Primer probe, kit and method for identifying A1 / A2-beta casein in milk and dairy products

Abstract

The invention provides a primer probe, a kit and a method for identifying A1 / A2-beta casein in milk and dairy products. The primer probe comprises an allele specific primer A1A2-F, an allele specific primer A1A2-R, a probe A2-P and a probe A1-P. The invention further discloses a kit for detecting the allele specific primer A1A2-F, the allele specific primer A1A2-R and the probe A1-P. According to the present invention, based on the 67th single nucleotide polymorphism (SNP) of the ruminant A1 / A2-beta casein gene (CSN2), the gene typing method with characteristics of high specificity and high sensitivity is constructed; according to the method, an ARMS-PCR technology, a locked nucleic acid (LNA) modification strategy and an MGB probe signal detection system are integrated, so that the A1 / A2 allele is accurately distinguished.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of dairy product detection, and particularly relates to a primer probe for identifying A1 / A2-beta casein in milk and dairy products, a kit and a method thereof. BACKGROUND

[0002] The genotype difference of A1 and A2-beta casein is derived from the single nucleotide polymorphism (SNP) at the 67th site of the beta-casein gene (CSN2), that is, the A1 type gene is cytosine (C) at the site, and the A2 type is thymine (T). This single base mutation leads to the difference between histidine (A1 type) and proline (A2 type) at the 67th amino acid position of the encoded beta-casein, and further causes significant changes in protein structure and functional characteristics. Studies have shown that ordinary cow milk containing A1-beta casein may interfere with intestinal enzyme activity by releasing beta-casomorphin-7 (BCM-7) during digestion, reduce lactase activity and induce lactose intolerance symptoms; and milk containing only A2-beta casein does not produce BCM-7, has higher digestion and absorption efficiency and gastrointestinal tolerance.

[0003] A2-beta casein widely exists in the milk of ruminants such as cows and sheep, but its high proportion expression depends on the genetic background of specific breeds or gene screening technology. For example, only about 30% of the world's dairy cows are homozygous A2 type (AA genotype), which can stably secrete 100% A2-beta casein. Therefore, accurate identification of A1 / A2-beta casein through genotyping technology is not only crucial for the quality grading of dairy products and the development of functional products, but also provides a scientific basis for the targeted breeding of A2 type populations in dairy cattle breeding, and has important value in clinical nutritional intervention (such as dietary management of lactose-intolerant populations).

[0004] At present, the "gold standard" for genotype detection is Sanger sequencing method, but it has significant limitations: high instrument cost, long sequencing period, and strict technical requirements for operators, usually only professional sequencing companies can provide services, which is difficult to popularize and apply. In addition, the existing detection methods can be divided into two categories: First, protein level detection: including high performance liquid chromatography, gel electrophoresis and mass spectrometry, etc. This kind of method is based on the structural difference of A1 / A2-beta casein for distinction, but due to the difference of only one amino acid (A1 type at the 67th site is histidine, and A2 type is proline), the molecular structure gap is very small, which is easy to be interfered by sample matrix, leading to false positive results, and the detection process is complex and time-consuming.

[0005] Second, gene level detection: A1 / A2-beta casein is identified indirectly by detecting the genotype of ruminants, which has high accuracy. However, for deep-processed samples (such as UHT milk), the number of cells is greatly reduced due to high-temperature treatment, and DNA is easily degraded during processing, which often leads to insufficient template amount, thereby causing false negative results, which cannot meet the actual detection needs.

[0006] In summary, the existing detection techniques are difficult to be applied efficiently in actual production and detection due to high cost, complex operation or insufficient accuracy, and it is urgent to develop a simple, accurate and suitable A1 / A2-beta casein identification method for various samples. SUMMARY

[0007] The present application provides a primer probe, a kit and a method for identifying A1 / A2-beta casein in milk and dairy products to solve the problems of high cost, complex operation and insufficient accuracy in the prior art.

