Cyclic peptide or salt thereof, and use thereof

Abstract

The present invention addresses the problem of providing a cyclic peptide or a salt thereof and a cyclic peptide complex or a salt thereof having excellent binding properties with an FGFR protein, and of providing a culture medium composition, a purification material, a labeling material, a cell control material, and an integration material using the cyclic peptide or the salt thereof and the cyclic peptide complex or the salt thereof. According to the present invention, provided is a cyclic peptide or a salt thereof, which comprises an amino acid sequence represented by X1-Xm-X2-Xn-X3 and comprises a cyclization part that is cyclized by a covalent bond, the cyclization part comprising a structure represented by formula (2), X1 represents a glutamine residue or a histidine residue, Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues, and Xn represents a peptide residue comprising 2 to 4 arbitrary amino acid residues. X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue, or a histidine residue, Xn represents an amino acid residue or a peptide residue comprising any one to three amino acid residues, x3 represents an amino acid residue containing an aromatic residue in a side chain, Z1 and Z2 each independently represent a linking group, and m represents an integer of 1-10.

Description

Technical Field

[0001] The present invention relates to a cyclic peptide or a salt thereof having excellent bonding properties and excellent stability with FGFR (Fibroblast Growth Factor Receptor) proteins. The present invention also relates to a cyclic peptide complex or a salt thereof formed by linking two or more molecules of the cyclic peptide or a salt thereof via a linker. The present invention also relates to the use of the cyclic peptide or a salt thereof and the cyclic peptide complex or a salt thereof. Background Art

[0002] As a treatment for diseases that cannot be treated with previous low-molecular-weight drugs and antibody drugs, the development of cell therapy products that inject cells with healing functions into the body is underway. Moreover, in recent years, as a measure to cope with the food crisis and greenhouse gases, research and development towards the practical application of cell products such as cultured meat (cell agriculture) or cells for drug development support is underway. In the research and manufacture of these cell therapy products and cell products, it is important to enable cells to proliferate effectively while maintaining qualities such as undifferentiated ability. Among the components of the culture medium used for cell proliferation, the protein group called growth factors (also called growth factors, cytokines) is an important component that has a great influence on the quality and cell proliferation rate. However, growth factors are generally very expensive and have low stability, which is the reason for the high manufacturing cost of cell therapy products and cell products. In particular, the production of cultured meat requires costs and is difficult to produce commercially. A very important cost factor is that a large amount of special cell culture medium is required, especially appropriate growth factors that tend to be the most expensive component in the cell culture medium. Currently, most of the production costs (up to 96% or more) are affected by the cost of growth factors, making production economically unfeasible.

[0003] Among growth factors, fibroblast growth factor (FGF) is known to play a crucial role in maintaining the undifferentiated capacity and promoting cell proliferation in a wide range of cells. Among them, basic fibroblast growth factor (bFGF) is widely used to promote the proliferation of mesenchymal stem cells (MSCs), which make up the majority of cell therapy products. It is also widely used as a crucial component for maintaining the undifferentiated capacity and promoting the proliferation of induced pluripotent stem cells (iPSCs) and adult stem cells.

[0004] The maintenance of bFGF's undifferentiated potential and growth-promoting effects are driven by the binding of the bFGF FGFR (Fibroblast Growth Factor Receptor) protein to its extracellular domain. Therefore, to reduce the price of bFGF and improve its stability, research has long focused on substances that bind to the extracellular domain of the FGFR protein.

[0005] Patent Document 1 describes a disulfide-type cyclic peptide that bonds to FGFR protein. Patent Document 2 describes a thioether-type cyclic peptide that has both good bonding properties and stability in proteins other than FGFR.

[0006] Prior art literature

[0007] Patent Literature

[0008] Patent Document 1: International Publication No. WO2000 / 003245

[0009] Patent Document 2: Japanese Patent Application Laid-Open No. 2017-95443 Summary of the Invention

[0010] Technical issues to be solved by the invention

[0011] The peptide described in Patent Document 1 has significantly low binding properties to FGFR proteins and is not practical. Furthermore, the disulfide bonds contained in disulfide-bonded cyclic peptides are known to be unstable and easily degraded in cell culture environments. Furthermore, when combining the amino sequence that binds to FGFR in Patent Document 1 with the stable thioether bond of Patent Document 2, the binding properties to FGFR proteins are significantly low, making them impractical.

[0012] The present invention aims to provide a cyclic peptide or salt thereof, or a cyclic peptide complex or salt thereof, that exhibits excellent binding properties to FGFR proteins. Furthermore, the present invention aims to provide a culture medium composition, culture medium additive, purification material, labeling material, cell control material, and integration material utilizing the cyclic peptide or salt thereof, or the cyclic peptide complex or salt thereof.

[0013] Means for solving technical problems

[0014] The present inventors conducted intensive research to address the above-mentioned issues and discovered that cyclic peptides containing specific amino acid residues at specific positions in their amino acid sequences exhibit excellent binding properties to FGFR proteins. The present invention was completed based on this finding. According to the present invention, the following invention is provided.

[0015] <1> A cyclic peptide or a salt thereof, comprising an amino acid sequence represented by X1-Xm-X2-Xn-X3 and a cyclized portion cyclized by a covalent bond, wherein the cyclized portion comprises a structure represented by formula (2).

[0016] [Chemical Formula 1]

[0017]

[0018] X1 represents a glutamine residue or a histidine residue,

[0019] Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues,

[0020] X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue,

[0021] Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0022] X3 represents an amino acid residue containing an aromatic residue in its side chain.

[0023] Z1 and Z2 each independently represent a linking group,

[0024] m represents an integer of 1 to 10.

[0025] <2> The cyclic peptide or a salt thereof according to <1>, which is represented by the following formula (1-1) or (1-2).

[0026] [Chemical Formula 2]

[0027]

[0028] Where,

[0029] W represents -Xm-X1-Y1- or Xk, wherein Xm is bonded to X2, and Y1 is bonded to CO.

[0030] In the case where W is -Xm-X1-Y1, V represents -NH-Y3, and L0 represents L, or V represents R, and L0 represents L1,

[0031] In the case where W represents Xk, V represents -NH-X1-Y5, and L0 represents L.

[0032] V1 represents -NH-Y3 or R,

[0033] When V1 represents -NH-Y3, L0 represents L, and when V1 represents R, L0 represents L1.

[0034] X1 represents a glutamine residue or a histidine residue,

[0035] Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues,

[0036] Xk represents a peptide residue comprising 1 to 3 arbitrary amino acid residues,

[0037] X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue,

[0038] Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0039] Xi represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues,

[0040] X3 represents an amino acid residue containing an aromatic residue in the side chain,

[0041] Y1 represents a single bond or an amino acid residue or peptide residue containing 1 to 10 arbitrary amino acid residues,

[0042] Y2 represents a single bond or an amino acid residue or peptide residue containing 1 to 12 arbitrary amino acid residues,

[0043] Y3 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0044] Y4 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0045] Y5 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0046] Y6 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0047] L and L1 represent the cyclization part,

[0048] R represents the side chain structure of the amino acid,

[0049] The amino terminal of X1 is bonded to the carboxyl terminal of Y1, and the carboxyl terminal of X1 is bonded to the amino terminal of Xm.

[0050] <3> The cyclic peptide or a salt thereof according to <1>, which is represented by the following formula (1A), formula (1B) or formula (1C).

[0051] [Chemical Formula 3]

[0052]

[0053] Where,

[0054] X1 represents a glutamine residue or a histidine residue,

[0055] Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues,

[0056] Xk represents a peptide residue comprising 1 to 3 arbitrary amino acid residues,

[0057] X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue,

[0058] Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0059] Xi represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues,

[0060] X3 represents an amino acid residue containing an aromatic residue in the side chain,

[0061] Y1 represents a single bond or an amino acid residue or peptide residue containing 1 to 10 arbitrary amino acid residues,

[0062] Y2 represents a single bond or an amino acid residue or peptide residue containing 1 to 12 arbitrary amino acid residues,

[0063] Y3 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0064] Y4 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0065] Y5 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0066] Y6 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0067] V represents -NH-Y3 or R. When V is -NH-Y3, L0 represents L. When V is R, L0 represents L1.

[0068] V1 represents -NH-Y3 or R. When V1 is -NH-Y3, L0 represents L. When V1 is R, L0 represents L1.

[0069] L and L1 represent the cyclization part,

[0070] R represents the side chain structure of the amino acid,

[0071] The amino terminal of X1 is bonded to the carboxyl terminal of Y1, and the carboxyl terminal of X1 is bonded to the amino terminal of Xm.

[0072] <4> The cyclic peptide or a salt thereof according to <1>, which is represented by the following formula (1A1), formula (1A2), formula (1B), formula (1C1), or formula (1C2).

[0073] [Chemical Formula 4]

[0074]

[0075] Where,

[0076] X1 represents a glutamine residue or a histidine residue,

[0077] Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues,

[0078] Xk represents a peptide residue comprising 1 to 3 arbitrary amino acid residues,

[0079] X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue,

[0080] Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0081] Xi represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues,

[0082] X3 represents an amino acid residue containing an aromatic residue in the side chain,

[0083] Y1 represents a single bond or an amino acid residue or peptide residue containing 1 to 10 arbitrary amino acid residues,

[0084] Y2 represents a single bond or an amino acid residue or peptide residue containing 1 to 12 arbitrary amino acid residues,

[0085] Y3 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0086] Y4 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0087] Y5 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0088] Y6 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0089] L and L1 represent the cyclization part,

[0090] R represents the side chain structure of the amino acid,

[0091] The amino terminal of X1 is bonded to the carboxyl terminal of Y1, and the carboxyl terminal of X1 is bonded to the amino terminal of Xm.

[0092] <5> The cyclic peptide or a salt thereof according to <1>, wherein

[0093] Xm represents a group represented by -Xo-X4-,

[0094] Xo represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0095] X4 represents an alanine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue.

[0096] <6> The cyclic peptide or a salt thereof according to <1>, wherein

[0097] Xm represents a group represented by -Xo-X4-,

[0098] Xo represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0099] X4 represents an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue,

[0100] Xk represents a group represented by -Xj-X4-,

[0101] Xj represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues.

[0102] <7> The cyclic peptide or a salt thereof according to <1>, wherein

[0103] Xm represents a group represented by -X5-X6-X4-,

[0104] X5 represents an alanine residue, a proline residue, a leucine residue, an isoleucine residue, a valine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a serine residue, a glutamine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a methionine residue, an amino acid residue containing a thiol group forming a cyclization portion, or an amino acid residue containing a halocarboxyl group forming a cyclization portion,

[0105] X6 represents any amino acid residue,

[0106] X4 represents an alanine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue.

[0107] <8> The cyclic peptide or a salt thereof according to <1>, wherein

[0108] Xm represents a group represented by -X5-X6-X4-,

[0109] X5 represents an alanine residue, a proline residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue or a methionine residue,

[0110] X6 represents any amino acid residue,

[0111] X4 represents an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue,

[0112] Xk represents a group represented by -X6-X4-.

[0113] <9> The cyclic peptide or a salt thereof according to <4>, wherein

[0114] L represents

[0115] [Chemical Formula 5]

[0116]

[0117] [Chemical Formula 6]

[0118]

[0119] The cyclization part represented by , Z11 and Z12 each independently represent a linking group, m represents an integer from 1 to 10, * represents the position of the α carbon atom of the amino acid main chain,

[0120] L1 represents the

[0121] [Chemical Formula 7]

[0122]

[0123] represents the cyclization portion, Z12 represents a linking group, m represents an integer of 1 to 10, and * represents the position of the α-carbon atom of the amino acid main chain.

[0124] <10> The cyclic peptide or a salt thereof according to <1>, wherein

[0125] The number of amino acid residues constituting the loop is 10 to 22.

[0126] <11> The cyclic peptide or a salt thereof according to <1>, wherein

[0127] The cyclized portion contains a homocysteine ​​residue.

[0128] <12> The cyclic peptide or salt thereof according to <1>, comprising any one of the amino acid sequences of SEQ ID NOs. 37 to 450 and SEQ ID NOs. 452 to 454 described in Tables 4 to 6, or

[0129] An amino acid sequence comprising 1 to 4 amino acids substituted, deleted, or inserted into any of the amino acid sequences of SEQ ID NOs: 37 to 450 and SEQ ID NOs: 452 to 454 described in Tables 4 to 6, and having the ability to bind to FGFR protein.

[0130] <13> The cyclic peptide or salt thereof according to <1>, comprising SEQ ID NOs: 37 to 51, 53 to 55, 57 to 61, 63 to 68, 70 to 89, 92 to 93, 103 to 104, 106 to 109, 114 to 115, 117, 119, 121 to 123, 125 to 133, 136 to 181, 187 to 189, 194 to 199, 201 to 203, 205 to 207, 211 to 218, 220 to 235, 237 any one of the amino acid sequences of SEQ ID NOs: 254-270, SEQ ID NO: 272, SEQ ID NOs: 275-276, SEQ ID NOs: 278-291, SEQ ID NOs: 293-324, SEQ ID NOs: 328-337, SEQ ID NO: 339, SEQ ID NOs: 341-354, SEQ ID NO: 356, SEQ ID NOs: 358-360, SEQ ID NOs: 385-386, SEQ ID NOs: 391-392, SEQ ID NOs: 394-398, SEQ ID NO: 400, SEQ ID NOs: 402-403, SEQ ID NOs: 406-407, SEQ ID NOs: 409-411, SEQ ID NO: 430, SEQ ID NOs: 433-435, SEQ ID NOs: 437-444, SEQ ID NOs: 446-450, and SEQ ID NO: 452, or

[0131] Including sequence numbers 37 to 51, sequence numbers 53 to 55, sequence numbers 57 to 61, sequence numbers 63 to 68, sequence numbers 70 to 89, sequence numbers 92 to 93, sequence numbers 103 to 104, sequence numbers 106 to 109, sequence numbers 114 to 115, sequence number 117, sequence number 119, sequence numbers 121 to 123, sequence numbers 125 to 133, sequence numbers 136 to 181, sequence numbers 187 to 189, sequence numbers 194 to 199, sequence numbers 201 to 203, sequence numbers 205 to 207, sequence numbers 211 to 218, sequence numbers 220 to 235, sequence numbers 237 to 250, sequence numbers 254 to 270, sequence number 272, sequence number 275 An amino acid sequence in which 1 to 4 amino acids are substituted, deleted, or inserted in any one of the amino acid sequences of SEQ ID NOs: 276, 278-291, 293-324, 328-337, 339, 341-354, 356, 358-360, 385-386, 391-392, 394-398, 400, 402-403, 406-407, 409-411, 430, 433-435, 437-444, 446-450, and 452, and has the ability to bind to FGFR protein.

