Composition, kit and detection method for detecting Marek's disease virus
By combining the CRISPR/Cas14a system with RPA technology, designing specific RPA primers and sgRNA, and utilizing the targeted cleavage activity of the Cas14a protein, high-specificity and high-sensitivity detection of Marek's disease virus was achieved, solving the problems of non-specific amplification and equipment dependence in existing technologies, and providing a fast and simple on-site diagnostic tool.
Patent Information
- Application Number
- CN202511062950.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-30
- Publication Date
- 2025-10-17
AI Technical Summary
Existing RPA technology has problems with nonspecific amplification and aerosol contamination in Marek's disease virus detection, making it difficult to effectively distinguish vaccine strains such as CVI988 and 814. It also requires expensive equipment and professional operators and cannot meet the needs of rapid and accurate diagnosis on-site outside the laboratory.
Combining the CRISPR/Cas14a system with RPA technology, specific RPA primer pairs and sgRNA were designed. The targeted cleavage activity of the Cas14a protein was utilized, combined with ssDNA fluorescent probes to achieve rapid visual detection, and the results were interpreted by fluorescent signals.
It achieves high specificity and high sensitivity detection of Marek's disease virus, can identify epidemic strain infection within 1 hour, reduce economic losses, and does not require expensive equipment, is simple to operate, and has visual results.
Smart Images

Figure CN120796594A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular biology diagnosis, and particularly relates to a field visual reagent kit for detecting Marek's disease virus based on RPA-CRISPR / Cas14a technology. BACKGROUND
[0002] Marek's disease (MD) is an important avian immunosuppressive disease caused by Marek's disease virus (MDV), which causes various functional disorders and can lead to death and tumor formation in infected chickens, causing significant economic losses to the poultry industry. MDV can be divided into three serotypes: Gallid herpesvirus 2 (GaHV-2; i.e. MDV-1), Gallid herpesvirus 3 (GaHV-3; i.e. MDV-2) and Meleagrid herpesvirus 1 (MeHV1; i.e. HVT). Only MDV-1 wild strains are pathogenic and can cause malignant tumors in chickens. The disease is mainly prevented by MD vaccine immunization, and the vaccine strains used for MD clinical immunoprevention in China are mainly MDV-1 type CVI988 / Rispens, 814 strain and HVT type FC-126 strain. Among them, the CVI988 / Rispens vaccine has a high protection index against MD strong virus, super strong virus and ultra super strong virus attack, and is the most widely used and best protective weak vaccine. In recent years, due to the widespread use of vaccines and continuous immune pressure, the virus continues to enhance the virulence and constantly break through the vaccine protection. Early and accurate identification of MD suspected cases can provide an important basis for production enterprises and breeders to take timely measures and reduce losses.
[0003] The common diagnostic methods for detecting MD include virus isolation and culture, serological diagnosis and molecular detection. Virus isolation and culture and identification involve cumbersome steps and a long test cycle, and there are many influencing factors, especially the existence of vaccine strains with strong interference. Serological diagnosis also cannot effectively distinguish whether the field epidemic strain or the vaccine strain exists in the diseased chicken flock or case chicken. Molecular biology methods based on nucleic acid amplification, such as polymerase chain reaction (PCR), can quickly detect multiple batches of samples, greatly shorten the detection time, and have relatively higher accuracy, which plays an important role in the detection of MD and overcomes the shortcomings of the above methods. However, PCR methods require expensive instruments and experienced operators, which are not suitable for areas lacking complex equipment.
[0004] To meet the needs of field diagnosis outside the laboratory, researchers have developed isothermal nucleic acid amplification techniques that do not require temperature conversion, such as loop-mediated isothermal amplification (LAMP) and the recently popular recombinase polymerase amplification (RPA) and other new technologies. RPA technology has the characteristics of rapid, sensitive, specific, multiplex compatible, and constant temperature work at 37-42°C, as well as other isothermal amplification techniques that do not have these characteristics. Since the introduction of RPA technology, it has been widely used in different types of virus detection.