[0008] The technical method of the present application is as follows: A primer probe for identifying A1 / A2-beta casein in milk and dairy products, the primer probe comprises allele-specific primer A1A2-F, allele-specific primer A1A2-R, probe A2-P and probe A1-P. The nucleotide sequence of the allele-specific primer A1A2-F is shown in SEQ ID NO. 1, the nucleotide sequence of the allele-specific primer A1A2-R is shown in SEQ ID NO. 2, the nucleotide sequence of the probe A2-P is shown in SEQ ID NO. 3, and the nucleotide sequence of the probe A1-P is shown in SEQ ID NO. 4. Preferably, the probe A2-P is modified by a locked nucleic acid and an MGB probe, and the probe A1-P is modified by an MGB probe.

[0009] The present application also provides a kit for identifying A1 / A2-beta casein in milk and dairy products, which comprises the primer probe described above.

[0010] The present application also provides a method for identifying A1 / A2-beta casein in milk and dairy products using the primer probe described above, comprising: S1, extracting DNA from the sample to be tested; S2, preparing a fluorescent PCR reaction system by combining the primer and the probe described above, and setting a positive control, and performing a fluorescent quantitative PCR reaction program on the DNA of the sample to be tested; S3, determining the results according to the Ct value results and the allele partition results of the fluorescent quantitative PCR reaction program; the positive control is to amplify the DNA of a non-milk sample as a template.

[0011] The step S1 comprises: S11, placing the milk sample in a centrifugal tube for centrifugation, discarding supernatant and middle layer, adding PBS buffer to the bottom layer, and mixing and precipitating; S12, transferring the precipitate in the centrifugal tube in the step S11 to another centrifugal tube, centrifugation, and taking the precipitate; S13, taking the precipitate in the step S12, adding a mixed solution of emulsifier and PBS buffer, washing the precipitate, and taking the precipitate; S14, taking the precipitate in the step S13 for constant temperature water bath, centrifugation, and taking the precipitate; and S15, taking the precipitate in the step S14, adding PBS buffer, washing the precipitate, and centrifugation, to obtain the precipitate as the DNA of the sample to be tested. In the step S11, the centrifugal speed is 5000-20000 rpm, and the centrifugal time is 3-8 min. In the step S12, the centrifugal speed is 5000-20000 rpm, and the centrifugal time is 3-8 min. In the step S13, the components of the emulsifier comprise: Triton-X100, 95% ethanol, and sodium chloride solution. In the step S14, the centrifugal speed is 5000-20000 rpm, and the centrifugal time is 3-8 min. The temperature of the constant temperature water bath is 30-50℃, and the constant temperature water bath time is 5-15 min. In the step S15, the centrifugal speed is 5000-20000 rpm, the centrifugal time is 5-15 min, and the centrifugal temperature is 2-5℃.

[0012] In the step S2, the fluorescence quantitative PCR reaction program is 95℃ reaction for 30 s, 55℃ annealing for 30 s, and amplification for 40 cycles.

[0013] In the step S3, the standard for judging the result is: when the Ct value of the sample to be tested is <40, the fluorescence signal is detected, the typical amplification curve appears, and the typing result is clear, the sample is judged as positive; when the Ct value of the sample to be tested is ≥40, the typical amplification curve does not appear, and the typing result is not clear, the sample is judged as negative.

[0014] The present application has the following beneficial effects: I. The present application is based on the single nucleotide polymorphism (SNP) of the 67th site of the A1 / A2-beta casein gene (CSN2) of ruminants, and a high specificity and high sensitivity genotyping method is constructed. The method realizes accurate discrimination of A1 / A2 alleles by integrating ARMS-PCR technology, lock nucleic acid (LNA) modification strategy and MGB probe signal detection system. Specifically, two allele-specific primers (A1A2-F and A1A2-R) are designed, and the 3' end bases are strictly complementary to A1 (C) and A2 (T) templates, respectively. The 3' end mismatch blocking mechanism of ARMS-PCR is used to allow only the completely matched primer to start the chain extension reaction, thereby realizing allele-specific amplification. On this basis, LNA-modified allele-specific probes (A1-P and A2-P) are introduced, which significantly improve the binding stability of the probe and the template (ΔTm≈3–8℃) by embedding LNA units at the SNP site, and further stabilize the probe-template hybridization complex by combining the structure optimization of MGB (minor groove binder) probe. The 5' end of the MGB probe is labeled with a fluorescent reporter group (such as FAM / HEX), and the 3' end is connected with a quenching group (such as BHQ1). Only when the probe is completely matched with the template, the probe is hydrolyzed by Taq enzyme and the fluorescence signal is released, and the unmatched probe is in the quenched state. By monitoring the fluorescence signal intensity of the two groups of probes by real-time fluorescence quantitative PCR (qPCR), the homozygous A1 type, heterozygous type and homozygous A2 type genotypes can be accurately distinguished. The method has high specificity (mismatch blocking efficiency > 99%), high sensitivity (can detect 0.1% allele variation) and convenient operation (one-step closed detection), which provides a reliable technical platform for dairy product quality grading, dairy germplasm resource evaluation and functional food development.