[0132] <14> The cyclic peptide or salt thereof according to <1>, comprising SEQ ID NOs: 37 to 42, SEQ ID NO: 45, SEQ ID NOs: 47 to 51, SEQ ID NOs: 53 to 55, SEQ ID NOs: 60 to 61, SEQ ID NO: 63, SEQ ID NOs: 65 to 68, SEQ ID NOs: 71 to 88, SEQ ID NOs: 92 to 93, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NOs: 114 to 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NOs: 125 to 133, SEQ ID NOs: 136 to 170, SEQ ID NOs: 172 to 180, SEQ ID NOs: 187 to 188, SEQ ID NOs: 194 to 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NOs: 205 to 207, SEQ ID NOs: 211 to 212, SEQ ID NO: 214 any one of the amino acid sequences of SEQ ID NOs: 21-220, 220-235, 237-250, 254-260, 262-270, 272, 275, 278-290, 293, 295-324, 328-337, 339, 341-354, 356, 358-360, 391-392, 395, 397, 400, 402, 406, 409-411, 430, 433-435, 437-443, 446-450, and 452, or

[0133] Serial numbers 37 to 42, 45, 47 to 51, 53 to 55, 60 to 61, 63, 65 to 68, 71 to 88, 92 to 93, 106, 108, 114 to 115, 117, 119, 121, 123, 125 to 133, 136 to 170, 172 to 180, 187 to 188, 194 to 199, 201, 203, 205 to 207, 211 to 212, 214 to 218, 220 to 235, 237 to 250, 251 to 257 An amino acid sequence in which 1 to 4 amino acids are substituted, deleted, or inserted in any of the amino acid sequences of SEQ ID NOs: 254-260, SEQ ID NOs: 262-270, SEQ ID NO: 272, SEQ ID NO: 275, SEQ ID NOs: 278-290, SEQ ID NO: 293, SEQ ID NOs: 295-324, SEQ ID NOs: 328-337, SEQ ID NO: 339, SEQ ID NOs: 341-354, SEQ ID NOs: 356, SEQ ID NOs: 358-360, SEQ ID NOs: 391-392, SEQ ID NO: 395, SEQ ID NO: 397, SEQ ID NO: 400, SEQ ID NO: 402, SEQ ID NO: 406, SEQ ID NOs: 409-411, SEQ ID NO: 430, SEQ ID NOs: 433-435, SEQ ID NOs: 437-443, SEQ ID NOs: 446-450, and SEQ ID NO: 452, and having the ability to bind to FGFR protein.

[0134] <15> The cyclic peptide or a salt thereof according to <1>, which is modified with another substance.

[0135] <16> A cyclic peptide complex or a salt thereof, comprising two or more molecules of the cyclic peptide or a salt thereof according to any one of <1> to <15> linked via a linker.

[0136] <17> A cyclic peptide complex or a salt thereof, comprising two molecules of the cyclic peptide or a salt thereof according to any one of <1> to <15> linked via a linker.

[0137] <18> The cyclic peptide complex or a salt thereof according to <16>, which is modified with another substance.

[0138] <19> A culture medium composition or culture medium additive comprising the cyclic peptide or a salt thereof according to any one of <1> to <15>.

[0139] <20> A purification material comprising the cyclic peptide or a salt thereof according to any one of <1> to <15>.

[0140] <21> A labeling material comprising the cyclic peptide or a salt thereof according to any one of <1> to <15>.

[0141] <22> A cell control material comprising the cyclic peptide or a salt thereof according to any one of <1> to <15>.

[0142] <23> An integration material comprising the cyclic peptide or a salt thereof according to any one of <1> to <15>.

[0143] <24> A culture medium composition or culture medium additive comprising the cyclic peptide complex or a salt thereof according to <16>.

[0144] <25> A purification material comprising the cyclic peptide complex or a salt thereof according to <16>.

[0145] <26> A labeling material comprising the cyclic peptide complex or a salt thereof according to <16>.

[0146] <27> A cell control material comprising the cyclic peptide complex or a salt thereof according to <16>.

[0147] <28> An integration material comprising the cyclic peptide complex or a salt thereof according to <16>.

[0148] Effects of the Invention

[0149] The cyclic peptide or a salt thereof of the present invention has excellent bonding properties to FGFR protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0150] Figure 1 The structures of the compounds used in Examples are shown.

[0151] Figure 2 This study demonstrates the cell proliferation promoting effect of the cyclic peptide complex (SEQ ID NO: 458).

[0152] Figure 3 The bovine cell proliferation effect of the cyclic peptide complex (SEQ ID NO: 458) is shown. DETAILED DESCRIPTION

[0153] The present invention is described in detail below. These descriptions and examples illustrate embodiments and do not limit the scope of the embodiments. The mechanism of action described in the present invention includes speculation, and its accuracy does not limit the scope of the embodiments.

[0154] In the present invention, the term "process" or a term representing a process includes processes that are independent of other processes and also encompasses processes that cannot be clearly distinguished from other processes as long as the purpose of the process can be achieved.

[0155] In the present invention, a numerical range expressed using “to” indicates a range including the numerical values ​​before and after “to” as the minimum value and the maximum value, respectively.

[0156] In the numerical ranges described in stages throughout the present invention, the upper limit or lower limit described in one numerical range may be replaced by the upper limit or lower limit of another numerical range described in stages. Furthermore, in the numerical ranges described in the present invention, the upper limit or lower limit of the numerical range may be replaced by the value shown in the Examples.

[0157] <Amino acids, amino acid residues, and peptides>

[0158] In principle, amino acids are represented by names, abbreviations, etc. adopted by the Joint Nomenclature Committee of the International Union of Pure and Applied Chemistry and the International Union of Biochemistry and Molecular Biology (INTERNATIONAL UNION OF PURE AND APPLIED CHEMISTRY and INTERNATIONAL UNION OF BIOCHEMISTRY AND MOLECULAR BIOLOGY IUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN)). In addition, amino acid residues are represented by the abbreviations of the amino acids from which they are derived. In addition, the amino acid residue can be the N-terminal amino acid (N-terminal residue) or the C-terminal amino acid (C-terminal residue).

[0159] Unless otherwise specified, the amino acid sequence (also referred to as "primary structure") of a peptide or protein is represented by a row of amino acid residues arranged from the left end to the right end, from the N-terminus to the C-terminus.

[0160] Examples of amino acids include α-amino acids, β-amino acids, γ-amino acids, and amino acids in which the amino group or the carboxyl group is similarly substituted with a reactive group (for example, substituted with a secondary or tertiary amine of a primary amine or substituted with an ester of a carboxyl group), but are not particularly limited. α-amino acids refer to molecules containing an amino group and a carboxyl group bonded to a carbon designated as an α-carbon. β-amino acids refer to molecules containing both an amino group and a carboxyl group in a β configuration. γ-amino acids refer to molecules containing both an amino group and a carboxyl group in a γ configuration. As amino acids, α-amino acids are preferred.

[0161] As an amino acid, any of natural amino acids or non-natural amino acids can be used, and any of the D- and L-isomers can be used. When an amino acid is represented by its name, and there are isomers in an enantiomeric relationship, i.e., an L-isomer and a D-isomer, unless the distinction between the L-isomer and the D-isomer is explicitly indicated, the L-isomer is generally represented. For example, "isoleucine" represents "L-isoleucine," and the enantiomer of "isoleucine" represents "D-isoleucine." The same applies to amino acid residues.

[0162] Table 1 shows the names and abbreviations (one-letter abbreviation, three-letter abbreviation) of amino acids for which one-letter abbreviations and three-letter abbreviations are officially recognized.

[0163] [Table 1]

[0164]

[0165] The amino acids are not limited to those listed in Table 1, and amino acids called non-natural amino acids can also be used. Examples of non-natural amino acids are listed in Table 2 below, but are not limited to these. In addition, the amino acid may be an N-alkyl amino acid in which the hydrogen atom on the amino group at the N-terminus is replaced by an alkyl group (methyl, propyl, etc.). Examples of N-alkyl amino acids include N-methylleucine (hereinafter, marked as me L).

[0166] [Table 2]

[0167]

[0168] Examples of the amino acid containing an aromatic residue include phenylalanine, tryptophan, tyrosine, histidine, and unnatural amino acids containing a benzene ring, an imidazole ring, or a pyridine ring in the side chain structure, with phenylalanine, tryptophan, and tyrosine being preferred.

[0169] As amino acids, methionine, cysteine, and lysine can be used. However, from the viewpoint of oxidation resistance, it is preferred not to use methionine and cysteine. From the viewpoint of peptide chemical synthesis cost, it is preferred not to include cysteine ​​and lysine.

[0170] A peptide generally refers to a structure consisting of 3 to 100 amino acids linked together, but may also contain structures other than amino acids at its terminals and / or internally. All substances containing 3 to 100 amino acids are peptides.

[0171] A cyclic peptide refers to a peptide containing a closed ring structure consisting of three or more amino acid residues.

[0172] <Cyclic peptide>

[0173] The cyclic peptide of the present invention comprises a peptide having an amino acid sequence represented by X1-Xm-X2-Xn-X3 and comprises a cyclized portion cyclized by a covalent bond, wherein the cyclized portion comprises a structure represented by formula (2).

[0174] [Chemical Formula 8]

[0175]

[0176] X1 represents a glutamine residue or a histidine residue,

[0177] Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues,

[0178] X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue,

[0179] Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0180] X3 represents an amino acid residue containing an aromatic residue in its side chain.

[0181] Z1 and Z2 each independently represent a linking group,

[0182] m represents an integer of 1 to 10.

[0183] The cyclic peptide of the present invention is preferably represented by the following formula (1-1) or formula (1-2).

[0184] [Chemical Formula 9]

[0185]

[0186] Where,

[0187] W represents -Xm-X1-Y1- or Xk, wherein Xm is bonded to X2, and Y1 is bonded to CO.

[0188] In the case where W is -Xm-X1-Y1, V represents -NH-Y3, and L0 represents L, or V represents R, and L0 represents L1,

[0189] In the case where W represents Xk, V represents -NH-X1-Y5, and L0 represents L.

[0190] V1 represents -NH-Y3 or R,

[0191] When V1 represents -NH-Y3, L0 represents L, and when V1 represents R, L0 represents L1.

[0192] X1 represents a glutamine residue or a histidine residue,

[0193] Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues,

[0194] Xk represents a peptide residue comprising 1 to 3 arbitrary amino acid residues,

[0195] X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue,

[0196] Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0197] Xi represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues,

[0198] X3 represents an amino acid residue containing an aromatic residue in the side chain,

[0199] Y1 represents a single bond or an amino acid residue or peptide residue containing 1 to 10 arbitrary amino acid residues,

[0200] Y2 represents a single bond or an amino acid residue or peptide residue containing 1 to 12 arbitrary amino acid residues,

[0201] Y3 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0202] Y4 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0203] Y5 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0204] Y6 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0205] L and L1 represent the cyclization part,

[0206] R represents the side chain structure of the amino acid,

[0207] The amino terminal of X1 is bonded to the carboxyl terminal of Y1, and the carboxyl terminal of X1 is bonded to the amino terminal of Xm.

[0208] The cyclic peptide of the present invention is preferably represented by the following formula (1A), formula (1B) or formula (1C).

[0209] [Chemical Formula 10]

[0210]

[0211] Where,

[0212] X1 represents a glutamine residue or a histidine residue,

[0213] Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues,

[0214] Xk represents a peptide residue comprising 1 to 3 arbitrary amino acid residues,

[0215] X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue,

[0216] Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0217] Xi represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues,

[0218] X3 represents an amino acid residue containing an aromatic residue in the side chain,

[0219] Y1 represents a single bond or an amino acid residue or peptide residue containing 1 to 10 arbitrary amino acid residues,

[0220] Y2 represents a single bond or an amino acid residue or peptide residue containing 1 to 12 arbitrary amino acid residues,

[0221] Y3 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0222] Y4 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0223] Y5 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0224] Y6 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0225] V represents -NH-Y3 or R. When V is -NH-Y3, L0 represents L. When V is R, L0 represents L1.

[0226] V1 represents -NH-Y3 or R. When V1 is -NH-Y3, L0 represents L. When V1 is R, L0 represents L1.

[0227] L and L1 represent the cyclization part,

[0228] R represents the side chain structure of the amino acid,

[0229] The amino terminal of X1 is bonded to the carboxyl terminal of Y1, and the carboxyl terminal of X1 is bonded to the amino terminal of Xm.

[0230] The cyclic peptide of the present invention is preferably represented by the following formula (1A1), formula (1A2), formula (1B), formula (1C1), or formula (1C2).

