, I214V, I249M, M259L, K262R, I281M, N284P, T288K, E289D, E295Q, E296Q, E297T, M298I, or I300A. Among them, the letter before the number represents the original amino acid, and the letter after the number represents the mutated amino acid.

[0021] SEQ ID NO: 1 (nucleotide sequence of wild-type UTP-glucose-1-phosphate uridylyltransferase GalU): ATGGCTGCCATTAATACGAAAGTCAAAAAAGCCGTTATCCCCGTTGCGGGATTAGGAACCAGGATGTTGCCGGCGACGAAAGCCATCCCGAAAGAGATGCTGCCACTTGTCGATAAGCCATTAATTCAATACGTCGTGAATGAATGTATTGCGGCTGGCATTACTGAAATTGTGCTGGTTACACACTCATCTAAAAACTCTATTGAAAACCACTTTGATACCAGTTTTGAACTGGAAGCAATGCTGGAAAAACGTGTAAAACGTCAACTGCTTGATGAAGTGCAGTCTATTTGTCCGCCGCACGTGACTATTATGCAAGTTCGTCAGGGGCTGGCGAAAGGTCTGGGACACGCGGTATTGTGTGCTCACCCGGTAGTGGGTGATGAACCTGTGGCTGTTATTTTGCCTGACGTTATTCTGGATGAATATGAATCCGATTTGTCACAGGATAACCTGGCAGAGATGATCCGCCGCTTTGATGAAACGGGTCATAGCCAGATCATGGTTGAACCGGTTGCTGATGTGACCGCATATGGCGTTGTGGATTGCAAAGGCGTTGAATTAGCGCCGGGTGAAAGCGTACCGATGGTTGGCGTGGTTGAAAAACCAAAAGCGGATGTTGCGCCGTCTAATCTCGCTATTGTGGGTCGTTACGTACTTAGTGCGGATATTTGGCCGTTGCTGGCAAAAACCCCTCCGGGAGCTGGTGATGAAATTCAGCTCACCGACGCAATTGATATGCTAATCGAAAAAGAAACGGTTGAAGCCTATCATATGAAAGGGAAGAGCCATGACTGCGGTAATAAATTAGGTTACATGCAGGCCTTCGTTGAATACGGTATTCGTCATAACACCCTTGGCACGGAATTTAAAGCCTGGCTTGAAGAAGAGATGGGCATTAAGAAGTAA; SEQ ID NO: 2 (amino acid sequence of wild-type UTP-glucose-1-phosphate uridylyltransferase GalU): MAAINTKVKKAVIPVAGLGTRMLPATKAIPKEMLPLVDKPLIQYVVNECIAAGIETIVLVTHSSKNSIENHFDTSFELEAMLEKRVKRQLLDEVQSICPPHVTIMQVRQGLAKGLGHAVLCAHPVVGDEPVAVILPDVILDEYESDLSQDNLAEMIRRFDETGHSQIMVEPVADVTAYGVVDCKGVELAPGESVPMVGVVEKPKADVAPSNLAIVGRYVLSADIWPLLAKTPPGAGDEIQLTDAIDMLIEKETVEAYHMKGKSHDCGNKLGYMQAFVEYGIRHNTLGETFKAWLEEEMGIKK*.

[0022] Table 1 genetically engineered bacteria containing different UTP-glucose-1-phosphate uridylyltransferase mutants

[0023] Example 2. Fermentation experiment of rhodioloside by genetically engineered bacteria containing different UTP-glucose-1-phosphate uridylyltransferase mutants The 50 genetically engineered bacteria and the control strain (genotype of the strain is pgm-galU BL21 (pRSFDuet- - ARO10-ADH6 pgm-galU + pETDuet- - ARO10-ADH6 fbr pgm-galU were inoculated into LB liquid medium containing resistance, and the culture system was 10 mL medium in a 100 mL triangular flask, and the medium was supplemented with 50 μg / mL kanamycin and 100 μg / mL ampicillin. The culture condition was constant temperature shaking bed 37°C, 220 rpm overnight culture, and the seed liquid was obtained. The seed liquid was inoculated into fresh fermentation medium at a volume of 2%, and the culture system was 50 mL medium in a 250 mL triangular flask, and the medium was supplemented with 50 μg / mL kanamycin and 100 μg / mL ampicillin. The culture condition was constant temperature shaking bed 37°C, 220 rpm, and the culture was cultured to OD 600 0.6-0.8, and 0.1 mM IPTG was added to induce, and the induction fermentation was carried out at 30°C, 220 rpm for 72 h, and the sample preparation was carried out.

[0024] Example 3. Extraction and liquid phase detection of rhodioloside Take 1 mL of fermentation broth into a 1.5 mL centrifuge tube, centrifuge 12000 rpm for 5 min using a centrifuge, mix 200 μL supernatant with 800 μL mobile phase A, dilute the sample 5 times and then use Shimadzu high performance liquid chromatograph to detect the content of salidroside. The method is to use a reversed-phase C18 column for quantification. Mobile phase A is water containing 1% trifluoroacetic acid (TFA); mobile phase B is acetonitrile containing 1% TFA. The flow rate is 1 mL·min -1 The absorbance of the sample was detected at 274 nm. The HPLC program was as follows: 10% B: 0-5 min, 60% B: 5-10 min, 90% B: 10-12 min, 2% B: 12-16 min, 0% B: 16-20 min. Taking the strain containing unmutated UTP-glucose-1-phosphate uridylyltransferase as a control (the yield of shake flask fermentation is as high as 4.0 g / L), the yield improvement degree of 50 different site-directed mutant UTP-glucose-1-phosphate uridylyltransferase GalU mutants in shake flask fermentation of salidroside is shown in Table 2.