[0015] I. The method of the present application is convenient, fast, low in price and low in operation requirement.

[0016] III. The method of the present application is convenient and fast, and can complete the discrimination of A1 / A2-beta casein gene in milk and dairy products in a short time, and does not require expensive instruments and equipment; the detection limit is high (0.01%), the sensitivity meets the requirements (99.6%), and there is no false positive or false negative situation in the specificity result. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 It is the first species alignment result graph of embodiment 1 of the present application; Figure 2 It is the second species alignment result graph of embodiment 1 of the present application; Figure 3 It is the PCR primer temperature level gel electrophoresis result graph of embodiment 2 of the present application; Figure 4 Optimal concentration graph of A2 type primer; Figure 5 Optimal concentration graph of A1 type primer; Figure 6 Optimal temperature graph of PCR probe; Figure 7 Probe optimal concentration amplification curve graph; Figure 8 PCR amplification graph for comparison of different extraction methods; Figure 9 Horizontal gel electrophoresis result graph for different extraction methods; Figure 10A Specific amplification curve result graph; Figure 10B Specific genotyping result graph; Figure 11 Limit of detection amplification curve graph; Figure 12 A1 beta-casein sensitivity standard curve graph; Figure 13 A2 beta-casein sensitivity standard curve; Figure 14A Actual sample detection amplification curve result graph; Figure 14B Actual sample detection genotyping result graph. DETAILED DESCRIPTION

[0018] The technical solutions of the present application will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0019] In an aspect, the present application provides a primer probe for identifying A1 / A2-beta casein in milk and dairy products, which comprises allele-specific primer A1A2-F, allele-specific primer A1A2-R, probe A2-P and probe A1-P. The nucleotide sequence of the allele-specific primer A1A2-F is shown in SEQ ID NO. 1, the nucleotide sequence of the allele-specific primer A1A2-R is shown in SEQ ID NO. 2, the nucleotide sequence of the probe A2-P is shown in SEQ ID NO. 3, and the nucleotide sequence of the probe A1-P is shown in SEQ ID NO. 4.

[0020] In an embodiment, SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4 are respectively: SEQ ID NO. 1: 5'- GGATAAAATCCACCCCTTATC -3'; SEQ ID NO. 2: 5'- TTGAGGGGGAGGAGGGATGTTTTGT -3'; SEQ ID NO. 3: 5'- FAM-CCCCACC / iXNA_A / TAACAGCC-MGB -3'; SEQ ID NO. 4: 5'- VIC-CCATCC / iXNA_C / TAACAGTCT-MGB -3'.

[0021] Here, the probe A2-P is modified by a locked nucleic acid and an MGB probe, and the probe A1-P is modified by an MGB probe. The VIC probe and the FAM probe have the same effect, both of which provide fluorescence. Two fluorescent probes are used in the present application in order to achieve simultaneous detection.

[0022] According to the specific nucleic acid sequence of the A1 / A2-β casein of ruminants, the present application uses the ARMS-PCR technology, designs two allele-specific primers A1A2-F and A1A2-R, and controls the allele-specific extension through the different nucleotides at the 3' end of the primers. In the amplification process, the upstream primer that does not completely match the template will form a mismatch, resulting in blocked extension and no PCR product, while the primer that matches the template can amplify the corresponding PCR product, and the A1 and A2 genes of the PCR product are detected by the fluorescently labeled probes A2-P and A1-P, so as to accurately distinguish the A1 / A2-β casein genotype.