[0231] [Chemical Formula 11]

[0232]

[0233] Where,

[0234] X1 represents a glutamine residue or a histidine residue,

[0235] Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues,

[0236] Xk represents a peptide residue comprising 1 to 3 arbitrary amino acid residues,

[0237] X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue,

[0238] Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0239] Xi represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues,

[0240] X3 represents an amino acid residue containing an aromatic residue in the side chain,

[0241] Y1 represents a single bond or an amino acid residue or peptide residue containing 1 to 10 arbitrary amino acid residues,

[0242] Y2 represents a single bond or an amino acid residue or peptide residue containing 1 to 12 arbitrary amino acid residues,

[0243] Y3 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0244] Y4 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0245] Y5 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0246] Y6 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues,

[0247] L and L1 represent the cyclization part,

[0248] R represents the side chain structure of the amino acid,

[0249] The amino terminal of X1 is bonded to the carboxyl terminal of Y1, and the carboxyl terminal of X1 is bonded to the amino terminal of Xm.

[0250] In a more preferred embodiment,

[0251] Xm represents a group represented by -Xo-X4-,

[0252] Xo represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0253] X4 represents an alanine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue,

[0254] Xk represents a group represented by -Xj-X4-,

[0255] Xj represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues.

[0256] In a more preferred embodiment,

[0257] Xm represents a group represented by -Xo-X4-,

[0258] Xo represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0259] X4 represents an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue,

[0260] Xk represents a group represented by -Xj-X4-,

[0261] Xj represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues.

[0262] In a further preferred embodiment,

[0263] Xm represents a group represented by -X5-X6-X4-,

[0264] X5 represents an alanine residue, a proline residue, a leucine residue, an isoleucine residue, a valine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a serine residue, a glutamine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a methionine residue, an amino acid residue containing a thiol group forming a cyclization portion, or an amino acid residue containing a halocarboxyl group forming a cyclization portion,

[0265] X6 represents any amino acid residue,

[0266] X4 represents an alanine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue,

[0267] Xk represents a group represented by -X6-X4-.

[0268] In a further preferred embodiment,

[0269] Xm represents a group represented by -X5-X6-X4-,

[0270] X5 represents an alanine residue, a proline residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue or a methionine residue,

[0271] X6 represents any amino acid residue,

[0272] X4 represents an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue,

[0273] Xk represents a group represented by -X6-X4-.

[0274] In a further preferred embodiment,

[0275] L represents

[0276] [Chemical Formula 12]

[0277]

[0278] or

[0279] [Chemical Formula 13]

[0280]

[0281] The cyclization part represented by , Z11 and Z12 each independently represent a linking group, m represents an integer from 1 to 10, * represents the position of the α carbon atom of the amino acid main chain,

[0282] L1 represents the

[0283] [Chemical Formula 14]

[0284]

[0285] represents the cyclization portion, Z12 represents a linking group, m represents an integer of 1 to 10, and * represents the position of the α-carbon atom of the amino acid main chain.

[0286] X1 preferably represents a glutamine residue.

[0287] X5 preferably represents a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a histidine residue, an amino acid residue containing a thiol group that forms a cyclized portion, or an amino acid residue containing a halogenated carboxyl group that forms a cyclized portion. X5 more preferably represents a phenylalanine residue, a tyrosine residue, a tryptophan residue, a histidine residue, an amino acid residue containing a thiol group that forms a cyclized portion, or an amino acid residue containing a halogenated carboxyl group that forms a cyclized portion. X5 particularly preferably represents a phenylalanine residue, a tyrosine residue, a tryptophan residue, or a histidine residue.

[0288] X preferably represents an alanine residue, a glycine residue, a leucine residue, an isoleucine residue, a valine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a serine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a lysine residue or a methionine residue. X more preferably represents an alanine residue, a glycine residue, a leucine residue, an isoleucine residue, a valine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a serine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a lysine residue or a methionine residue.

[0289] X4 preferably represents an alanine residue, a phenylalanine residue or a tyrosine residue. More preferably, X4 represents a phenylalanine residue or a tyrosine residue.

[0290] X2 preferably represents a leucine residue, an isoleucine residue, a phenylalanine residue or a tyrosine residue. X2 more preferably represents a leucine residue, a phenylalanine residue or a tyrosine residue. X2 especially preferably represents a leucine residue or a phenylalanine residue.

[0291] Xn preferably represents a peptide residue comprising two amino acid residues represented by Xn1-Xn2.

[0292] Xi preferably represents the amino acid residue represented by Xn1.

[0293] Xn1 preferably represents an alanine residue, a glycine residue, a leucine residue, an isoleucine residue, a valine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a serine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a lysine residue or a methionine residue. Xn1 more preferably represents an alanine residue, a leucine residue, an isoleucine residue, a valine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a serine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a lysine residue or a methionine residue.

[0294] Xn2 preferably represents an alanine residue, a glycine residue, a proline residue, a leucine residue, an isoleucine residue, a valine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a serine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a lysine residue, a methionine residue, an amino acid residue containing a thiol group that forms a cyclized portion, or an amino acid residue containing a halogenated carboxyl group that forms a cyclized portion. Xn2 more preferably represents an alanine residue, a glycine residue, a leucine residue, an isoleucine residue, a valine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a serine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a lysine residue, or a methionine residue. Xn2 particularly preferably represents an alanine residue, a leucine residue, a valine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a serine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a lysine residue or a methionine residue.

[0295] X3 preferably represents a phenylalanine residue, a tyrosine residue or a tryptophan residue.

[0296] Y1 preferably represents a group represented by Ym-Y11-Yn,

[0297] Ym represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues,

[0298] Y11 represents an alanine residue, a glycine residue, a tyrosine residue, an asparagine residue, a serine residue, a threonine residue, a glutamic acid residue or a histidine residue,

[0299] Yn represents a peptide residue consisting of five arbitrary amino acid residues.

[0300] Y11 preferably represents an asparagine residue.

[0301] Ym preferably represents an amino acid residue represented by Ym3, a peptide residue comprising two amino acid residues represented by Ym2-Ym3, or a peptide residue comprising three amino acid residues represented by Ym1-Ym2-Ym3. Ym more preferably represents a peptide residue comprising two amino acid residues represented by Ym2-Ym3, or a peptide residue comprising three amino acid residues represented by Ym1-Ym2-Ym3.

[0302] Ym1 preferably represents an alanine residue.

[0303] Ym2 preferably represents an alanine residue or a proline residue.

[0304] Ym3 preferably represents an alanine residue or a glutamine residue.

[0305] Yn preferably represents a peptide residue comprising 5 amino acid residues represented by Yn1-Yn2-Yn3-Yn4-Yn5.

[0306] Yn1 preferably represents an alanine residue or a phenylalanine residue. More preferably, Yn1 represents a phenylalanine residue.

[0307] Yn2 preferably represents an alanine residue or an isoleucine residue. Yn2 more preferably represents an isoleucine residue.

[0308] Yn3 preferably represents an alanine residue or an asparagine residue. More preferably, Yn3 represents an asparagine residue.

[0309] Yn4 preferably represents an alanine residue or a proline residue.

[0310] Yn5 preferably represents an alanine residue or a valine residue.

[0311] Y2 preferably represents a single bond.

[0312] Y3 preferably represents any amino acid residue.

[0313] Y4 preferably represents any amino acid residue.

[0314] Z1 and Z2 each independently represent a linking group, preferably an alkylene group having 1 to 10 carbon atoms, more preferably an alkylene group having 1 to 5 carbon atoms, and particularly preferably an alkylene group having 2 to 4 carbon atoms.

[0315] m preferably represents an integer of 1 to 5, more preferably represents an integer of 1 to 3, and particularly preferably represents an integer of 1.

[0316] Z11 and Z12 each independently represent a linking group, preferably an alkylene group having 1 to 10 carbon atoms, more preferably an alkylene group having 1 to 5 carbon atoms, and particularly preferably an alkylene group having 2 to 4 carbon atoms.

[0317] Cyclic peptides are formed by multiple amino acid residues in the polypeptide chain being bonded to each other through covalent bonds other than the backbone peptide bonds to form a closed ring structure. In a cyclic peptide, the portion of the structure containing these multiple bonded amino acid residues is called the cyclization moiety.

[0318] From the viewpoint of stability, the cyclized portion of the cyclic peptide must not contain a disulfide bond. Examples of cyclized portions that do not contain a disulfide bond include structures containing a thioether bond.

[0319] In the case of forming a thiol bond, for example, a side chain thiol group of an amino acid residue having a thiol group in its side chain can be reacted with a side chain chloroacetyl group of an amino acid residue having a chloroacetyl group in its side chain to form a thiol bond. Specifically, for example, a linear polypeptide can be cyclized by forming a thiol bond between the side chain thiol group of an L-homocysteine ​​residue and the side chain chloroacetyl group of an N-ε-chloroacetyl-L-lysine residue.

[0320] Alternatively, an amino acid having a halocarbonyl group such as a chloropropionyl group in the side chain, in which the number of methylene units is greater than that of the haloacetyl group, may be used instead of an amino acid having a haloacetyl group such as a chloroacetyl group in the side chain. However, the fewer the number of methylene units, the higher the cyclization efficiency, which is preferred. For example, an acetyl group (-C(=O)-CH2-X; X is a halogen atom, the number of methylene units is 1) has a higher cyclization efficiency than a propionyl group (-C(=O)-(CH2)2-X; X is a halogen atom, the number of methylene units is 2), which is preferred.

[0321] When forming a thioether, from the viewpoint of FGFR binding properties, it is more preferable to use an amino acid having a halocarbonyl group in the side chain rather than using an amino acid having a halocarbonyl group in the main chain.

[0322] From the perspectives of stability and suppression of racemate formation during peptide chemical synthesis, the amino acid on the thiol-donating side is preferably homocysteine ​​rather than cysteine. That is, the cyclization moiety preferably contains a homocysteine ​​residue.

[0323] From the viewpoint of FGFR protein binding properties, the number of amino acid residues constituting the ring of the cyclic peptide is preferably 10 to 22, more preferably 14 to 22, and particularly preferably 15 to 20.

[0324] From the perspective of FGFR protein bonding, the amino acids used in the cyclic peptide can be similar structures (generally considered to be similar structures). Similar structures include non-natural amino acids. Non-natural amino acids can be amino acids with extended carbon chains (such as homoserine), amino acids with methyl groups (such as N-methylalanine), and amino acids that have been modified individually or multiple times (such as phosphorylated tyrosine).

[0325] In the cyclic peptide, the amino acid at any unspecified position may be a natural amino acid, a non-natural amino acid, or an amino acid analog (peptide mimetic).

[0326] Specific examples of cyclic peptides include the following:

[0327] comprising any of the amino acid sequences of SEQ ID NOs: 37 to 450 and SEQ ID NOs: 452 to 454 described in Tables 4 to 6, or

[0328] An amino acid sequence comprising 1 to 4 amino acids substituted, deleted, or inserted into any of the amino acid sequences of SEQ ID NOs: 37 to 450 and SEQ ID NOs: 452 to 454 described in Tables 4 to 6, and having the ability to bind to FGFR protein.

[0329] Preferred specific examples of cyclic peptides include the following:

[0330] Including serial numbers 37 to 51, 53 to 55, 57 to 61, 63 to 68, 70 to 89, 92 to 93, 103 to 104, 106 to 109, 114 to 115, 117, 119, 121 to 123, 125 to 133, 136 to 181, 187 to 189, 194 to 199, 201 to 203, 205 to 207, 211 to 218, 220 to 235, 237 to 250, 251 to 257 any one of the amino acid sequences of SEQ ID NOs: 54-270, SEQ ID NOs: 272, SEQ ID NOs: 275-276, SEQ ID NOs: 278-291, SEQ ID NOs: 293-324, SEQ ID NOs: 328-337, SEQ ID NO: 339, SEQ ID NOs: 341-354, SEQ ID NO: 356, SEQ ID NOs: 358-360, SEQ ID NOs: 385-386, SEQ ID NOs: 391-392, SEQ ID NOs: 394-398, SEQ ID NO: 400, SEQ ID NOs: 402-403, SEQ ID NOs: 406-407, SEQ ID NOs: 409-411, SEQ ID NO: 430, SEQ ID NOs: 433-435, SEQ ID NOs: 437-444, SEQ ID NOs: 446-450, and SEQ ID NO: 452, or

[0331] Including sequence numbers 37 to 51, sequence numbers 53 to 55, sequence numbers 57 to 61, sequence numbers 63 to 68, sequence numbers 70 to 89, sequence numbers 92 to 93, sequence numbers 103 to 104, sequence numbers 106 to 109, sequence numbers 114 to 115, sequence number 117, sequence number 119, sequence numbers 121 to 123, sequence numbers 125 to 133, sequence numbers 136 to 181, sequence numbers 187 to 189, sequence numbers 194 to 199, sequence numbers 201 to 203, sequence numbers 205 to 207, sequence numbers 211 to 218, sequence numbers 220 to 235, sequence numbers 237 to 250, sequence numbers 254 to 270, sequence number 272, sequence number 275 An amino acid sequence in which 1 to 4 amino acids are substituted, deleted, or inserted in any one of the amino acid sequences of SEQ ID NOs: 276, 278-291, 293-324, 328-337, 339, 341-354, 356, 358-360, 385-386, 391-392, 394-398, 400, 402-403, 406-407, 409-411, 430, 433-435, 437-444, 446-450, and 452, and has the ability to bind to FGFR protein.