[0005] However, the mismatch tolerance of RPA to primer binding sites may cause non-specific amplification between similar species, making it difficult to effectively distinguish between CVI988 and 814 vaccine strains. And RPA is prone to aerosol contamination after reaction amplification in a non-hermetic environment, causing false positives. In view of this, on the basis of establishing the RPA rapid amplification method, combining the advantages of CRISPR / Cas system for precise editing of genes to detect pathogenic microorganisms has become an important direction for the development of detection technology at present and in the future.
[0006] As a revolutionary gene editing tool, the CRISPR / Cas system provides a new technical path for molecular detection with its diverse effector proteins. CRISPR / Cas14 is the smallest RNA-guided endonuclease discovered so far in the CRISPR / Cas system. The relative molecular mass of effector protein Cas14a is usually between 40-70kDa. Cas14a binds and cleaves single-stranded DNA (ssDNA) targets in a PAM site-independent manner under the guidance of sgRNA. Cas14a further triggers transcleavage activity after binding to the target sequence, degrading non-specific ssDNA. Because the recognition of DNA molecules does not depend on the PAM site, Cas14a has extremely strict requirements for the accuracy of the recognition sequence. A single base mismatch will severely inhibit its cleavage activity, making Cas14a have stronger ability to recognize single nucleotide polymorphism (SNP). In recent years, corresponding sgRNA has been designed for different pathogenic microorganisms, and the Cas14a protein has been used to cleave the target sequence using its cis-cleavage activity. The trans-cleavage activity is combined with various signal reading methods to realize the amplification and rapid reading of the results, making Cas14a have great application potential in pathogen rapid detection.
[0007] However, how to combine the CRISPR / Cas detection technology with LAMP, RPA and other nucleic acid amplification techniques to realize the detection of Marek's disease virus is a technical problem that needs to be solved at present. SUMMARY
[0008] To overcome the above defects, the present application provides a nucleic acid composition for detecting Marek's disease virus, which comprises a RPA primer pair consisting of an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2.
[0009] and a sgRNA comprising a guide sequence for specifically recognizing the target amplified by the RPA primer pair.
[0010] Further, the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 3.
[0011] Further, the guide sequence of the sgRNA is used for specifically recognizing the region of 98-492 nucleotides in the meq gene of MDV-1 type Marek's disease virus, i.e. the region of 5831-6225 nucleotides in the gene sequence of MDV-1 representative strain Md5 (GenBank Acc. No.: AF243438.1).
[0012] A kit for detecting Marek's disease virus, comprising the nucleic acid composition described above, further comprising a Cas14a protein and a ssDNA fluorescent probe, wherein the Cas14a protein is Cas14a1 protein, and the nucleotide sequence of the ssDNA fluorescent probe is shown as SEQ ID NO. 4.
[0013] Further, the kit further comprises RPA basic freeze-dried powder, RPA reaction buffer, deoxyribonucleotide triphosphate mixture and lambda exonuclease.
[0014] The RPA basic freeze-dried powder comprises a recombinase, a single-stranded DNA binding protein and a strand displacement polymerase.
[0015] Further, the kit further comprises a positive control and a negative control.
[0016] The positive control comprises a positive standard plasmid pMD19-T-S-meq of the S-meq gene of the epidemic strain of Marek's disease virus.
[0017] The negative control comprises a negative standard plasmid pMD19-T-L-meq of the L-meq gene of the vaccine strain of Marek's disease virus and nuclease-free water.
[0018] A method for detecting Marek's disease virus, using the nucleic acid composition and the kit described above, comprising the following steps:
[0019] S1, extracting genomic DNA in a sample to be detected;
[0020] S2, using the genomic DNA extracted in S1 as a template, performing isothermal amplification using an RPA primer pair to obtain a target DNA fragment;
[0021] S3, taking the amplification product obtained in S2, adding lambda exonuclease, ssDNA fluorescent probe, Cas14a protein and sgRNA to form a detection system;
[0022] S4, reading the detection signal, and judging the result through the fluorescent signal:
[0023] If a characteristic fluorescent signal appears, the sample to be tested contains Marek's disease virus epidemic strain DNA;
[0024] If no characteristic fluorescent signal appears, the sample to be tested does not contain Marek's disease virus epidemic strain DNA.