[0025]

[0026] Note: The number + represents the improvement amplitude of salidroside yield; - represents no improvement.

[0027] Improvement amplitude (%) = (salidroside yield of mutant strain (g / L) - salidroside yield of control strain (g / L)) / salidroside yield of control strain (g / L) x 100%.

[0028] From the above description, it can be seen that the above-mentioned embodiments of the present application achieve the following technical effects: the present application performs site-directed modification on UTP-glucose-1-phosphate uridylyltransferase GalU derived from Escherichia coli (E. coli) - ARO10-ADH6 pgm-galU - ARO10-ADH6 aroG - tyrC-AtUGT85A1 E. coli pgm- galU-ARO10-ADH6 aroG - tyrC-AtUGT85A1 Escherichia coli The present application performs site-directed modification on UTP-glucose-1-phosphate uridylyltransferase GalU derived from Escherichia coli (E. coli) V180I Overexpression of the gene engineering bacteria significantly improves the yield of salidroside, and the yield of shake flask fermentation can reach 5 g / L, which is 25% higher than that of the control strain, and provides valuable resources for constructing high-efficiency salidroside production strains.

[0029] The above only describes the preferred embodiments of the present application and is not used to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A UTP-glucose-1-phosphate uridylyl transferase mutant, characterized in that: The UTP-glucose-1-phosphate uridyltransferase mutant is obtained by taking the amino acid sequence shown in SEQ ID NO.2 as the starting sequence and mutating any one of positions 6, 126, 134, 140, 177, 180, 214, 249, 284, 289, 296, 298 and 300.

2. A UTP-glucose-1-phosphate uridylyl transferase mutant, characterized in that: The UTP-glucose-1-phosphate uridyltransferase mutant is any one of the following: (1) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the threonine at position 6 with arginine; (2) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the valine at position 126 with isoleucine; (3) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the isoleucine at position 134 with valine; (4) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the leucine at position 140 with isoleucine; (5) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the alanine at position 177 with serine; (6) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the valine at position 180 with isoleucine; (7) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the isoleucine at position 214 with valine; (8) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the isoleucine at position 249 with methionine; (9) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the aspartic acid at position 284 with proline; (10) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the glutamic acid at position 289 with aspartic acid; (11) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the glutamic acid at position 296 with glutamine; (12) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the methionine at position 298 with isoleucine; (13) Using the amino acid sequence shown in SEQ ID NO. 2 as the starting sequence, replace the isoleucine at position 300 with alanine.

3. A gene encoding the UTP-glucose-1-phosphate uridylyltransferase mutant according to claim 1 or 2.

4. A recombinant vector containing the gene according to claim 3.

5. The recombinant vector according to claim 4, characterized in that The starting vectors are pRSFDuet series and pETDuet series.

6. A recombinant microbial cell containing the gene according to claim 3.

7. The recombinant microbial cell according to claim 6, characterized in that Overexpression in Escherichia coli derived from Escherichia coli ( Escherichia coli ) phosphoglucomutase gene pgm and UTP-glucose-1-phosphate uridyltransferase mutant genes galU Mut 、 Derived from Saccharomyces cerevisiae ( Saccharomyces cerevisiae phenylpyruvate decarboxylase gene ARO10 and alcohol dehydrogenase gene ADH6 The recombinant plasmid pRSFDuet- pgm-galU-ARO10-ADH6 and overexpression of a mutant 3-deoxy-D-arabinoheptulose-7-phosphate (DAHP) synthase gene from Escherichia coli aroG fbr , derived from Zymomonas mobilis ( Zymomonas mobilis ) cyclohexadiene dehydrogenase gene tyrC and from Arabidopsis thaliana ( Arabidopsis thaliana ) glycosyltransferase genes AtUGT85A1 The recombinant plasmid pETDuet- aroG fbr -tyrC- AtUGT85A1 .

8. Use of the UTP-glucose-1-phosphate uridylyltransferase mutant according to claim 1, the gene according to claim 3, the recombinant vector according to claim 4 or 5, or the recombinant microbial cell according to claim 6 or 7 in producing salidroside.

9. A method for producing salidroside, characterized in that: The method comprises the following steps: fermenting the recombinant microbial cells according to claim 7 at 30° C. for 72 hours.

10. The method according to claim 9, characterized in that The fermentation medium composition was 25 g / L glucose, 10 g / L glycerol, 7.5 g / L (NH4)2SO4, 3 g / L K2HPO4·3H2O, 2 g / L KH2PO4, 2.0 g / L MgSO4·7H2O, 1.0 g / L citric acid monohydrate, 0.1 g / L vitamin B1, and 7 g / L yeast powder. 10 g / L CaCO3 was used to maintain the pH of the fermentation medium. The culture medium was supplemented with 0.1% volume of trace elements, including 2.0 g / L Al2(SO4)3·18H2O, 0.75 g / L CoSO4·7H2O, 2.5 g / L CuSO4·5H2O, 0.5 g / L H3BO3, 24 g / L MnSO4·H2O, 2.5 g / LNiSO4·6H2O, and 15 g / L ZnSO4·7H2O, and the pH was adjusted to 7.0 using NaOH.

Images