[0023] The present application modifies the probe A2-P with a locked nucleic acid (LNA), which has a high recognition characteristic for base mismatches when complementary pairing: when there is a mismatched base in the LNA-DNA hybridization chain, the stability is significantly reduced. By modifying the LNA at the mismatch site and its vicinity, single-base mismatches can be effectively recognized and the extension of non-complementary double-stranded is blocked; at the same time, the probes A2-P and A1-P are modified with MGB probes to improve the probe annealing temperature, further enhancing the specificity of the probes, so as to realize the efficient identification of the A1 / A2-β casein gene in milk and dairy products.

[0024] In an aspect, the present application provides a kit for identifying the A1 / A2-β casein in milk and dairy products, which comprises the above-mentioned primer probe. Specifically, the primer probe comprises the allele-specific primer A1A2-F, the allele-specific primer A1A2-R, the probe A2-P, and the probe A1-P.

[0025] In a third aspect, the present application provides a method for identifying A1 / A2-β-casein in milk and milk products by using the primer and probe as described above, comprising: S1, extracting DNA of the sample to be tested.

[0026] Specifically, the step S1 comprises: S11, placing the milk sample in a centrifuge tube for centrifugation, discarding the supernatant and the middle layer, adding PBS buffer to the bottom layer, and mixing and precipitating; S12, transferring the precipitate of step S11 in the centrifuge tube to another centrifuge tube, centrifuging, and taking the precipitate; S13, taking the precipitate of step S12, adding a mixture of emulsifier and PBS buffer, washing the precipitate, and taking the precipitate; S14, taking the precipitate of step S13 for constant temperature water bath, centrifuging, and taking the precipitate; S15, taking the precipitate of step S14, adding PBS buffer, washing the precipitate, and centrifuging to obtain the precipitate as the DNA of the sample to be tested.

[0027] In step S11, the milk sample is one or more of yellow cattle, water buffalo, yak, pig, goat, sheep, camel, horse, and donkey. The centrifugation speed is 5000-20000 rpm, and the centrifugation time is 3-8 min. The volume ratio of the milk sample to PBS buffer is 40-60:1.

[0028] In step S12, the centrifugation speed is 5000-20000 rpm, and the centrifugation time is 3-8 min.

[0029] In step S13, the emulsifier comprises Triton-X100, 95% ethanol, and sodium chloride solution. The volume ratio of Triton-X100, 95% ethanol, and sodium chloride solution is 10-30:100-150:850-860. The concentration of the sodium chloride solution is 0.5-1.5 g / L. The volume ratio of the precipitate of step S11 in the centrifuge tube, the emulsifier, and the PBS buffer is 10-30:0.5-1.5:7-11.

[0030] In step S14, the centrifugation speed is 5000-20000 rpm, and the centrifugation time is 3-8 min. The temperature of the constant temperature water bath is 30-50℃, and the time of the constant temperature water bath is 5-15 min.

[0031] In step S15, the centrifugation speed is 5000-20000 rpm, the centrifugation time is 5-15 min, and the centrifugation temperature is 2-5℃. The volume ratio of the precipitate of step S11 in the centrifuge tube to the PBS buffer is 10-30:4-6.

[0032] S2, using the primer and probe as described above to prepare a fluorescent PCR reaction system, setting a positive control, and performing a fluorescent quantitative PCR reaction program on the DNA of the sample to be tested.

[0033] In an embodiment, the positive control is amplification using DNA of a non-milk sample as a template. The non-milk sample is sampled at multiple points. Here, the multiple-point sampling scheme is the same as GB / T 38164-2019 Common Livestock and Poultry Animal Origin Components Detection Method, Real-time Fluorescent PCR Method 8.1 Sample Pretreatment.

[0034] In the S2 step, the fluorescent quantitative PCR reaction program is 95℃ for 30s, 55℃ for 30s, and 40 cycles of amplification.

[0035] In the S2 step, the fluorescent PCR reaction system includes allele-specific primer A1A2-F, allele-specific primer A1A2-R, probe A2-P, probe A1-P, PCR reaction solution, template DNA, and sterilized deionized water. For example, A1A2-F and A1A2-R are each 0.4 μL, A1-P and A2-P are each 0.2 μL, PCR reaction solution is 12.5 μL, template DNA is 2.5 μL, and sterilized deionized water is added to 25 µL.

[0036] S3, according to the Ct value results of the fluorescent quantitative PCR reaction program and the allele partitioning results, the results are determined.