[0025] Further, step S2 synchronously sets the following control reactions:
[0026] pMD19-T-S-meq containing the S-meq gene of the Marek's disease virus epidemic strain is used as a template as a positive control, and nuclease-free water and pMD19-T-L-meq containing the L-meq gene of the Marek's disease virus vaccine strain are used as templates as negative control 1 and negative control 2, respectively.
[0027] Compared with the prior art, the present application has the following beneficial effects:
[0028] 1. The primer set has high specificity and good sensitivity, and the kit has the advantages of simple operation, rapid detection, visual results, etc.
[0029] The detection system established based on the RPA-CRISPR / Cas14a technology can realize on-site rapid and visual detection of the MD epidemic strain, and provides a high-efficiency and convenient early differential diagnosis tool for breeding enterprises and breeders, which helps to take preventive measures in time and reduce economic losses caused by the epidemic;
[0030] 2. By using the method of the present application, infected cases in chicken flocks can be successfully detected, and the infection of the epidemic strain in clinical samples can be accurately identified, with a sensitivity of 2.46x10 1 copies / uL, which shortens the operation time and makes the detection time within 1h;
[0031] At the same time, there is no cross reaction for other serotypes of MDV or MDV-1 vaccine strain, and the primer group has high specificity and sensitivity, and the ssDNA fluorescent probe can be used for on-site visual detection of Marek's disease virus, the fluorescence intensity can be quantified by using a wavelength of 470-520nm enzyme-labeled instrument or fluorescence quantitative PCR instrument, or the reaction system amplification product is observed whether it is colored by using a colloidal gold test strip, so that the detection result can be determined, and expensive equipment is not needed, and the cost and time of diagnosis are reduced;
[0032] In conclusion, the primer group has the characteristics of high specificity and good sensitivity, the kit has the advantages of simple operation, rapid detection, visual results and the like. BRIEF DESCRIPTION OF DRAWINGS
[0033] Figure 1 For meq gene sequence conservation analysis of MDV-1 reference strain and RPA primer pair design site diagram.
[0034] Figure 2 For the screening results of the RPA primer for the MDV-1 type strain meq gene.
[0035] Figure 3 For the amplification temperature screening results of the designed MDV-1 type strain RPA primer.
[0036] Figure 4 For the specific amplification results of the designed MDV-1 strain RPA primer.
[0037] Figure 5 For the fluorescence chart of the RPA-CRISPR / Cas14a technology for detecting Marek's disease virus by meq gene target-sgRNA complex.
[0038] Figure 6 For the RPA-CRISPR / Cas14a reaction specificity detection of different strains.
[0039] Figure 7 For the fluorescence chart of the RPA-CRISPR / Cas14a detection of MDV-1 epidemic strain with different concentrations of templates.
[0040] Figure 8 For the fluorescence column chart of the RPA-CRISPR / Cas14a detection of chicken MD suspected case tissue samples. DETAILED DESCRIPTION
[0041] With reference to the accompanying drawings, the technical solutions in the embodiments of the present application will be described clearly and completely. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of the present application.
[0042] The basic principle of the method for detecting Marek's disease virus DNA based on the RPA-CRISPR / Cas14a technology provided by the present application is as follows: the meq gene target sequence of the MDV-1 type strain of Marek's disease virus is first amplified into a specific DNA fragment by the RPA amplification technology, then subjected to λ exonuclease cleavage to form ssDNA, then specifically combined with the sgRNA target fragment, and finally cut the ssDNA fluorescent probe by using the ssDNA non-specific cleavage activity of Cas14a, so as to detect Marek's disease virus through the fluorescence signal.
[0043] Embodiment 1
[0044] The design and screening of the RPA amplification primer are as follows:
[0045] The S-meq and L-meq gene sequences of the MDV-1 representative strain Md5 (GenBank Acc.No.: AF243438.1), vaccine strain CVI988 / Rispens (GenBank Acc.No.: ABF72323.1), vaccine strain 814 (GenBank Acc.No.: JF742597) and other reference strains at home and abroad were queried in the NCBI GenBank database, and sequence alignment was performed by using MeqALign software.