[0332] More preferred specific examples of cyclic peptides include the following:

[0333] Including sequence numbers 37 to 42, sequence number 45, sequence numbers 47 to 51, sequence numbers 53 to 55, sequence numbers 60 to 61, sequence number 63, sequence numbers 65 to 68, sequence numbers 71 to 88, sequence numbers 92 to 93, sequence number 106, sequence number 108, sequence numbers 114 to 115, sequence number 117, sequence number 119, sequence number 121, sequence number 123, sequence numbers 125 to 133, sequence numbers 136 to 170, sequence numbers 172 to 180, sequence numbers 187 to 188, sequence numbers 194 to 199, sequence number 201, sequence number 203, sequence numbers 205 to 207, sequence numbers 211 to 212, sequence numbers 214 to 218, sequence number 22 any one of the amino acid sequences of SEQ ID NOs: 20-235, SEQ ID NOs: 237-250, SEQ ID NOs: 254-260, SEQ ID NOs: 262-270, SEQ ID NO: 272, SEQ ID NO: 275, SEQ ID NOs: 278-290, SEQ ID NO: 293, SEQ ID NOs: 295-324, SEQ ID NOs: 328-337, SEQ ID NO: 339, SEQ ID NOs: 341-354, SEQ ID NO: 356, SEQ ID NOs: 358-360, SEQ ID NOs: 391-392, SEQ ID NO: 395, SEQ ID NO: 397, SEQ ID NO: 400, SEQ ID NO: 402, SEQ ID NO: 406, SEQ ID NOs: 409-411, SEQ ID NO: 430, SEQ ID NOs: 433-435, SEQ ID NOs: 437-443, SEQ ID NOs: 446-450, and SEQ ID NO: 452, or

[0334] Serial numbers 37 to 42, 45, 47 to 51, 53 to 55, 60 to 61, 63, 65 to 68, 71 to 88, 92 to 93, 106, 108, 114 to 115, 117, 119, 121, 123, 125 to 133, 136 to 170, 172 to 180, 187 to 188, 194 to 199, 201, 203, 205 to 207, 211 to 212, 214 to 218, 220 to 235, 237 to 250, 251 to 257 An amino acid sequence in which 1 to 4 amino acids are substituted, deleted, or inserted in any of the amino acid sequences of SEQ ID NOs: 254-260, SEQ ID NOs: 262-270, SEQ ID NO: 272, SEQ ID NO: 275, SEQ ID NOs: 278-290, SEQ ID NO: 293, SEQ ID NOs: 295-324, SEQ ID NOs: 328-337, SEQ ID NO: 339, SEQ ID NOs: 341-354, SEQ ID NOs: 356, SEQ ID NOs: 358-360, SEQ ID NOs: 391-392, SEQ ID NO: 395, SEQ ID NO: 397, SEQ ID NO: 400, SEQ ID NO: 402, SEQ ID NO: 406, SEQ ID NOs: 409-411, SEQ ID NO: 430, SEQ ID NOs: 433-435, SEQ ID NOs: 437-443, SEQ ID NOs: 446-450, and SEQ ID NO: 452, and having the ability to bind to FGFR protein.

[0335] The number of amino acids to be substituted, deleted or inserted may be 1 to 4, preferably 1, 2 or 3, more preferably 1 or 2.

[0336] The binding property to the FGFR protein is expressed by the amount of cyclic peptide bound to the FGFR protein when the cyclic peptide is allowed to act on a certain amount of FGFR protein at a specific concentration. In the present invention, ELISA and SPR methods were used for measurement, but other methods (ITC, alphascreen, etc.) can also be used for similar measurement. The FGFR protein can be full-length, a localized domain, or have mutations introduced.

[0337] Regarding the molecular stability of cyclic peptides, the present invention measures reduction resistance and alkali resistance as indicators, but resistance to other stimuli (e.g., X-ray resistance, gamma-ray resistance, ultraviolet resistance, heat resistance, and chemical resistance) also plays a role. This is because molecular stability basically means that the molecule is more stable in terms of free energy.

[0338] The cyclic peptide may be modified with other substances as exemplified below.

[0339] Cyclic peptides may have 1 to 20 amino acids and / or modified structures. From the perspective of peptide chemical synthesis costs, it is preferred not to have amino acids. From the perspective of stability, it is preferred to have modified structures. Examples of modified structures include acetylation and similar structures at the N-terminus, and amidation and similar structures at the C-terminus.

[0340] The cyclic peptide can be modified by phosphorylation, methylation, adenylation, ADP (adenosine diphosphate) ribosylation, sugar chain addition, or the like depending on the intended use.

[0341] Furthermore, cyclic peptides can be given a functional structure from the perspective of water solubility, stability, ease of separation, and / or ease of tracking. Examples of functional structures include water-soluble polymers such as polyethylene glycol (PEG), IgG and other proteins, various affinity tags (e.g., histidine (His) tags, FLAG tags), solid-phase carriers (e.g., cellulose beads, magnetic beads, various gels), fluorescent dyes, and radioactive isotopes.

[0342] The cyclic peptide may lack amino acids and / or have modified structures. From the perspective of FGFR protein binding, the number of amino acid deletions should be 4 or less, preferably 2 or less, and no deletions are particularly preferred.

[0343] The cyclic peptide of the present invention can be a salt. The salt is preferably a salt with a physiologically acceptable inorganic or organic acid or base. Examples of suitable acid salts include the following: acetate, adipate, benzoate, benzenesulfonate, butyrate, citrate, digluconate, dodecyl sulfate, formate, fumarate, glycolate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, lactate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, pamoate, phosphate, picrate, pivalate, propionate, salicylate, succinate, sulfate, tartrate, toluenesulfonate, trifluoroacetic acid, and undecanoate. Salts derived from suitable bases include alkali metal (e.g., sodium) salts, alkaline earth metal (e.g., magnesium) salts, ammonium salts, and N-(alkyl)4-[4-(amino)-1-[4-(amino)-1-methyl] ... + Salt.

[0344] <Method for producing cyclic peptide>

[0345] The method for producing the cyclic peptide is not particularly limited and can be produced by chemical synthesis, genetic engineering synthesis, or enzymatic synthesis using a cell-free translation system. From the viewpoint of purity, chemical synthesis is more preferred.

[0346] As peptide synthesis based on chemical synthesis, solid phase synthesis can be used, and liquid phase synthesis can also be used. In small-scale synthesis, solid phase synthesis is preferred. Solid phase synthesis using an automatic peptide synthesizer is simple and therefore preferred. In large-scale synthesis, liquid phase synthesis is preferred from the perspective of operability. As a large-scale standard, 1 g or more can be mentioned, but it is not limited to this.

[0347] The solid phase synthesis of peptides is well known to those skilled in the art, for example, the hydroxyl group of a resin having a hydroxyl group is subjected to an esterification reaction with the carboxyl group of a first amino acid (usually, the C-terminal amino acid of the target peptide) whose α-amino group is protected by a protecting group. As an esterification catalyst, well-known dehydration condensation agents such as 1-mesitylenesulfonyl-3-nitro-1,2,4-triazole (MSNT), dicyclohexylcarbodiimide (DCC), and diisopropylcarbodiimide (DIPCDI) can be used. Next, the protecting group of the α-amino group of the first amino acid is removed, and a second amino acid in which all functional groups except the carboxyl group of the main chain are protected is added, the above-mentioned carboxyl group is activated, and the first amino acid and the second amino acid are bonded. Furthermore, the α-amino group of the second amino acid is deprotected, and a third amino acid in which all functional groups except the carboxyl group of the main chain are protected is added, the above-mentioned carboxyl group is activated, and the second amino acid and the third amino acid are bonded. This operation is repeated, and after synthesizing a peptide of the target length, all functional groups are deprotected. As resins for solid phase synthesis, Merrifield resin, MBHA resin, Cl-Trt resin, SASRIN resin, Wangresin, Rink amide resin, HMFS resin, Amino-PEGAresin (Merck), HMPA-PEGAresin (Merck) and the like can be mentioned. These resins can be used after washing with solvents (dimethylformamide (DMF), 2-propanol, dichloromethane, etc.). As protecting groups for α-amino groups, benzyloxycarbonyl (Cbz or Z), tert-butyloxycarbonyl (Boc), fluorenylmethoxycarbonyl (Fmoc), benzyl, allyl, allyloxycarbonyl (Alloc) and the like can be mentioned. The Cbz group can be deprotected by hydrofluoric acid, hydrogenation, etc., the Boc group can be deprotected by trifluoroacetic acid (TFA), and the Fmoc group can be deprotected by treatment with piperidine. The protection of the α-carboxyl group can be carried out using methyl ester, ethyl ester, benzyl ester, tert-butyl ester, cyclohexyl ester and the like. As other functional groups of amino acids, the hydroxyl group of serine or threonine can be protected with a benzyl or tert-butyl group, and the hydroxyl group of tyrosine can be protected with a 2-bromobenzyloxycarbonyl or tert-butyl group. The amino group of the lysine side chain, the carboxyl group of glutamic acid or aspartic acid can be protected in the same manner as the α-amino group and the α-carboxyl group. The activation of the carboxyl group can be carried out using a condensing agent. As a condensing agent, for example, dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIPCDI), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC or WSC), (1H benzotriazole-1-yloxy) tris(dimethylamino) phosphonic acid ammonium hexafluorophosphate (BOP), 1-[bis(dimethylamino) methyl]-1H-benzotriazolium-3-oxide hexafluorophosphate (HBTU) etc. can be enumerated. The peptide chain from the resin can be cut off by treating with an acid such as TFA or hydrofluoric acid (HF).

[0348] Genetic engineering refers to a method of introducing genes into cells to synthesize peptides. Cells that can be used include bacteria, yeast, nematode cells, insect cells, and animal cells (such as mammalian cells).

[0349] For example, it can be synthesized by introducing unnatural amino acids using the four-base codon method. Alternatively, it can be synthesized by synthesizing a chain peptide and then reacting the crosslinking functional groups of the side chains of the amino acid residues introduced into the cyclic portion to cyclize the peptide.

[0350] Cell-free translation systems, also known as cell-free protein synthesis systems, are translation systems that utilize components present within cells such as E. coli rather than directly using cells such as E. coli. There are systems that use cell extracts and systems that use reaction solutions reconstituted by purifying the components of cell extracts (reconstituted cell-free translation systems).

[0351] Examples of the system using a cell extract include a system using an Escherichia coli extract, a wheat germ extract, a rabbit erythrocyte extract, and an insect cell extract.

[0352] Reconstituted cell-free translation systems can be constructed using separately purified ribosomal proteins, aminoacyl-tRNA synthetases (ARS), ribosomal RNA, amino acids, GTP, ATP, translation initiation factors (IFs), elongation factors (EFs), termination factors (RFs), ribosome regeneration factors, and other factors required for translation.

[0353] In translation systems, dialysis can be used to continuously supply energy. For transcription from DNA, RNA polymerase can be added.

[0354] Commercially available cell-free translation systems include RTS-100 (registered trademark) from Roche Diagnostics for systems derived from Escherichia coli, products from Zyagen and CellFree Sciences Co., Ltd. for systems using wheat germ extract, and PURESYSTEM (registered trademark) from PGI, Purefrex (registered trademark) from Gene Frontier Co., Ltd., and PURExpress (registered trademark) In Vitro Protein Synthesis Kit from New England BioLabs for reconstructive translation systems.

[0355] <Cyclic peptide complex>

[0356] According to the present invention, a cyclic peptide complex or a salt thereof is provided, wherein two or more molecules of the cyclic peptide or a salt thereof of the present invention are connected via a linker. The number of molecules of the cyclic peptide or a salt thereof connected via the linker is not particularly limited as long as it is two or more molecules, and is, for example, 2 to 10 molecules, preferably 2 to 5 molecules, more preferably 2 to 4 molecules, further preferably 2 molecules or 3 molecules, and particularly preferably 2 molecules.

[0357] FGFR is a membrane-penetrating receptor tyrosine kinase, with the bonding of FGF as starting point, FGFR dimerization, the intracellular kinase region of FGFR approaches, causes mutual phosphorylation thus, promotes the proliferation induction and / or differentiation state control of cell. Therefore, it is believed that by making the cyclic peptide with FGFR protein bonding multimerization (hereinafter, the cyclic peptide of multimerization is referred to as cyclic peptide complex) by connexon structure, and make it act on the cell of expression FGFR, cause thus the FGFR multimerization by cyclic peptide complex, can make FGFR phosphorylation.Now, in view of phosphorylation approaching between the intracellular kinase region of FGFR, it is believed that preferably with suitable distance and orientation, FGFR multimerization is made.

[0358] In addition, it is sometimes necessary to include multiple cyclic peptides in the FGFR phosphorylation of the proliferation or differentiation state of the cells expressing FGFR. The multiple cyclic peptides included in the cyclic peptide complex can be complexed by covalent bonds or bonded by non-covalent bonds (e.g., complex formation, affinity bonds, nucleic acid hybridization). From the viewpoint of synthesis cost, the above-mentioned bond can be a non-covalent bond, but from the viewpoint of complex stability, it is preferably a covalent bond (e.g., amide bond, various click chemistries).

[0359] A plurality of cyclic peptides can be complexed by direct bonding between the cyclic peptides, or by other molecules. The plurality of cyclic peptides contained in the cyclic peptide complex can have the same structure or different structures. From the viewpoint of cell proliferation promoting effect and / or cell differentiation state control, different structures can be provided, but from the viewpoint of synthesis cost, it is preferred to have the same structure.

[0360] The length of the linker is not particularly limited, but is preferably More preferably

[0361] When calculating the length of the linker, the bending of the molecular chain is taken into account and each single bond is calculated. (Each amino acid residue is By using this unit distance, the length of the linker can be calculated based on the molecular structure.

[0362] In the cyclic peptide complex, from the viewpoint of FGFR phosphorylation, the linker may be used by being bonded to either the N-terminus or the C-terminus of the cyclic peptide, but is more preferably bonded to the C-terminus.

[0363] In the cyclic peptide complex, from the perspective of FGFR phosphorylation, the linker structure can be PEG (polyethylene glycol), an alkyl chain (polyethylene), a polypeptide, a polyester, a polyacrylamide, a polycarbonate, a polypropylene, a polystyrene and / or a polyurethane. Furthermore, the linker structure can form a salt. When the linker structure forms a salt, the salt is preferably the above-mentioned salt. From the perspective of the water solubility of the cyclic peptide complex, PEG (polyethylene glycol), an alkyl chain (polyethylene), a polypeptide, a polyester and / or a polyacrylamide is more preferred.