[0037] In the S3 step, the standard for the result determination is that when the Ct value of the sample to be tested is <40, there is a fluorescent signal detection, a typical amplification curve appears, and the typing result is clear, the sample is determined to be positive; when the Ct value of the sample to be tested is ≥40, there is no typical amplification curve, and the typing result is clear, the sample is determined to be negative.

[0038] According to the typing results, only the detection of FAM signal indicates that the sample contains A2 type β casein gene; only the detection of VIC signal indicates that the sample contains A1 type β casein gene; and the detection of both FAM and VIC signals indicates that the sample contains A1 / A2 type β casein gene.

[0039] In the present application, all the preparation raw materials are commercially available products well known to those skilled in the art, unless otherwise specified.

[0040] The present application is described in detail below through examples and experimental examples. However, these are only examples and do not limit the present application in any form.

[0041] Example 1 Sequence alignment As Figure 1As shown, according to the information in the GenBank (https: / / www.ncbi.nlm.nih.gov / ) database, the beta casein information of Canadian sheep (Ovis canadensis), oryx (Oryx dammah), zebu (Bos indicus), red deer (Cervus elaphus), yak (Bos mutus), sheep (Ovis aries), domestic cattle (Bos taurus), domestic yak (Bos grunniens), goat (Capra hircus), water buffalo (Bubalus bubalis), American prairie bison (Bison bison bison) and Javan bison (Bos javanicus) was selected for alignment, respectively.

[0042] In Figure 1 , only the genotype of bovine beta casein and bovine A1 type beta casein has A (A) at this position. Figure 1 In the intersection part of the blue frame and the red frame in , the genotype of bovine A2 type beta casein and other animal-derived beta casein has C at this position, and the rest of the positions of the two types of beta casein are not different.

[0043] Figure 2 As shown, since the cause of diseases such as type I diabetes, sudden infant death, hyperactivity, childhood autism, etc. is that beta-casomorphin-7 can be produced after histidine hydrolysis, the nucleic acid sequence is aligned for translation, and it is found that the genotype of bovine beta casein and bovine A1 type beta casein is translated into histidine (H) at this position. Figure 2 In the intersection part of the blue frame and the red frame in , the genotype of bovine A2 type beta casein and other animal-derived beta casein is translated into proline (P), so this position is selected for primer probe design.

[0044] Example 2: Primer probe design According to the above sequence alignment results, combined with existing technologies (such as ARMS-PCR (amplification refractory mutation system PCR), locked nucleic acid (Locked nucleic acid, LNA)), primer probe design is carried out, but these technologies cannot effectively solve the problem of allele detection in actual verification.

[0045] Only yak DNA containing A2 type beta-casein and only yellow cattle DNA containing A1 type beta-casein were added to the reaction. As shown in Figure 3M is the standard quality of DNA molecules; 1, 2 are 60℃; 3, 4 are 58℃; 5, 6 are 57℃; 7, 8 are 55℃; 9, 10 are 53℃; 11, 12 are 50℃; B is blank. The front and rear added DNA is yak (1, 3, 5, 7, 9, 11 in the figure), cow (2, 4, 6, 8, 10, 12 in the figure). The experimental results show that when the primer temperature is 60℃, the specific amplification and tailing phenomenon are not obvious, so the optimal temperature of the primer is selected as 60℃.

[0046] The DNA extracted from the A2 milk product and the yak DNA containing only A2 type β-casein are added to the reaction respectively to obtain the optimal concentration of the primer for only A2 type β-casein gene. As shown in Figure 4 M is the standard quality of DNA molecules; 1, 2 are 0.25 μL; 3, 4 are 0.5 μL; 5, 6 are 0.75 μL; 7, 8 are 1.0 μL; 9, 10 are 1.25 μL; 11, 12 are 1.5 μL. The front and rear added DNA is A2 milk (1, 3, 5, 7, 9, 11), yak (2, 4, 6, 8, 10, 12). The experimental results show that in a certain range, the primer addition amount higher than 0.5 μL has almost the same amplification effect on A2 gene; and when the concentration is too large, non-specific amplification will occur, so 0.5 μL is selected as the optimal concentration of the primer. Therefore, when the primer addition amount is 0.5 μL, the amplification effect is optimal.