[0046] The results show that the full length of the S-meq gene of the MDV epidemic strain (including Md5 and different pathogenic type strains such as strong strain, super strong strain and extra super strong strain) is 1020 bp, and the full length of the L-meq gene of the vaccine strains CVI988 / Rispens and 814 is 1197 bp. It is found by comparison and analysis that, compared with the S-meq gene of the epidemic strain, the L-meq gene of the vaccine strain has a highly conserved G→T single nucleotide mutation at the 211th site, and this mutation site shows high conservation in all detected MDV epidemic strains and vaccine strains, such as Figure 1As shown in the figure, wherein: A, indicates that the upstream and downstream primers meq-F1 and meq-R3 recognize specific conserved sequences of the meq gene of different pathogenic MDV-1 reference strains; SNP, indicates that the characteristic single nucleotide polymorphism contained in the amplified fragment of the upstream and downstream primers can specifically identify MDV-1 epidemic strains and vaccine strains; B, indicates the relative position of the upstream and downstream primers recognizing the meq gene; the positive and negative arrows indicate the upstream and downstream primers; the numbers indicate the relative position of nucleotides; S-meq, indicates the relatively shorter meq gene of the MDV-1 epidemic strain; L-meq, indicates the relatively longer meq gene of the MDV-1 vaccine strain.
[0047] Therefore, based on the conserved region on both sides of the 211 site of the meq gene, the RPA primer pair for specifically amplifying the site was designed using Primer Premier 5.0 software, and a total of 6 primers (3 upstream primers and 3 downstream primers) were obtained. Among them, the 5' end of the downstream primer was phosphorylated to realize the λ exonuclease enzyme cutting, so as to generate a single-stranded DNA (ssDNA) product that can be specifically recognized and cut by Cas14a protein, and the nucleotide sequences of the primers are shown in the following table:
[0048] Name Sequence 5'-3' meq-F1 AAAGGAAAAGTCACGACATCCCCAACAGCC (as set forth in SEQ ID NO. 1) meq-F2 GCGCTATGCCCTACAGTCCCGCTGACGATC meq-F3 GGAGGAGAAACAGAAGCTGGAAAGGAGGAG meq-R1 p-TTGTCTACATAGTRCGTCTGCTNCCTGCGTC meq-R2 p-CATAGTRCGTCTGCTNCCTGCGTCTTCTCC meq-R3 p-ATGTGGAGCGTTAGGTTCATCCGGTGAGGG (as set forth in SEQ ID NO. 2)
[0049] Table 1
[0050] In Table 1: "p" is the phosphorylation modification of the primer; R is A or C; N is T or C.
[0051] It should be noted that the above primers are synthesized by Sheng Wu Biotechnology (Shanghai) Co., Ltd., and the synthesized primers are diluted to a working concentration of 10 uM with sterilized ultrapure water, and the optimal primer pair is screened through RPA reaction.
[0052] The preparation of S-meq and L-meq gene standard plasmids is shown as follows:
[0053] PCR primer pairs were designed to amplify the full-length S-meq gene of the MDV-1 epidemic strain international representative strain Md5 and the full-length L-meq gene of the vaccine strain CVI988 / Rispens. After 1% agarose gel electrophoresis analysis, the PCR products were recovered, pMD19-T was used as a carrier to construct positive plasmid pMD19-T-S-meq and negative plasmid pMD19-T-L-meq, respectively. The above plasmids were transformed into DH5α competent cells, single colonies were picked for PCR identification, and samples were sent to Sheng Wu Biotechnology (Shanghai) Co., Ltd. for sequencing.
[0054] The primer sequence information is shown in the following table:
[0055] Name Sequence 5'-3' PCR-meq-F TGCTGGAATGTTAAGAATAAATTCCGCAC PCR-meq-R TTATCTCATACTTCGGAACTCCTGG
[0056] Table 2
[0057] The above table is the PCR amplification primer of S-meq and L-meq gene.