[0364] The manufacture of cyclic peptide complexes can be implemented by connecting two cyclic peptides with one amino group using a linker molecule (hereinafter, described as Bis-NHS linker) with two NHS-activated carboxyl groups. Bis-NHS linkers with a variety of linker lengths are sold by various companies, and as an example, BS (PEG) 5 (PEGylated bis (sulfosuccinimidyl) suberate) (Thermo, 21581) or Bis (NHS) PEG9 (Tokyo Chemical Industry Co., Ltd., B4688) can be cited. The connection of the cyclic peptide using the Bis-NHS linker can be implemented by mixing the cyclic peptide and linker in water near pH 7.

[0365] Furthermore, in peptide solid phase synthesis and liquid phase synthesis, cyclic peptide complexes can be produced by using branched amino acids with multiple amino groups. Examples of branched amino acids include lysine and 2,4-diaminobutyric acid. In this case, after the branched amino acid is connected to a solid phase resin or a tag for liquid phase synthesis, the multiple amino groups are deprotected and the peptide chains are extended on both, thereby enabling the synthesis of cyclic peptide complexes on the solid phase resin or the tag for liquid phase synthesis. Peptide chain extension can be performed on all amino groups simultaneously or one by one.

[0366] The cyclic peptide complex of the present invention may be modified with other substances, which are the same as those used to modify the cyclic peptide described above.

[0367] <Utilization of Cyclic Peptides and Cyclic Peptide Complexes>

[0368] The cyclic peptide or salt thereof and the cyclic peptide complex or salt thereof of the present invention can be used for functional analysis, functional control, labeling, proliferation promotion, differentiation state control, or purification of living substances (proteins, cells, tissues, etc.) containing FGFR proteins, etc. Among them, the proliferation-promoting effect of the cyclic peptide complex or salt thereof of the present invention helps reduce the manufacturing costs of various cell therapy products and cultured meat, and therefore has high industrial value. In particular, in cultured meat, commercial production can be carried out by replacing the majority (up to 96% or more) of the growth factors in the production cost with the cyclic peptide complex or salt thereof of the present invention.

[0369] From the viewpoint of bonding, functional controllability, labeling efficiency, purification, proliferation promotion and / or differentiation state control, the object that makes cyclic peptide or its salt or cyclic peptide complex or its salt play a role can be FGFR protein, can also be other proteins, compounds and / or cells, but is preferably FGFR protein and / or the cell expressing FGFR, cell secretion and / or cell lysis liquid, the cell of known proliferation or undifferentiation maintenance effect based on bFGF. More preferably FGFR2 or FGFR4 protein and / or the cell expressing FGFR2 or FGFR4, cell secretion and / or cell lysis liquid. Especially preferably FGFR2 protein and / or the cell expressing FGFR2, cell secretion and / or cell lysis liquid.

[0370] The object that makes cyclic peptide or its salt or cyclic peptide complex or its salt play a role can be a substance derived from human beings, or can be a substance derived from mouse, cattle or other animals. From the viewpoint of bonding, functional controllability, labeling efficiency, purification, proliferation promotion and / or differentiation state control, it is preferably a substance derived from an animal with a high homology to the amino acid sequence constituting FGFR of human beings. As an example of an animal with a high homology to the amino acid constituting FGFR of human beings, cattle, pig, chicken and tuna can be enumerated.

[0371] The cyclic peptide or its salt or cyclic peptide complex or its salt can be dissolved in an aqueous solution or an organic solvent for use, or can be bonded to a solid phase carrier (e.g., a plate, a bead) for use. When used in combination with a solid phase carrier, from the viewpoint of bonding efficiency and / or target performance, it is preferred to introduce a reactive group (e.g., an amino group, a thiol group, a biotin group) for bonding to the cyclic peptide and / or cyclic peptide complex or its salt.

[0372] Specifically, the cyclic peptide or salt thereof and the cyclic peptide complex or salt thereof of the present invention can be used as a culture medium composition, a culture medium additive, a purification material, a labeling material, a cell control material, or an integration material.

[0373] When a cyclic peptide or its salt or a cyclic peptide complex or its salt is used as a culture medium composition, it can be prepared by combining the constituent components by conventional methods. As long as the desired effect such as cell proliferation promotion and / or cell control can be obtained, its form is not particularly limited. For example, it can be prepared as a liquid culture medium, a semi-fluid culture medium and a solid culture medium. In addition, the culture medium composition of the present invention can be prepared in a powdered form. By preparing it in a powdered form, it can be extremely easy to transport or store. In addition, by adding sterilized water and / or agar, etc. during use, a liquid, semi-liquid or solid culture medium can be easily prepared. In the case of preparing a liquid, semi-liquid or solid culture medium, from the viewpoint of FGFR phosphorylation, the preparation concentration of the cyclic peptide or its salt or the cyclic peptide complex or its salt is preferably 0.001 to 100 nmol / L, more preferably 0.01 to 10 nmol / L, and particularly preferably 0.1 to 10 nmol / L.

[0374] Furthermore, the culture medium composition of the present invention can also be used in any culture method such as adherent culture, suspension culture, embedding culture, and tissue culture.

[0375] When a cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof is used as a culture medium composition, in addition to the cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof of the present invention, components commonly used for cell culture, such as amino acids, vitamins, buffer materials, inorganic salts, carbon sources, serum and serum substitutes, etc., can also be appropriately used.

[0376] When a cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof is used as a culture medium composition, it can be dissolved in a culture medium for use. When dissolved in a culture medium for use, from the perspective of FGFR phosphorylation, the dissolved concentration is preferably 0.001 to 100 nmol / L, more preferably 0.01 to 10 nmol / L, and particularly preferably 0.1 to 10 nmol / L.

[0377] When a cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof is dissolved in a culture medium for use, the culture medium may be any culture medium commonly used for cell culture, but from the perspective of cell proliferation promotion and / or cell control, it is more preferable to prepare a culture medium with components suitable for the culture of the cells used.

[0378] The culture medium may contain serum, but when used for the production of cell products such as cell therapy products or cultured meat, a serum-free culture medium is preferably used from the perspective of safety. The serum-free culture medium does not contain serum, but may contain purified components derived from serum, or may contain recombinant proteins derived from components of serum. The serum-free culture medium may contain serum substitutes, for example, culture media that appropriately contain serum albumin, transferrin, fatty acids, collagen precursors, trace elements, 2-mercaptoethanol or 3'-thiolglycerol or their equivalents. Such serum substitutes can be prepared, for example, by the method described in WO98 / 30679. The cyclic peptide or its salt or the cyclic peptide complex or its salt of the present invention can also be cited as a serum substitute. As a serum substitute, a commercially available product can be used. As such a commercially available serum substitute, for example, Knockout TM Serum Replacement (Life Technologies Corporation), Chemically-defined Lipid Concentrated (Life Technologies Corporation), Glutamax TM (Life Technologies Corporation), B27 (Life Technologies Corporation), N2 (Life Technologies Corporation), etc., but are not limited to these.

[0379] When a cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof is used as a culture medium additive, it can be used when the cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof is added to the culture medium. The culture medium additive of the present invention may contain an appropriate amount of any additive, such as a stabilizer, an isotonic agent, a pH adjuster, etc., in addition to the cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof, as long as it does not impair the desired effect such as cell proliferation promotion and / or cell control.

[0380] The culture medium additive of the present invention can be in any dosage form as long as the desired effect can be obtained, for example, a solution, a solid, a powder, etc. can be enumerated. From the viewpoint of reducing transportation costs, it is preferably solid or powder. In the case of a solid or powder, it can be dissolved into a desired concentration using an appropriate buffer or solvent, or it can be used in the form of a solid or powder. In the case where the culture medium additive is a solution, it is preferably sterilized by filtration sterilization using a membrane filter, etc.

[0381] The number of times and timing of adding the culture medium additive of the present invention to the culture medium is not particularly limited and can be performed before, during, or after cell culture. However, from the perspective of promoting proliferation and / or controlling the differentiation state, it is preferably performed before and / or during cell culture.

[0382] When a cyclic peptide or its salt or a cyclic peptide complex or its salt is used as a culture medium composition or culture medium additive, the culture medium composition or culture medium additive can be used to produce a cell therapy product or cultured meat. For example, a method for producing a cell therapy product or cultured meat may include a step of culturing cells using a culture medium containing the cyclic peptide or its salt or the cyclic peptide complex or its salt.

[0383] Cultured meat refers to edible meat produced through cell culture. It is an innovative technology that uses cell engineering to produce animal meat from cultured tissue, instead of the traditional method of raising livestock. The production process includes the cultivation of animal cells in a way that they grow into muscle tissue or fat. This technology makes it possible to produce protein-rich foods that are physically and nutritionally equivalent to traditional meat or fish-based foods. Regarding livestock farming, in addition to obvious concerns about animal welfare, the use of water and land for cultivating feed crops continues to increase, and resources are in great demand. In addition, due to the growing awareness of greenhouse gas emissions, deforestation, pollution, antibiotic resistance, the ecological impact of edible meat production, and the increasing concern for animal welfare, "cultured meat" or "clean meat" has been proposed to replace traditional meat consumption with "lab-grown meat."

[0384] Generally, edible meat refers to a collection of muscle fibers, connective tissue, and fat. Cultured meat preferably mimics the structure of edible meat, but it does not necessarily have to contain all of the so-called edible meat structures, as long as it contains cultured cells selected from the group consisting of fibroblasts, adipose tissue-derived cells, and muscle tissue-derived cells. Cultures containing multiple cell types are more preferred.

[0385] Cultured meat may contain an extracellular matrix in addition to cultured cells selected from the group consisting of fibroblasts, adipose tissue-derived cells, and muscle tissue-derived cells. Methods for producing cultured meat, for example, include culturing cells selected from the group consisting of fibroblasts, adipose tissue-derived cells, and muscle tissue-derived cells, and recovering and integrating the cultured cells. Cultured meat production methods may also include a differentiation induction step or a post-integration culturing step.

[0386] In the case where a cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof is used as a culture medium composition or a culture medium additive, the culture of cells can be carried out by seeding the cells into a culture medium containing a cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof. The culture is carried out under conditions well known in the art, for example, in a CO2 incubator at 37°C. The culture can be a plate culture or a suspension culture. The proliferated cells can be recovered as a culture by trypsin treatment or the like, and can be further subcultured after recovery. The culture of cells can also be carried out by seeding the cells into a detachable structure for culture. The structure with the proliferated cells attached can be recovered as a culture. The structure can be constructed of an extracellular matrix such as collagen, elastin, fibronectin, laminin, adenonectin, or the structure with the cells attached can be integrated to form the culture meat.

[0387] The integration step includes a step of shaping the culture of one or more recovered cells. The culture shaped in the integration step can be a piece of meat such as a steak, or it can be branched meat, or it can be minced. The integration step includes a step of integrating the cell culture with at least one substance selected from the group consisting of other cells, blood and tissues. The other cells can be cultured cells or cells collected from animals. More specifically, it can be shaped together with other cells cultured in a culture medium containing the cyclic peptide or its salt or cyclic peptide complex or its salt of the present invention. As an example, muscle tissue-derived cells cultured in a culture medium containing the cyclic peptide or its salt or cyclic peptide complex or its salt of the present invention can be integrated with adipose tissue-derived cells and / or fibroblasts cultured in a culture medium containing the cyclic peptide or its salt or cyclic peptide complex or its salt of the present invention. After integration, co-culture can also be further performed. As an example, the cultures of one or more recovered cells can be mixed and seeded into an extracellular matrix for co-culture. As an extracellular matrix, collagen, elastin, fibronectin, laminin, adenonectin, etc. can be used. As the culture medium in this case, a culture medium containing the cyclic peptide or a salt thereof, or the cyclic peptide complex or a salt thereof of the present invention can also be used.

[0388] In the integration process, the culture of one or more recovered cells can be integrated with blood and / or tissue. The tissue can be either animal tissue or cultured tissue. For example, blood, adipose tissue, or muscle tissue separated during meat processing can be integrated with the culture to produce cultured meat.

[0389] The differentiation induction step can be performed after cell culture, or before, during, or after the integration step. The differentiation induction step can cause mononuclear muscle satellite cells and myoblasts to differentiate into multinucleated myotubes, which then mature into muscle fibers. Differentiation induction can be performed using methods known in the art. For example, culturing cells under high carbon dioxide concentrations is known. For example, culturing cells in an atmosphere of 5-10% (v / v) CO₂ can promote differentiation into myotubes.

[0390] The culture medium comprising a cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof can culture any animal cell. From the viewpoint of manufacturing cultured meat, cells derived from livestock such as cattle, pigs, goats, sheep, rabbits, chickens, ostriches, ducks, etc. can be used. In particular, when placing cattle cells, any cell of Holstein, Jersey, black-haired, brown-haired, short-horned, hornless, and their hybrids can be used. However, from the viewpoint of edible meat production, cells of black-haired, brown-haired, short-horned, and hornless species for meat are preferred.

[0391] The culture medium containing a cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof can also culture tissues formed by cell aggregation. Animal cells can be primary cells obtained from animals and passage cells derived from primary cells, or they can be strained cells or genetically modified cells with missing or inserted genes. Primary cells can be obtained by culture of animal tissues. They can also be cells differentiated from stem cells such as stem cells. From the viewpoint of manufacturing cell therapy products, it is preferred to culture adult stem cells or artificial pluripotent stem cells containing mesenchymal stem cells. From the viewpoint of manufacturing cultured meat, it is preferred to culture cells selected from the group consisting of fibroblasts, adipose tissue-derived cells and muscle tissue-derived cells.

[0392] Fibroblasts are cells that make up connective tissue and produce extracellular matrices such as collagen and elastin. Fibroblasts found in muscle are specifically called myofibroblasts. Myofibroblasts form the connective tissue surrounding myofiber bundles in skeletal muscle. Myofibroblasts express α-SMA, produce extracellular matrix, and accumulate fat, contributing to the chewiness and texture of the food.