[0047] The DNA extracted from the ordinary (A1 / A2) milk product (which is assumed to contain A1 gene) and the cow DNA containing only A1 type β-casein are added to the reaction respectively to obtain the optimal concentration of the primer for only A1 type β-casein gene. As shown in Figure 5 M is the standard quality of DNA molecules; 1, 2 are 0.25 μL; 3, 4 are 0.5 μL; 5, 6 are 0.75 μL; 7, 8 are 1.0 μL; 9, 10 are 1.25 μL; 11, 12 are 1.5 μL. The front and rear added DNA is A1 milk (1, 3, 5, 7, 9, 11), cow (2, 4, 6, 8, 10, 12). The experimental results show that in a certain range, the primer addition amount higher than 0.5 μL has almost the same amplification effect on A1 gene; and when the concentration is too large, non-specific amplification will occur, so 0.5 μL is selected as the optimal concentration of the primer. Therefore, when the primer addition amount is 0.5 μL, the amplification effect is optimal.

[0048] Common (A1 / A2) milk DNA, A2 milk DNA, cattle (A1) DNA, and yak milk (A2) DNA were added to the PCR reaction, and the samples containing the A1 / A2 gene were tested at a temperature gradient of 66, 65, 64, 62, 60, 58, 57, and 56°C, respectively. The amplification results were as follows: Figure 6 The curve is best presented at 58°C. The optimal concentration of the fluorescent quantitative PCR probe for A2 milk, as determined by the study, is listed in Table 1. Specific Ct values ​​(>40 is considered non-detection) are shown. The experimental results show that when the probe temperature is set at 58°C, only the A2 gene is detected in A2 milk samples, with no other specific amplification. Furthermore, the Ct values ​​at similar temperatures are relatively close. Combining the amplification patterns and specific Ct values ​​indicates that the probe's optimal temperature is 58°C. Therefore, the optimal probe temperature is 58°C.

[0049] Table 1 Results of fluorescence quantitative PCR assays of probes at optimal temperatures like Figure 7 As shown, DNA from A2 milk, yak (A2), and cattle (A1) was added to the reaction, respectively. After fluorescence quantitative PCR amplification, a probe addition of 0.2 μL already met the detection requirement, and a good curve was obtained. Table 2 (using the results from A2 milk as an example) shows that once the detection requirement was met, the Ct values ​​of different probe additions remained relatively small. Therefore, combined with the amplification profile, the optimal probe addition for this method can be determined to be 0.2 μL.

[0050] Table 2 Results of fluorescence quantitative PCR assays for probe optimal temperature like Figure 8 As shown, combined with quantitative fluorescence PCR, the experimental results (Table 3 uses the results of A2 milk as an example) show that the Ct value of the kit extraction method after emulsifier pretreatment is the best, followed by the guanidine-chloroform method, and third is direct kit extraction. However, the emulsifier pretreatment process is complex, so the extraction method was screened again.

[0051] Table 3 PCR results of different extraction methods like Figure 9 As shown, 1 is the kit method; 2 is the emulsifier kit method; 3 is the phenol-chloroform method; 4 is the SDS method; 5 is the PVP method; and 6 is the guanidine-chloroform method. The guanidine-chloroform method has the best extraction effect, but no specific amplification is observed. The kit method is second best, with clear bands but no obvious specific amplification.

[0052] In summary, the results show that the nucleic acid extraction effect of guanidine-trichloromethane is the best, and the kit method is the second, but the phenol, chloroform and other substances used by the former are harmful to the human body, and the process is complex, time-consuming, for the safety and efficiency of subsequent operation, the nucleic acid extraction method is unified as the kit method extraction.