[0058] The PCR reaction system is shown in the following table:
[0059] Reagent Amount 2x Easy Taq PCR SuperMix (+dye) 25 uL Upstream primer (10 uM) 2 uL Downstream primer (10 uM) 2 uL Virus DNA template (10 ng / uL) 1-2 uL ddH2O Up to 50 uL
[0060] Table 3
[0061] The above table is the PCR amplification system of S-meq and L-meq gene.
[0062] The PCR reaction program is: pre-denaturation 94℃ 4min; denaturation 94℃ 30s, annealing 56℃ 30s, extension 72℃ 1min; 72℃ extension 5min; the subsequent plasmid construction and identification are carried out according to the conventional method; finally, shake bacteria culture, extract plasmid, and measure the concentration of plasmid pMD19-T-S-meq and pMD19-T-S-meq by ultraviolet spectrophotometer, both of which are diluted to 10ng / uL and stored at-20℃ for standby.
[0063] The screening and amplification detection of RPA primer are as follows:
[0064] 1μL positive standard plasmid pMD19-T-S-meq as template, using table 1 primer for RPA amplification, reaction condition is 37℃, 20min, the result is shown in Figure 2 , wherein: lanes 1-9 are nucleic acid electrophoresis identification of positive standard plasmid sample; M, represents DNA Marker; 1, represents upstream and downstream primer meq-F1 and meq-R1; 2, represents upstream and downstream primer meq-F1 and meq-R2; 3, represents upstream and downstream primer meq-F1 and meq-R3; 4, represents upstream and downstream primer meq-F2 and meq-R1; 5, represents upstream and downstream primer meq-F2 and meq-R2; 6, represents upstream and downstream primer meq-F2 and meq-R3; 7, represents upstream and downstream primer meq-F3 and meq-R1; 8, represents upstream and downstream primer meq-F3 and meq-R2; 9, represents upstream and downstream primer meq-F3 and meq-R3, which shows that among the 9 combinations of 3 pairs of primers, the amplification efficiency of meq-F1 / R3 primer pair is optimal;
[0065] Further temperature gradient experiment is shown in Figure 3As shown in the figure, wherein: M represents DNA Marker; 1 amplification temperature is 35℃; 2 amplification temperature is 36℃; 3 amplification temperature is 37℃; 4 amplification temperature is 38℃; 5 amplification temperature is 39℃; 6 amplification temperature is 40℃, which proves that the primer pair can realize effective amplification in the range of 35-40℃, and the amplification effect of 37℃ and 38℃ is the best.
[0066] The genomic DNA of MDV international standard virulent strain Md5, vaccine strain CVI988 / Rispens and HVT was extracted by using the DNA extraction kit of Tiangeng Biotechnology Co., Ltd. according to the operation steps of the instruction manual, and the amplification template was obtained by dissolving 50 μL ultrapure water. Using the genomic DNA of each strain as a template, specific RPA primers meq-F1 / R3 were used for amplification. As shown in the figure, wherein: M represents DNA Marker; 1 is DEPC water negative control; 2-7 are genomic samples of MDV-1 epidemic strain GX0101, MDV-1 vaccine strain CVI988 / Rispens, HVT vaccine strain, MDV-1 epidemic strain GX0101+ vaccine strain CVI988 / Rispens, MDV-1 epidemic strain GX0101+ HVT vaccine strain, MDV-1 vaccine strain CVI988 / Rispens+ HVT vaccine strain, respectively. The primer pair can specifically amplify the genomic DNA of the above MDV-1 type strains, indicating that it has good detection specificity. The RPA reaction system is shown in the following table: Figure 4
[0067]
[0068]
[0069] Table 4
[0070] The design and preparation of sgRNA are as follows:
[0071] According to the sequence analysis and alignment results of the above S-meq and L-meq genes, sgRNA was designed on both sides of the 211th site of gene mutation; pre-sgRNA contains a repeated region at the 5' end, a target sequence and a Cas14a protein binding sequence at the 3' end. The pre-sgRNA sequence was constructed into a pUC57 plasmid (containing a T7 promoter);
[0072] The upstream primer sgRNA-PCR-F and the downstream primer sgRNA-PCR-R were designed using the pUC57-sgRNA plasmid as the amplification template, and the primer sequences are shown in the following table:
[0073] Name Sequence 5'-3' sgRNA-PCR-F TCTCGCGCGTTTCGGTGATGACGG sgRNA-PCR-R ATCGTGACGCCGCTCGGAGAGTTGC
[0074] Table 5
[0075] The PCR amplification product was recovered, and 1 ug was used as a transcription template after detecting the concentration using a spectrophotometer. The sgRNA transcription system is shown in the following table:
[0076]
[0077]
[0078] Table 6
[0079] The sgRNA was obtained by using T7 transcription enzyme. After overnight transcription at 37°C, the template DNA was degraded by RNase-free DNase I. The obtained sgRNA was purified using a column RNA rapid purification kit (Quants Biosciences Co., Ltd.), and the concentration was measured using a spectrophotometer. The sgRNA was stored at -80°C for standby use. The nucleotide sequence of the sgRNA is shown in SEQ ID NO. 3, and is specifically as follows:
[0080]
[0081] It should be noted that in the electronic sequence list submitted according to the ST.26 format, the U (u) in the SEQ ID NO. 3 sequence list is uniformly replaced by T.