[0393] Adipose tissue-derived cells refer to cells that constitute adipose tissue and are cells isolated and cultured from adipose tissue. Adipose tissue-derived cells are at least one type of cell selected from the group consisting of adipose stem cells, multicystic adipocytes, and unicystic adipocytes. Adipose stem cells are mesenchymal stem cells that have the ability to differentiate into various cells and can differentiate into muscle cells, adipocytes, and cells of connective tissue. Multicystic adipocytes are also called brown adipocytes and contribute to the burning of fat in the living body. Unicystic adipocytes are also called white adipocytes and can store fat droplets within the cells. Adipose tissue-derived cells contain fat and therefore contribute to the taste of meat.

[0394] Muscle tissue-derived cells refer to cells constituting muscle tissue, and are cells isolated and cultured from muscle tissue. As muscle tissue-derived cells, myoblasts, muscle satellite cells, and myotubes can be mentioned, but myotubes do not have proliferative properties, so from the perspective of proliferation, myoblasts and / or muscle satellite cells are preferred. Muscle satellite cells are adult stem cells contained in muscles that can proliferate and differentiate into myoblasts. Myoblasts refer to cells that become the source of myofibers and are proliferative mononuclear cells. If myoblasts differentiate, myoblasts fuse with each other to form multinuclear myotubes, which then mature and become myofibers. Myofibers are composed of myofibrils, which are composed of the proteins that constitute muscle, i.e., actin fibers and myosin fibers, and are classified into red myofibers (type I, type IIA) and white myofibers (IIB) by the isotype of myosin, which contributes to the difference in the taste of edible meat.

[0395] When a cyclic peptide or a salt thereof or a cyclic peptide complex or a salt thereof is used as a purification material, the cyclic peptide may be bonded to a solid phase carrier or used without bonding. As a method for using the cyclic peptide without bonding, there is a method of imparting a separation structure (e.g., a biotin tag, an antibody epitope, a polar residue for electrostatic separation) to the cyclic peptide or a method of imparting a toxin to the cyclic peptide to kill cells outside the target.

[0396] When a cyclic peptide or its salt or a cyclic peptide complex or its salt is used as a labeling material, a fluorescent dye, a radioisotope, a nuclear polar molecule, an affinity tag (e.g., biotin, FLAG tag) or an enzyme (e.g., luciferase) can be used as the labeling group.

[0397] When a cyclic peptide or its salt or a cyclic peptide complex or its salt is used as a cell control material, the cyclic peptide can be bonded to a solid phase carrier (e.g., flask, plate) or used without bonding. As an example of cell control, FGFR phosphorylation promotion, FGFR phosphorylation inhibition, cell proliferation promotion, cell proliferation inhibition, cell differentiation promotion and cell differentiation inhibition can be enumerated. Furthermore, by connecting the cyclic peptide to other cell stimulants, the effect of the cell stimulant that selectively connects the cell with FGFR can be manifested.

[0398] When a cyclic peptide or a salt thereof, or a cyclic peptide complex or a salt thereof is used as a material for integrating a specific molecule near FGFR, it is necessary to link the molecule to be integrated with the cyclic peptide. The linking can be one molecule to one molecule or one molecule to multiple molecules, and the linking can be reversible or irreversible.

[0399] Example

[0400] Below, specific examples are given to explain the cyclic peptides, etc. involved in the present invention in more detail. The materials, processing steps, etc. shown in the following specific examples can be appropriately changed as long as they do not deviate from the purpose of the present invention. The scope of the cyclic peptides, etc. involved in the present invention should not be interpreted restrictively by the specific examples shown below. In the following description, unless otherwise specified, synthesis, processing, manufacturing, etc. are carried out at room temperature (25°C ± 3°C). The percentage of substance concentration is a mass reference.

[0401] <Example 1: Obtaining FGFR-binding candidate peptides using mRNA display>

[0402] Candidate sequences of cyclic peptides that bind to FGFR were obtained using the mRNA display method.

[0403] The sequence of SEQ ID NO: 1 was used as the library for the mRNA display method. The library was translated from the 86th to 88th start codon (ATG) at the 5' end, and the base groups after 107 (NNNTGT(NNN) 6～18TAGNNN (NNN is a trimer oligonucleotide, wherein N independently represents A, T, G or C)) is a random sequence, and the base group located on the 3' end side of the random sequence is the pyrimidine mycin linker bonding portion and the termination codon. The base group before the 85th from the 5' end is a sequence required for the start of transcription and translation, such as the T7 promoter sequence and the Shine-Dalgarno sequence. The triplet TAG in this random sequence corresponds to the codon for chloroacetylated lysine, so the thiol group of cysteine ​​in the peptide encoded by this random sequence spontaneously forms a thioether bond with the chloroacetyl group of chloroacetylated lysine, thereby forming a cyclic peptide. In the nucleic acid having the sequence of sequence number 1, the trimer oligonucleotide represented by NNN is an equal mixture of trimer oligonucleotides corresponding to the 18 types of codons shown in Table 1, which assign one codon to one amino acid. About (NNN) 6～18 For this part, 13 different libraries with 6 to 18 repeat numbers were prepared separately, and mRNA display was performed on each of them.

[0404] [Table 3]

[0405]

[0406] Serial number 1:

[0407] GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAG AAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGTTAAGAAAACA AAAACANNNTGT(NNN) 6～ 18 TAGNNNGGTGGCTCTGGCGGTAGCAGGAC GGGGGGCGGCGGGGGGTAAATAAATAAGCTTGAGTAT

[0408] (NNN is a trimer oligonucleotide, wherein N independently represents A, T, G or C)

[0409] The library of sequence number 1 was prepared by performing overlap extension PCR. Specifically, the three DNAs of sequence number 2, sequence number 3, and sequence number 4 to 16 were mixed at 3 μmol / L, 1 μmol / L, and 1 μmol / L, respectively, and the DNA was cloned in Platinum TMIn the presence of SuperFi II DNA Polymerase (Thermo, 12361010), after 98°C / 30 seconds, 7 cycles of 98°C / 10 seconds, 60°C / 10 seconds, and 72°C / 10 seconds were repeated, and finally 72°C / 5 minutes were performed to connect the three DNAs to prepare the target library. The prepared library was purified and diluted to 10 ng / μL. In the DNAs of sequence numbers 4 to 17, the trimer oligonucleotide represented by NNN is an equal mixture of trimer oligonucleotides corresponding to the 18 types of codons shown in Table 1 that assign one codon to one amino acid.

[0410] Serial number 2:

[0411] GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGTTAAAAAAACAAAAAC

[0412] Serial number 3:

[0413] ATACTCAAGCTTATTTATTTATTACCCCCCGCCGCCCCCCGTCCTGCTAC CGCCAGAACCACC

[0414] Serial No. 4:

[0415] AAAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN)6TAGNNNGGCGGTTCTGGCGGTAGC

[0416] Serial No. 5:

[0417] AAAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN)7TAGNNNGGCGGTTCTGGCGGTAGC

[0418] Serial No. 6:

[0419] AAAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN)8TAGNNNGGCGGTTCTGGCGGTAGC

[0420] Serial No. 7:

[0421] AAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN)9TAGNNNGGCGGTTCTGGCGGTAGC

[0422] Sequence number 8:

[0423] AAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN) 10 TAGNNNGGCGGTTCTGGCGGTAGC

[0424] Sequence number 9:

[0425] AAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN) 11 TAGNNNGGCGGTTCTGGCGGTAGC

[0426] Sequence number 10:

[0427] AAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN) 12 TAGNNNGGCGGTTCTGGCGGTAGC

[0428] Sequence number 11:

[0429] AAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN) 13 TAGNNNGGCGGTTCTGGCGGTAGC

[0430] Sequence number 12:

[0431] AAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN) 14 TAGNNNGGCGGTTCTGGCGGTAGC

[0432] Sequence number 13:

[0433] AAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN) 15 TAGNNNGGCGGTTCTGGCGGTAGC

[0434] [[ID= 51]]Sequence number 14

[0435] :AAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN) 16 TAGNNNGGCGGTTCTGGCGGTAGC

[0436] Serial No. 15:

[0437] AAAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN) 17 TAGNNNGGCGGTTCTGGCGGTAGC

[0438] Serial No. 16:

[0439] AAAGAAGGAGATATACATATGGTTAAAAAAACAAAAACANNNTGT(NNN) 18 TAGNNNGGCGGTTCTGGCGGTAGC

[0440] As FGFR, Recombinant Human FGFR2 alpha (IIIc) Fc Chimera Protein, CF (R&D systems, 712-FR-050) was immobilized on magnetic beads (NHS MagSepharose, Cytiva, 28951380) according to the manufacturer's (Cytiva) protocol (FGFR concentration during immobilization: 1 μg / μL). In addition, to remove the cyclic peptide bound to the magnetic beads, IgG1 Fc, Human, recombinant (FUJIFILM Wako Pure Chemical Corporation, 098-07141) was immobilized on magnetic beads in the same manner as above.

[0441] After a total of 8 cycles of repeating the step of bringing the library into contact with FGFR immobilized on magnetic beads and incubating the cells, the sequence of the peptide bound to FGFR was identified using a sequencer.

[0442] The specific steps of each round are as follows.

[0443] First, the prepared library (SEQ ID NO: 1) was reacted in the presence of T7 RNA Polymerase (TaKaRa, 2540A) at 37°C for 30 minutes to prepare library transcripts. The DNA fragments were purified and diluted to 10 μmol / L.

[0444] Next, the library transcripts (final concentration 5 μmol / L) and the pyrimidine mycin linker of sequence number 17 (final concentration 10 μmol / L) were mixed in TBS buffer (1.25 mmol / L Tris, 25 mmol / L NaCl, pH 7.5), heated at 95°C for 5 minutes, and then irradiated with UV (365 nm) on ice to prepare a complex of the library transcripts and the pyrimidine mycin linker.

[0445] Serial No. 17: (PsoralenC6)- UACCCCCCGCCGCCCCCCGUCCU -(Sp18)-(Sp18)-(Sp18)-(Sp18)-CC-(Puro)

[0446] (Structural references of PsoralenC6, Sp18, and Puro Figure 1 The underlined nucleotides are nucleotides whose 2'OH of RNA has become 2'OMe, and the ununderlined nucleotides represent unmodified DNA.

[0447] To translate chloroacetylated lysine, a non-natural amino acid, a tRNA with a CUA anticodon that pairs with the UAG codon of mRNA was prepared by transcribing the DNA of SEQ ID NO: 18. This tRNA was aminoacylated with N-chloroacetylated lysine pdCpA (phospho 2'deoxyribocytidylylriboadenosine) ester. This aminoacyl tRNA is referred to as aminoacyl tRNA (1).

[0448] Serial No. 18:

[0449] GTTGTAAAACGGACGGCCAGTGCCAAGCTTGGGCTAATACGACTCACTATAGGGAGAGTAGTTCAATGGTAGAACGTCGGTCTCTAAAACCGAGCGTTGAGGGTTCGATTCCTTTCTCTCCCAC

[0450] The library transcript and pyrimidine mycin linker complex was translated in a translation solution containing PUREfrex2.0 (Gene Frontier, PF201-0.25-5) and aminoacyl-tRNA. 5.25 μL of the complex, 7.5 μL of PUREfrex2.0 Solution I, 0.75 μL of Solution II, 1.5 μL of Solution III, and dried aminoacyl-tRNA (1) (final concentration 0.5 μg / μL) were mixed and reacted at 37°C for 60 minutes to produce an mRNA-cyclic peptide linker.

[0451] In the presence of ReverTra Ace (TOYOBO, TRT-101), 15 μL of the translation product and the DNA of sequence number 19 (final concentration 10 μmol / L) were mixed (reaction volume 37.5 μL) and reacted at 37°C for 30 minutes to perform reverse transcription and produce a cDNA-mRNA-cyclic peptide linker.

[0452] Serial number 19: GCTACCGCCAGAACCACC

[0453] Next, 22.5 μL of the reverse transcription product was mixed with 10 μL of magnetic bead-immobilized IgG1 Fc in TBS buffer (20 mmol / L Tris, 150 mmol / L NaCl, 0.1% BSA, 0.05% Tween 20, pH 7.4) (reaction volume 100 μL). After reacting at room temperature for 45 minutes, the supernatant was recovered to remove the cDNA-mRNA-cyclic peptide linker bonded to the magnetic beads.

[0454] Next, the supernatant was mixed with 10 μL of magnetic bead-immobilized FGFR (reaction volume 50 μL). After reacting at room temperature for 45 minutes, the beads were washed three times with 100 μL of TBS buffer to extract the cDNA-mRNA-cyclic peptide conjugate bound to FGFR. The extracted cDNA-mRNA-cyclic peptide conjugate was amplified using the following two-step PCR.

[0455] In the first stage of PCR, 25 μL of the cDNA-mRNA-polypeptide conjugate was mixed with the DNA of sequence number 20 (final concentration 0.5 μmol / L) and the DNA of sequence number 21 (final concentration 0.5 μmol / L) (reaction volume 50 μL) and the platinum TM In the presence of SuperFi II DNA Polymerase (Thermo, 12361010), the amplified product was obtained by repeating 6 to 15 cycles of 98°C / 10 seconds, 60°C / 10 seconds, and 72°C / 10 seconds, followed by a final treatment at 72°C / 5 minutes. The amplified product was purified and diluted to 20 nmol / L.

[0456] Serial number 20: GGAGATATACATATGGTTAAGAAAACAAAAAC

[0457] Sequence number 21: CTGCTACCGCCAGAACCACC

[0458] In the second stage of PCR, the PCR amplification product of the first stage (final concentration 10 nmol / L) was mixed with DNA of sequence number 2 (final concentration 0.5 μmol / L) and DNA of sequence number 3 (final concentration 0.5 μmol / L) and the mixture was stirred at 4 °C in Platinum TM In the presence of SuperFiII DNA Polymerase (Thermo, 12361010), after 30 seconds at 98°C, six cycles of 98°C for 10 seconds, 60°C for 10 seconds, and 72°C for 10 seconds were repeated, followed by a final treatment at 72°C for 5 minutes. This yielded DNA with identical sequences, excluding the original library and the randomized sequences. The resulting library was purified, diluted to 2 ng / μL, and used in the next round.