[0053] Example 3 Methodology study The primer probe of the application comprises: A1A2 F 5'- GGATAAAATCCACCCCTTATC -3' (SEQ ID No. 1) A1A2 R 5'- TTGAGGGGGAGGAGGGATGTTTTGT -3' (SEQ ID No. 2) A2 P 5'- FAM-CCCCACC / iXNA_A / TAACAGCC-MGB -3' (SEQ ID No. 3) A1 P 5'- VIC-CCATCC / iXNA_C / TAACAGTCT-MGB -3' (SEQ ID No. 4) A method for identifying A1 / A2-β casein in milk and dairy products, specifically comprising the following steps: (1) Sample cell collection: a. Non-milk sample: take 200 mg of sample (multi-point sampling); here, the multi-point sampling scheme is the same as GB / T 38164-2019 Common Livestock and Poultry Animal Origin Component Detection Method, Real-time Fluorescent PCR Method 8.1 Sample Pretreatment; b. Milk sample: take 50 mL of sample and place it in a 50 mL centrifuge tube, centrifuge with a high-speed low-temperature centrifuge, 4000 rpm, centrifuge for 10 min. Discard the supernatant and the middle layer, add 1 mL of PBS buffer to the bottom and mix the precipitate. Transfer the material in the centrifuge tube to a 2 mL centrifuge tube, centrifuge at 10000 rpm for 5 min. Wash the precipitate with a mixture of emulsifier (20 mL Triton-X100, 95% ethanol 125 mL, 0.9 g / L sodium chloride 855 mL) 100 μL and PBS 900 μL. 40°C constant temperature water bath for 10 min, then 10000 rpm centrifugation for 5 min. Discard the supernatant, wash the precipitate with 500 μL PBS, and finally centrifuge at 10000 rpm, 4°C for 10 min. Make the somatic cells fully settle in the precipitate as the DNA extraction sample.

[0054] (2) Extraction of template DNA: extract the DNA of the sample to be tested according to the general cell tissue DNA extraction kit instructions; (3) Fluorescent quantitative PCR reaction system: Prepare the reaction system in a 200 μL PCR tube: 0.4 μL of each of two primers, 0.2 μL of each of two probes, 12.5 μL of 2x PCR reaction solution, 2.5 μL of template DNA, and make up to 25 μL with sterilized deionized water; (4) Fluorescent quantitative PCR reaction program (genotyping): 95°C, 10 min; 95°C, 30 s, 40 cycles.

[0055] (5) Result judgment: a. When the Ct value of the sample to be tested is <40, the fluorescent signal is detected, a typical amplification curve appears, and the genotyping result is clear, the sample is judged to be positive.

[0056] b. When the Ct value of the sample to be tested is ≥40, there is no typical amplification curve, and the genotyping result is clear, the sample is judged to be negative.

[0057] (6) Result expression According to the genotyping result, only FAM signal is detected, indicating that the sample contains A2 type β-tubulin gene; only VIC signal is detected, indicating that the sample contains A1 type β-tubulin gene; both FAM and VIC signals are detected, indicating that the sample contains A1 / A2 type β-tubulin gene.

[0058] (7) Specificity After adding different types of DNA, the fluorescent quantitative PCR results are as follows Figure 10A and Figure 10B , and the specific amplification data are shown in Table 4. Only FAM (A1) signal is detected in yellow cattle, so only A1 type β-tubulin gene is contained; the FAM (A1) signal of yak, buffalo, goat and sheep is greater than 30, and the Figure 10B genotyping result can be determined as no A1 gene is detected; the VIC (A2) signal of yak, buffalo, goat and sheep is detected, i.e. only A2 type β-tubulin is detected, and the signals of the rest of the DNA are not detected, and the results are consistent with the genetic types of related animal sources, so the specificity of the method is good.

[0059] Table 4 Specific amplification result table (7) Detection limit A2 type bovine samples and non-A2 type bovine samples of different proportions were mixed to prepare 10% A2 type bovine samples, 1% A2 type bovine samples, 0.1% A2 type bovine samples, and 0.01% A2 type bovine samples, and the above steps (1) to (6) were adopted. As Figure 11As shown, the average Ct value of VIC (A2) signal of the A2 bovine-derived sample with a content of 0.01% is 32.02, and FAM (A1) signal is not detected, and no specific amplification. Therefore, the detection limit of the method is 0.01%.

[0060] (8) Sensitivity According to the method described in the above steps (1) to step (6), the sensitivity of A1 beta-casein and A2 beta-casein is obtained by fluorescence quantitative PCR detection. As shown in Figure 12 , the correlation coefficient of A1 beta-casein curve is 0.997, and the amplification efficiency is 91.005%, which is within the range of 80%-120%. As shown in Figure 13 , the correlation coefficient of A2 beta-casein curve is 0.997, and the amplification efficiency is 80.516%, which is within the range of 80%-120%. The method involved in the present application shows good sensitivity.