[0082] In summary, the nucleic acid composition for detecting the Marek's disease virus includes an RPA primer pair composed of an upstream primer and a downstream primer, and an sgRNA containing a guide sequence for specifically recognizing a target amplified by the RPA primer pair.
[0083] Example 2
[0084] For the product (kit) used for detection, the core components are the nucleic acid composition described in Example 1, and Cas14a1 protein and ssDNA fluorescent probe, the nucleotide sequence of which is shown in SEQ ID NO. 4, and the fluorescent group 6-FAM and the quencher group BHQ1 are modified at both ends, respectively. The complete structure of SEQ ID NO. 4 is: 6-FAM-TTTTTTTTTTTT-BHQ 1. The auxiliary components are RPA basic freeze-dried powder (containing recombinase, single-stranded DNA binding protein and strand displacement polymerase), RPA reaction buffer (protein reaction buffer), deoxynucleotide triphosphate mixture, lambda exonuclease and enzyme digestion buffer (Reaction Buffer), which are specifically as follows:
[0085] After the genomic DNA of each virus sample was extracted according to the method in Example 1 (DNA extraction kit of Shanghai Generay Biotech Co., Ltd.), the concentration of the genomic DNA was determined by a Nanodrop spectrophotometer, and the RPA amplification conditions and system in Example 1 were referred to for amplification. The CRISPR / Cas14a detection system was prepared according to the component ratio shown in the following table by taking the amplification product as a template:
[0086] Name Amount Template (10 uM) 0.5 uL Lambda exonuclease 1 uL 10x Reaction Buffer 2 uL 10x Protein Reaction Buffer 2 uL Cas14a1 protein (10 uM) 0.5 uL sgRNA (SEQ ID NO. 3) (10 uM) 0.5 uL ssDNA fluorescent probe (SEQ ID NO. 4) (10 uM) 0.5 uL RNase-free water Up to 20 uL
[0087] Table 7
[0088] Note: Cas14a1 protein from Sangon Biotech (Shanghai) Co., Ltd., item number C620038-1000; Lambda exonuclease from Thermo Fisher Scientific, item number: EN0562.
[0089] Control products, including positive control and negative control, are also needed. The positive control contains a positive standard plasmid pMD19-T-S-meq of the S-meq gene of the epidemic strain of MDV; and the negative control contains nuclease-free water (DEPC water) and a negative standard plasmid pMD19-T-L-meq of the L-meq gene of the vaccine strain of MDV.