[0459] The base sequence of the first-stage PCR product in the eighth round was identified using MiSeq (manufactured by Illumina, Inc.) and Miseq Reagent kit v2 (300 cycles) (Illumina, MS-102-2022) according to the standard protocol of Illumina, Inc. Analysis of the identified cyclic peptide group revealed a large number of cyclic peptides containing the following amino acid sequences.

[0460] X1-Xm-X2-Xn-X3

[0461] X1: glutamine residue or histidine residue

[0462] Xm: Peptide residue containing 2 to 4 arbitrary amino acid residues

[0463] X2: alanine residue, leucine residue, isoleucine residue, phenylalanine residue, tyrosine residue, tryptophan residue, glutamine residue, serine residue, threonine residue, asparagine residue, glutamic acid residue, arginine residue or histidine residue

[0464] Xn: amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues

[0465] X3: phenylalanine residue, tryptophan residue, tyrosine residue or histidine residue

[0466] In the evaluation of the bonding properties of Example 2, cyclic peptides in which a part of the cyclic peptides included in the identified cyclic peptide group and a part of the cyclic peptides included in the identified cyclic peptide group were substituted, deleted or inserted with amino acid residues were evaluated.

[0467] <Example 2: Evaluation of the bonding properties of peptides (enzyme-synthesized products)>

[0468] The FGFR binding ability of the peptides was evaluated using the ELISA method.

[0469] The peptides used for evaluation were enzymatically synthesized by the following method.

[0470] First, a fusion peptide (sequence number 25) was designed, which was formed by sequentially connecting a translation-promoting sequence (sequence number 22), a peptide, a Myc tag (sequence number 23), and a HiBiT tag (sequence number 24). Next, a template DNA sequence (sequence number 26) was designed, which contained sequences required for the start of transcription and translation, such as a T7 promoter sequence, a Shine-Dalgarno sequence, and an initiation codon (ATG) at the 5' end, and a termination codon group at the 3' end. In the case where a triplet TAG codon is included in this template DNA sequence, the codon is made to correspond to a codon for chloroacetylated lysine, so that the thiol group of cysteine ​​in the peptide encoded by the DNA sequence spontaneously forms a thioether bond with the chloroacetyl group of chloroacetylated lysine, thereby forming a cyclic peptide.

[0471] Serial Number 22: VKKTKT

[0472] Serial Number 23: EQKLISEEDL

[0473] Serial number 24: VSGWRLFKKIS

[0474] Serial No. 25:

[0475] MVKKTKT[HCSYERLQFHGHEAPFRVXV]GSGSGSEQKLISEEDLGGSVS GWRLFKKIS

[0476] (X represents chloroacetylated lysine, and the parentheses are examples of the amino acid sequences of the peptides to be evaluated. The parentheses differ for each peptide.)

[0477] Serial No. 26:

[0478] GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAG AAATAATTTTGTTTAACTTTAAGAAGGAGATATACCAATGGTTAAAAAAAC AAAAACA[CATTGCTCTTACGAACGTCTGCAGTTCCATGGTCATGAAGCTC CGTTCCGTGTTTAGGTT]GGTTCTGGCAGTGGTTCCGAACAGAAACTGATC AGCGAAGAAGATCTGGGTGGCTCTGTAAGTGGATGGCGATTATTCAAGAA GATTAGCTAATGAATAACTAATCC

[0479] (Parallels in parentheses are examples of DNA sequences encoding the peptides to be evaluated. The numbers in parentheses vary for each peptide.)

[0480] Template DNA was prepared by two-stage overlap extension PCR.

[0481] In the first stage of PCR, four DNAs (SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30) were mixed at concentrations of 0.3 μmol / L, 0.3 μmol / L, 0.05 μmol / L, and 0.05 μmol / L, respectively. In the presence of PrimeSTARMax (TaKaRa, R045B), the mixture was incubated at 98°C for 10 seconds, 39°C for 5 seconds, and 72°C for 5 seconds. The mixture was then repeated 27 times for a three-step process of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 5 seconds. This ligated DNA was purified and diluted to 50 ng / μL.

[0482] Sequence number 27: GAAATTAATACGACTCACTATAGG

[0483] Sequence number 28: GAACCACTGCCAGAACC

[0484] Serial No. 29:

[0485] GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCAATGGTTAAAAAAACAAAAAC

[0486] Serial No. 30:

[0487] GAACCACTGCCAGAACC[AACCTAAACACGGAACGGAGGCTTCATGACCATGGAACTGCAGACGTTCGTAAGAGCAATG]TGTTTTTGTTTTTTTAAC

[0488] (Parallels in parentheses are examples of DNA sequences encoding the peptides to be evaluated. The numbers in parentheses vary for each peptide.)

[0489] In the second stage of PCR, the four DNAs, DNA of sequence number 27, DNA of sequence number 31, DNA of sequence number 32, and the purified product of the first stage, were mixed at concentrations of 0.3 μmol / L, 0.3 μmol / L, 0.0025 μmol / L, and 0.4 ng / μL, respectively. In the presence of PrimeSTAR Max (TaKaRa, R045B), 30 cycles of 98°C / 10 seconds, 58°C / 5 seconds, and 72°C / 5 seconds were repeated to ligate the DNA of sequence number 32 and the purified product of the first stage, thereby obtaining a template DNA (SEQ ID NO: 25). The template DNA was purified and diluted to 50 ng / μL.

[0490] Serial number 31: GGATTAGTTATTCATTAGCTAATC

[0491] Serial No. 32:

[0492] GGTTCTGGCAGTGGTTCCGAACAGAAACTGATCAGCGAAGAAGATCTGGGTGGCTCTGTAAGTGGATGGCGATTATTCAAGAAGATTAGCTAATGAATAACTAATCC

[0493] Cell-free enzymatic synthesis of the polypeptide was performed in a translation solution containing template DNA, PUREfrex2.0 (Genefrontier, PF201-0.25-5), and aminoacyl-tRNA (1). 1.75 μL (62.5 ng) of template DNA prepared to 50 ng / μL, 2.5 μL of PUREfrex2.0 Solution I, 0.25 μL of Solution II, 0.5 μL of Solution III, and dried aminoacyl-tRNA (1) (final concentration 0.5 μg / μL) were mixed and reacted at 37°C for 1 hour.

[0494] The concentration of the enzymatically synthesized peptide was determined using the Nano Glo HiBiT Lytic Detection System (Promega, N3040) and a chemically synthesized peptide (SEQ ID NO: 33) with a calibration curve of known concentrations. The peptide was diluted with Can Get Signal Immunoreaction Enhancer Solution I (TOYOBO, NKB-101) according to the standard protocol of the Nano Glo HiBiT Lytic Detection System.

[0495] Serial number 33: EQKLISEEDLGGSVSGWRLFKKIS

[0496] The FGFR binding properties of the enzymatically synthesized peptides were measured by evaluating the amount of peptide-FGFR binding by ELISA.

[0497] First, 5 ng of Recombinant Human FGFR2 alpha (IIIc) Fc Chimeric Protein, CF (R&D systems, 712-FR-050) was immobilized in each well of a 96-well plate and blocked with Pierce Protein-Free (PBS) Blocking Buffer (Thermo, 37572). Then, peptide diluted with Can Get Signal Immunoreaction Enhancer Solution I (TOYOBO, NKB-101) was added and reacted at room temperature for 3 hours. After washing with PBS (phosphate buffered saline) containing 0.05% Tween 20, anti-Myc antibody (Cell Signaling, 14038S) diluted with Can Get Signal Immunoreaction Enhancer Solution II (TOYOBO, NKB-101) was added and reacted at room temperature for 2 hours. After washing with PBS containing 0.05% Tween 20, SuperSignal ELISA Femto Substrate (Thermo, 37075) was added and the luminescence intensity was measured. The dose-response relationship was calculated based on the difference in luminescence intensity between wells with immobilized FGFR and wells without immobilized FGFR and the peptide concentration during the reaction. FGFR binding properties were evaluated according to the following evaluation criteria. Evaluation criteria A, B, or C were preferred.

[0498] (Evaluation criteria for FGFR bonding)

[0499] The value of the luminescence signal emitted by the cyclic peptide of sequence number 47 at a reaction concentration of 10 nmol / L is set to 1, and the value of the luminescence signal emitted by the above cyclic peptide at a reaction concentration of 10 nmol / L during normalization is

[0500] A……is 0.7 or more.

[0501] B is 0.5 or more and less than 0.7.

[0502] C is 0.1 or more and less than 0.5.

[0503] D……less than 0.1.

[0504] Table 4 shows the evaluation results of the cyclic peptides.

[0505] The amino acid residues enclosed in parentheses represent amino acid residues that form a cyclic structure based on a thioether bond or a disulfide bond between the side chains. For example, K (acetyl) refers to a structure in which a haloacetyl group is modified on the side chain of a lysine residue. This cyclic peptide has a cyclic structure in which the halogen atom of the haloacetyl group is replaced by a thiol group of another residue.

[0506] Sequence number 34 is a cyclic peptide reported in International Publication No. WO2000 / 003245 (Patent Document 1), and Sequence number 36 is a cyclic peptide obtained by converting Sequence number 34 into a thioether-type cyclized structure.

[0507] Sequence number 35 is a linear peptide reported in Dev. Neurobiol. (2009) 69(13): 837-854 (Agonists of fibroblast growth factor receptor induce neurite outgrowth and survival of cerebellar granule neurons).

[0508] Sequence No. 37 and thereafter are cyclic peptides that are the subject of the present invention.

[0509] [Table 4]

[0510]

[0511]

[0512]

[0513]

[0514]

[0515]

[0516]

[0517]

[0518]

[0519]

[0520]

[0521] <Example 3: Evaluation of the bonding properties of cyclic peptide (chemically synthesized product)>

[0522] The FGFR binding properties of the cyclic peptide were evaluated using the surface plasmon resonance (SPR) method.

[0523] The cyclic peptides used for evaluation were custom synthesized by Toray Research Center, Inc.

[0524] The FGFR binding properties of the chemically synthesized cyclic peptide were evaluated by the following procedure.

[0525] A CM5 sensor chip (Cytiva, 29149603) was set up in a Biacore-T200 (manufactured by Cytiva), a surface plasmon resonance device, and HBS-EP buffer (Cytiva, BR100826) was added as a running buffer at a flow rate of 10 μL / min to balance the flow path. Next, 70 μL of a mixed aqueous solution of 0.2 mol / L EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide) and 0.05 mol / L NHS (N-hydroxysuccinimide) was added to activate the sensor chip. Afterwards, Recombinant Human FGFR2 alpha (IIIc) Fc Chimeric Protein CF (R&D systems, 712-FR-050) prepared to 50 nmol / L with Acetate 4.5 buffer (Cytiva, BR100350) was added and solidified to approximately 5000 RU. Subsequently, a blocking treatment was performed using an ethanolamine solution. In addition, in another channel of the sensor chip, FGFR was not immobilized but was blocked immediately after activation.

[0526] In each flow channel of the FGFR solid-state sensor chip prepared above, after adding a cyclic peptide diluted to 10 nmol / L using HBS-EP at 25°C for 10 minutes, HBS-EP was flowed as a running buffer for 30 minutes to measure the binding of the cyclic peptide to FGFR. Afterwards, the operation of flowing a regeneration solution made by dissolving sodium chloride powder in glycine 1.5 (Cytiva, BR100354) to a final concentration of 0.15 mol / L in each flow channel for 1 minute was repeated twice to perform a regeneration process to remove the bound cyclic peptide. The amount of cyclic peptide binding was evaluated based on the difference between the Biacore-T200 measurement value in the flow channel where FGFR was fixed when 10 nmol / L of cyclic peptide was passed and the Biacore-T200 measurement value in the flow channel where FGFR was not fixed.

[0527] Using the molecular weights of the cyclic peptide and FGFR, the amount of cyclic peptide bonded in the evaluation was normalized to the amount of cyclic peptide bonded per FGFR molecule, and the FGFR binding property was evaluated according to the following evaluation criteria, preferably evaluation criteria A, B, or C.

[0528] (Evaluation criteria for FGFR bonding)

[0529] A... The bonding amount is 0.7 cyclic peptide molecules / 1 FGFR molecule or more.

[0530] B ... The bonding amount is 0.5 or more cyclic peptide molecules / FGFR 1 molecule and less than 0.7 molecules / FGFR 1 molecule.

[0531] C ... The bonding amount is 0.1 cyclic peptide molecules / FGFR 1 molecule or more and less than 0.5 molecules / FGFR 1 molecule.

[0532] D……The bonding amount is less than 0.1 cyclic peptide molecules / 1 FGFR molecule.

[0533] Table 5 shows the evaluation results.

[0534] [Table 5]

[0535] The amino acid residues written in parentheses represent amino acid residues that form a cyclic structure based on a thioether bond or a disulfide bond between side chains.

[0536] For example, K (acetyl) refers to a structure in which a haloacetyl group is modified on the side chain of a lysine residue.

[0537] Cyclic structures in which atoms are replaced by thiol groups of other residues.

[0538]

[0539] <Example 4: Evaluation of FGFR versatility of cyclic peptides (chemically synthesized products)>

[0540] The binding of the cyclic peptide to various types of FGFR was evaluated using the surface plasmon resonance (SPR) method.

[0541] The cyclic peptides used for evaluation were custom synthesized by Toray Research Center, Inc.

[0542] The FGFR binding properties of the chemically synthesized cyclic peptide were evaluated by the following procedure.