[0061] Example 4 Actual sample detection According to the method described in the above steps (1) to step (6), the actual sample is detected, and Sample 1~Sample6 are six products such as A2 milk, organic milk of a certain brand. As shown in Figure 14A and Figure 14B , as shown in (see Table 5 for specific Ct value), in the case of knowing in advance that all samples contain A2 type beta-casein, various samples also detect A2 type beta-casein (Ct value is less than 35) by this method, and one sample also contains A1 type beta-casein.

[0062] Table 5 Actual sample detection results Although the embodiments of the present application have been shown and described, it can be understood by those skilled in the art that various changes, modifications, replacements and modifications can be made to these embodiments without departing from the principles and spirits of the present application, and the scope of the present application is defined by the appended claims and their equivalents.

Claims

1. A primer probe for identifying A1 / A2-β casein in milk and dairy products, characterized in that: The primer probe includes allele-specific primer A1A2-F, allele-specific primer A1A2-R, probe A2-P, and probe A1-P. The nucleotide sequence of the allele-specific primer A1A2-F is shown in SEQ ID NO.

1. The nucleotide sequence of the allele-specific primer A1A2-R is shown in SEQ ID NO.

2. The nucleotide sequence of probe A2-P is shown in SEQ ID NO.3, The nucleotide sequence of probe A1-P is shown in SEQ ID NO.

4.

2. The primer probe according to claim 1, characterized in that The probe A2-P is modified with locked nucleic acid and MGB probe, and the probe A1-P is modified with MGB probe.

3. A kit for identifying A1 / A2-β casein in milk and dairy products, characterized in that: The kit comprises the primer probe according to claim 1 or 2.

4. A method for identifying A1 / A2-β casein in milk and dairy products using the primer probe according to claim 1 or 2, characterized in that: include: S1. Extract DNA from the sample to be tested; S2. Prepare a fluorescent PCR reaction system using the primer and probe combination of claim 1 or 2, set a positive control, and perform a fluorescent quantitative PCR reaction procedure on the DNA of the sample to be tested; S3. Determine the results based on the Ct value of the fluorescent quantitative PCR reaction program and the allele partitioning result; The positive control is to amplify the DNA of non-milk sample as a template.

5. The method according to claim 4, characterized in that The steps of S1 include: S11, taking a milk sample and placing it in a centrifuge tube for centrifugation, discarding the supernatant and the middle layer, adding PBS buffer to the bottom layer, and mixing the precipitate; S12, transfer the precipitate from step S11 in the centrifuge tube to another centrifuge tube, centrifuge, and take the precipitate; S13, taking the precipitate from step S12, adding a mixture of an emulsifier and PBS buffer, washing the precipitate, and taking the precipitate; S14, taking the precipitate from step S13, placing it in a constant temperature water bath, centrifuging it, and taking the precipitate; S15. Take the precipitate from step S14, add PBS buffer, wash the precipitate, and centrifuge to obtain the precipitate as the DNA of the sample to be tested.

6. The method according to claim 5, characterized in that The emulsifier comprises the following components: Triton-X100, 95% ethanol and sodium chloride solution.

7. The method according to claim 5, characterized in that In the step S11, the centrifugal speed is 5000-20000 rpm, and the centrifugal time is 3-8 min; In the step S12, the centrifugal speed is 5000-20000 rpm, and the centrifugal time is 3-8 min; In the step S14, the centrifugal speed is 5000-20000 rpm, and the centrifugal time is 3-8 min; In the step S15, the centrifugal speed is 5000-20000 rpm, the centrifugal time is 5-15 min, and the centrifugal temperature is 2-5°C.

8. The method according to claim 5, characterized in that The temperature of the constant temperature water bath is 30-50° C., and the time of the constant temperature water bath is 5-15 min.

9. The method according to claim 4, characterized in that The fluorescence quantitative PCR reaction procedure was as follows: reaction at 95° C. for 30 s, annealing at 55° C. for 30 s, and amplification for 40 cycles.

10. The method according to claim 4, characterized in that The criteria for determining the results are: When the Ct value of the sample to be tested is less than 40, a fluorescent signal is detected, a typical amplification curve appears, and the typing result is clear, the sample is judged to be positive; When the Ct value of the sample to be tested is ≥40, there is no typical amplification curve, and the typing result is clear, the sample is judged to be negative.

Images