[0090] Example 3
[0091] Based on the schemes in Example 1 and Example 2, the method for detecting Marek's disease virus is as follows:
[0092] S1, extracting genomic DNA in a sample to be detected to obtain a DNA template to be tested;
[0093] S2, recombinase polymerase amplification (RPA):
[0094] Taking the genomic DNA extracted in S1 as a template, specific primer pairs were used for isothermal amplification in an RPA reaction system (the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 2), to obtain a large amount of DNA amplification product containing a target gene (such as S-meq);
[0095] S3, construction and reaction of CRISPR / Cas14a detection system:
[0096] Taking the amplification product obtained in S2, λ exonuclease, ssDNA fluorescent probe (nucleotide sequence: SEQ ID NO. 4), Cas14a protein and sgRNA were added to form a detection system, and incubation was performed at a suitable temperature (37°C);
[0097] S4, signal detection and result determination:
[0098] The fluorescence intensity value is read every 4 minutes by a fluorescence detection device (fluorescence quantitative PCR instrument), 30 times, and is interpreted according to the following criteria:
[0099] A positive control (PC, such as a plasmid containing the S-meq gene) and a negative control (NC, such as a plasmid containing the L-meq gene or nuclease-free water) are set up;
[0100] (1) If the fluorescence intensity value of the sample to be tested is significantly higher than that of the negative control (for example, more than 3 times higher) or reaches the preset positive judgment threshold (for example, 600 a.u.) within the preset detection time, it is determined that the sample to be tested contains the DNA of the epidemic strain of Marek's disease virus, and is a positive result, as shown in Figure 5 ;
[0101] (2) If the fluorescence intensity value of the sample to be tested has no significant difference from the negative control, it is determined that the sample to be tested does not contain the DNA of the epidemic strain of Marek's disease virus, and is a negative result.
[0102] It should be noted that in the specificity verification experiment, in addition to using the genomic DNA of MDV international standard virulent strain Md5, vaccine strain CVI988 / Rispens and HVT extracted in Example 1 as the detection template, chicken Newcastle disease virus (NDV) and infectious bursal disease virus (IBDV) genomic DNA are also added as specificity controls, and DEPC water is used as a negative control. The RPA-CRISPR / Cas14a detection system is used for specificity verification, and the results show (as shown in Figure 6 ) that the system produces a significant fluorescence signal for samples containing Md5 genome, while no fluorescence reaction is detected for MDV-1 vaccine strain, other viruses and negative control.
[0103] The experiment proves that the detection method has high specificity, no cross reaction, and can realize visual detection.
[0104] In the sensitivity verification experiment, the standard plasmid pMD19-T-S-meq (3712 bp) of Example 1 is gradient diluted to prepare a series of dilution templates with a concentration range of 2.46×10 0 to 2.46×10 8 copies / μL (the specific concentration gradient is: 2.46×10 8 , 2.46×10 7 , 2.46×10 6 , 2.46×10 5 , 2.46×10 4 , 2.46×10 3 , 2.46×10 2,2.46×10 1 ,2.46×10 0 copies / μL), the sensitivity test was carried out using the RPA-CRISPR / Cas14a detection system, as shown in Figure 7 ,2.46×10 1 to 2.46×10 8 copies / μL, the fluorescence signal with significant difference from the negative control can be observed within 8 min of reaction; compared with the negative control, the fluorescence intensity has statistical difference (one way ANOVA test, P<0.001; the fluorescence value has exceeded more than 3 times of the negative control).
[0105] The results show that the detection method can detect Marek's disease virus DNA within the shortest 8 min, with extremely high sensitivity, reaching 2.46×10 1 copies / μL.
[0106] Copy number calculation formula:
[0107] Copy number concentration (copies / μL) = [6.02×10 23 ×10 (ng / μL) ×10 -9 ] / [3712 (bp) ×660] = 2.46×10 9 copies / μL (initial concentration).
[0108] The detection method is used for the proof of MD clinical cases in laying hen flocks:
[0109] The case comes from a poultry breeding farm laying hen flock, 120 days old, with an incidence rate of about 15%, and clinical autopsy of 6 cases of different degrees of hepatosplenomegaly.
[0110] 10 chickens were randomly numbered as A01, A02, A03, A04, A05, A06, and each chicken was taken about 10 mg of spleen sample into a 1.5 ml sterile centrifuge tube, 200 uL of PBS solution was added, and the frozen tissue grinder was ground for 3 min, 10000 rpm centrifuged for 1 min, the supernatant was discarded, and the DNA of each spleen tissue grinding liquid precipitate sample was extracted according to the instructions of the cell / tissue / blood genomic DNA extraction kit (Tiangen Biochemical), the concentration was determined, and the sample was stored at -20℃ for detection.
[0111] The above samples were detected according to the RPA-CRISPR / Cas14a detection system and reaction conditions established in Example 2 (as shown in Figure 8The detection results show that the positive control (PC) detects effective fluorescent signal relative to the negative controls (NC1) and (NC2), indicating that the monitoring system is effective; meanwhile, the samples of the sick chickens numbered A01-A6 all detect effective fluorescent signal, and it can be concluded that the chicken population in the farm is sick due to infection of the MDV-1 epidemic strain.
[0112] It should be noted that the experimental methods not specified in the examples are selected according to the conventional methods and conditions in the art, or according to the product instructions. The reagents and raw materials not specified in the following examples are commercially available. In the quantitative test in the following examples, three repeated experiments are set up, and the average value is taken.
Claims
1. A nucleic acid composition for detecting Marek's disease virus, characterized in that: The nucleic acid composition includes an RPA primer pair consisting of an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; and sgRNA, comprising a guide sequence for specifically recognizing the target amplified by the RPA primer pair.
2. A nucleic acid composition for detecting Marek's disease virus according to claim 1, characterized in that: The nucleotide sequence of sgRNA is shown in SEQ ID NO.
3.
3. A nucleic acid composition for detecting Marek's disease virus according to claim 2, characterized in that: The guide sequence of the sgRNA is used to specifically recognize the nucleotide region 98-492 in the meq gene of Marek's disease virus MDV-1.
4. A kit for detecting Marek's disease virus, comprising the nucleic acid composition according to any one of claims 1 to 3, characterized in that: It also includes Cas14a protein and ssDNA fluorescent probe.
5. A kit for detecting Marek's disease virus according to claim 4, characterized in that: Cas14a protein is Cas14a1 protein.
6. A kit for detecting Marek's disease virus according to claim 4, characterized in that: The nucleotide sequence of the ssDNA fluorescent probe is shown in SEQ ID NO.
4.
7. A kit for detecting Marek's disease virus according to claim 4, characterized in that: The kit also includes RPAbasic lyophilized powder, RPA reaction buffer, deoxynucleoside triphosphate mix, and lambda exonuclease; RPA basic lyophilized powder contains recombinase, single-stranded DNA binding protein and strand-displacing polymerase.
8. A kit for detecting Marek's disease virus according to claim 4 or 7, characterized in that: The kit also contains positive and negative controls; The positive control contains the positive standard plasmid pMD19-TS-meq, which contains the S-meq gene of the epidemic strain of Marek's disease virus; The negative control contains the negative standard plasmid pMD19-TL-meq containing the L-meq gene of the Marek's disease virus vaccine strain and nuclease-free water.
9. A method for detecting Marek's disease virus, using the nucleic acid composition of claims 1 to 3 and the kit of claims 4 to 7, comprising the following steps: S1. Extracting genomic DNA from the sample to be tested; S2, using the genomic DNA extracted from S1 as a template, isothermal amplification was performed using RPA primer pairs to obtain the target DNA fragment; S3, take the amplified product obtained in S2, add λ exonuclease, ssDNA fluorescent probe, Cas14a protein and sgRNA to form a detection system; S4. Read the detection signal and interpret the result based on the fluorescence signal: If a characteristic fluorescent signal appears, the sample to be tested contains DNA of the epidemic strain of Marek's disease virus; If no characteristic fluorescent signal appears, the sample to be tested does not contain DNA of the epidemic strain of Marek's disease virus.
10. A method for detecting Marek's disease virus according to claim 9, characterized in that: Step S2 simultaneously sets up the following control reactions: pMD19-TS-meq containing the S-meq gene of the epidemic strain of Marek's disease virus was used as a template as a positive control, and nuclease-free water and pMD19-TL-meq containing the L-meq gene of the vaccine strain of Marek's disease virus were used as templates as negative controls 1 and 2, respectively.
Citation Information
Cited By
Primer pair and kit for detecting Marek's disease virus MEQ gene as well as detection method and application thereof
CN121472489A