[0543] A CM5 sensor chip (Cytiva, 29149603) was set up in a Biacore-T200 (manufactured by Cytiva), which is a surface plasmon resonance device, and HBS-EP buffer (Cytiva, BR100826) was added as a running buffer at a flow rate of 10 μL / min to balance the flow path. Next, 70 μL of a mixed aqueous solution of 0.2 mol / L EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide) and 0.05 mol / L NHS (N-hydroxysuccinimide) was added to activate the sensor chip. Afterwards, a cyclic peptide prepared at 2 mg / mL using HBS-EP buffer was added and solid-phased to approximately 200 RU. Afterwards, a blocking treatment was implemented using an ethanolamine solution. In addition, FGFR was not immobilized in another flow path of the sensor chip, but was immediately blocked after activation.

[0544] At 25°C, various FGFRs (FGFR1 Protein, Human, Recombinant (His Tag) (Sino Biological, 10616-H08H), FGFR2 Protein, Human, Recombinant (His Tag) (Sino Biological, 10824-H08H), FGFR3 Protein, Human, Recombinant (ECD, His Tag) (Sino Biological, 16044-H08H), FGFR4 Protein, Human, Recombinant (His Tag) (Sino Biological, 10538-H08H)) diluted to 1 μmol / L using HBS-EP were added to each flow channel of the cyclic peptide solid-state sensor chip prepared above for 10 minutes. Then, HBS-EP was allowed to flow as the running buffer for 30 minutes, and the binding of various FGFRs to the cyclic peptides was measured. Afterwards, a regeneration solution consisting of sodium chloride (final concentration 0.4 mol / L) and an aqueous sodium dodecyl sulfate solution (mixed concentration 1%, final concentration 0.2%) dissolved in glycine 1.5 (Cytiva, BR100354) was passed through each channel for 1 minute twice, thereby performing a regeneration process to remove bound FGFRs. The amount of cyclic peptide bound was evaluated based on the difference between the Biacore-T200 measurement value in the channel where the cyclic peptide was immobilized and the Biacore-T200 measurement value in the channel where the cyclic peptide was not immobilized when 1 μmol / L of FGFR was passed through.

[0545] The FGFR binding capacity evaluated above was normalized to the FGFR binding capacity per cyclic peptide molecule using the molecular weights of the cyclic peptide and FGFR, and the FGFR binding property was evaluated according to the following evaluation criteria, preferably evaluation criteria A, B, or C.

[0546] (Evaluation criteria for FGFR bonding)

[0547] A... The bonding amount is at least 0.05 FGFR molecules per 1 cyclic peptide molecule.

[0548] B ... The bonding amount is greater than or equal to FGFR 0.01 molecule / cyclic peptide molecule and less than or equal to FGFR 0.05 molecule / cyclic peptide molecule.

[0549] C ... The bonding amount is not less than FGFR0.005 molecules / 1 cyclic peptide molecule and less than FGFR0.01 molecules / 1 cyclic peptide molecule.

[0550] D……The bonding amount is less than FGFR0.005 molecules / cyclic peptide 1 molecule.

[0551] The evaluation results are shown in Table 6.

[0552] [Table 6]

[0553]

[0554] These results demonstrate that the cyclic peptide of the present invention can bind to various types of FGFR.

[0555] <Example 5: Stability Evaluation of Cyclic Peptide>

[0556] The molecular stability of the cyclic peptide was evaluated by analyzing the aqueous cyclic peptide solution treated with a reducing agent using LC (liquid chromatography).

[0557] The reducing agent treatment is carried out under the following conditions based on the glutathione concentration contained in the cells. 25 μL of a 0.2 mg / mL cyclic peptide aqueous solution was prepared, 58.8 μL of a 12.6 mmol / L DTT aqueous solution was added to the aqueous solution, and incubated at room temperature for 1 hour to obtain a reducing agent-treated cyclic peptide aqueous solution. The DTT aqueous solution was used after diluting 1 mol / L (+-)-dithiotriol (DTT) solution (FUJIFILM Wako Pure Chemical Corporation, 044-33871) with water. The total area of ​​all peaks in the LC / MS of the cyclic peptide before the reducing agent treatment was set to 100%, and the cyclic peptide residual rate was calculated by obtaining the ratio of the total area of ​​all peaks in the LC / MS of the reducing agent-treated cyclic peptide aqueous solution, and the molecular stability was evaluated according to the following evaluation criteria. Preferably, evaluation criteria A, B or C are used.

[0558] (Evaluation criteria for residual rate of cyclic peptide)

[0559] A……The residual rate of cyclic peptide is more than 90%

[0560] B……The residual rate of cyclic peptide is 70% or more and less than 90%

[0561] C……The residual rate of cyclic peptide is 50% or more and less than 70%

[0562] D……The residual rate of cyclic peptide is less than 50%

[0563] In addition, the LC used for the evaluation of molecular stability was set to the following conditions.

[0564] LC equipment: Prominence series (pump, column oven, autosampler, detector) (manufactured by Shimadzu Corporation)

[0565] Detector: Photodiode array detector (SPD-M20A), measuring wavelength 280nm

[0566] Column: TSKgel ODS-100V, inner diameter 4.6 mm × length 150 mm, particle size 5 μm (manufactured by Tosoh Corporation)

[0567] Eluent A: Contains 0.1% trifluoroacetic acid as a solvent and the solvent is 100% water

[0568] Eluent B: Contains 0.1% trifluoroacetic acid as a solvent and a 100% acetonitrile solution

[0569] Flow rate: 1.0 mL / min

[0570] Injection volume: 25 μL

[0571] Gradient: 20-50%: eluent B (0-15 min), 100%: eluent B (15 min)

[0572] Column temperature: 40°C

[0573] The evaluation results are shown in Table 7. The amino acid residues in parentheses represent amino acid residues that form a cyclic structure based on a thioether bond or a disulfide bond between the side chains. For example, K (acetyl) refers to a structure in which a haloacetyl group is modified on the side chain of a lysine residue. This cyclic peptide has a cyclic structure in which the halogen atom of the haloacetyl group is replaced by a thiol group of another residue.

[0574] [Table 7]

[0575]

[0576] These results indicate that cyclic peptides cyclized via a thioether bond are more stable than cyclic peptides cyclized via a disulfide bond.

[0577] Furthermore, the stability of a cyclic peptide containing a homocysteine ​​residue in the cyclized portion (SEQ ID NO: 450) and a cyclic peptide containing a cysteine ​​residue in the cyclized portion (SEQ ID NO: 442) were compared in the following alkali treatment, which is a more severe condition.

[0578] Alkali treatment was carried out by the following method. 25 μL of a 0.2 mg / mL cyclic peptide aqueous solution was prepared, 58.8 μL of a 0.5 mol / L sodium hydroxide aqueous solution was added to the aqueous solution, and the mixture was incubated at room temperature for 3 hours to obtain an alkali-treated cyclic peptide aqueous solution. The total area of ​​all peaks in the LC / MS of the cyclic peptide before alkali treatment was set to 100%, and the ratio of the total area of ​​all peaks in the LC / MS of the alkali-treated cyclic peptide aqueous solution was obtained to calculate the cyclic peptide residual rate. It was shown that the residual rate of sequence number 450 was 36%, and the residual rate of sequence number 442 was 61%. The stability of the cyclic peptide containing a homocysteine ​​residue in the cyclization portion is higher than the stability of the cyclic peptide containing a cysteine ​​residue in the cyclization portion.

[0579] The LC conditions used for evaluation of molecular stability were the same as those for the measurement of the cyclic peptide treated with the reducing agent.

[0580] <Example 6: Evaluation of Cell Proliferation-Promoting Effects of Cyclic Peptide Complex>

[0581] The FGFR phosphorylation ability of the cyclic peptide complex was evaluated by promoting the proliferation of BaF3 cells stably expressing FGFR.

[0582] BaF3 cells stably expressing FGFR were established as follows: a vector containing the FGFR gene (human: SinoBiologicals, HG10824-UT, cattle: Accession No. F1MNW2 sequence was introduced into pcDNA3.1 / Hygro(+)Mammalian Expression Vector (Thermo, V87020), pig: Accession No. A0A4X1SNN3 sequence was introduced into pcDNA3.1 / Hygro(+)Mammalian Expression Vector (Thermo, V87020), chicken: Accession No. A0A8V0XB17 sequence was introduced into pcDNA3.1 / Hygro(+)Mammalian Expression Vector (Thermo, V87020)) was introduced into BaF3 cells using Nucleofector (Lonza), and the cells into which the FGFR gene was introduced were selected using hygromycin.

[0583] The cyclic peptide complexes used for evaluation were custom synthesized by Toray Research Center, Inc.

[0584] The proliferation-promoting effect of BaF3 cells stably expressing FGFR was evaluated by the following method. First, RPMI-1640 with L-Glutamine and Phenol Red (FUJIFILM Wako Pure Chemical Corporation, 189-02025) and Fetal Bovine Serum (Thermo, 10270-106) were mixed at a volume ratio of 9:1, and then heparin (STEM CELL, 07980) was added to a final concentration of 8 μg / mL to prepare an evaluation medium (hereinafter referred to as RPMI (10% FBS) medium). Next, BaF3 cells stably expressing FGFR were washed twice in RPMI (10% FBS) medium, suspended in RPMI (10% FBS) medium in which the cyclic peptide complex was dissolved to a final concentration of 0.001 to 10 nmol / L, and seeded into 384-well plates. At this time, as a negative control, a condition without the addition of the cyclic peptide complex was prepared. After culturing for 2 nights at 37°C (5% CO2), Hoechst 33342, Trihydrocide, Trihydrate-10 mg / mL Solution in Water (Thermo, H3570), -Cellstain (registered trademark)-Calcein-AM solution (1 mg / mL DMSO solution) (DOJINDO, C396) and -Cellstain (registered trademark)-PI solution (DOJINDO, P378) were added to RPMI (10% FBS) culture medium at a final concentration of 1 / 1000 volume, and allowed to stand at room temperature for 1 hour. Live and dead staining was performed and images were taken using a confocal microscope (YOKOGAWA ELECTRIC CORPORATION, CQ1). The number of viable cells was calculated based on the imaging data, and the cell proliferation promoting effect was evaluated according to the following evaluation criteria. The number of viable cells in the negative control was approximately 100 cells / well. Evaluation criteria A, B or C are preferred.

[0585] (Evaluation criteria for cell proliferation promoting effect)

[0586] The concentration of the cyclic peptide complex that resulted in the highest number of viable cells was

[0587] A: The number of viable cells is 1000 cells / well or more.

[0588] B: The number of viable cells is 400 cells / well or more and less than 1000 cells / well.

[0589] C: The number of viable cells is 200 cells / well or more and less than 400 cells / well.

[0590] D...The number of viable cells is less than 200 cells / well.

[0591] The evaluation results are shown in Table 8 and Figure 2 The amino acid residues in parentheses represent amino acid residues that form a cyclic structure based on a thioether bond or a disulfide bond between the side chains. For example, K (acetyl) refers to a structure in which a haloacetyl group is modified on the side chain of a lysine residue. This cyclic peptide has a cyclic structure in which the halogen atom of the haloacetyl group is replaced by a thiol group of another residue.

[0592] [Table 8]

[0593]

[0594] These results demonstrate that the cyclic peptide complex formed by linking the cyclic peptides of the present invention can phosphorylate FGFRs derived from various animals.

[0595] The structures of the cyclic peptide complexes of SEQ ID NOs. 455 to 463 are shown below.

[0596] [Chemical Formula 15]

[0597]

[0598] [Chemical Formula 16]

[0599]

[0600] [Chemical Formula 17]

[0601]

[0602] [Chemical Formula 18]

[0603]

[0604] [Chemical Formula 19]

[0605]

[0606] [Chemical Formula 20]

[0607]

[0608] [Chemical Formula 21]

[0609]

[0610] [Chemical Formula 22]

[0611]

[0612] [Chemical Formula 23]

[0613]

[0614] <Example 7: Evaluation of the Proliferation-Promoting Effect of Cyclic Peptide Complex on Bovine Cells>

[0615] The cyclic peptide complex was evaluated for its ability to promote the proliferation of bovine cells (myoblasts).

[0616] Bovine myoblasts were isolated from bovine muscle tissue by the following method. First, the muscle tissue of black-haired cattle was minced in HBSS (-) (without phenol red) (FUJIFILM Wako Pure Chemical Corporation, 085-09355), and protnase from Streptomyces Griseus (Sigma-Aldrich, 10165921001) was added to a final concentration of 1 mg / mL, and the cells were allowed to stand at 37°C for 1 hour. After standing, HBSS containing 10% FBS was added, and the cells were obtained by centrifugation. The obtained cells were suspended in D-MEM (high glucose) (containing L-glutamine, phenol red) (FUJIFILM Wako Pure Chemical Corporation, 044-29765) containing bovine serum at a final concentration of 10% and 30 ng / mL of bFGF. Suspended cells were cultured in a culture flask coated with an iMatrix-511 solution (FUJIFILM WakoPure Chemical Corporation, 381-07363) at 0.55 μg / cm 2 . Bovine myoblasts passaged twice or more after the start of culture were used for evaluation.

[0617] The proliferation-promoting effect on bovine myoblasts was evaluated using the following method. Subcultured bovine myoblasts were detached using Trypsin-EDTA (0.05%) and phenol red (Thermo, 25300-054), suspended in D-MEM (high glucose) (containing L-glutamine and phenol red) containing 10% FBS, diluted to a final concentration of 30 ng / mL for bFGF or 0.03-10 nmol / L for the cyclic peptide complex, and seeded into 96-well plates coated with 0.55 μg / cm² of ImaMatrix-511. As a negative control, conditions without the addition of bFGF or the cyclic peptide complex were prepared. After culturing for 4 days at 37°C (5% CO2), the culture supernatant was removed and Hoechst 33342, Trihydrochloride, Trihydrate-10 mg / mL Solution in Water (Thermo, H3570) and -Cellstain (registered trademark)-Calcein-AM solution (1 mg / mL DMSO solution) (DOJINDO, C396) were added to D-MEM (high glucose) (containing L-glutamine and phenol red) containing 10% FBS at final concentrations of 1 / 10000 and 1 / 4000, respectively. The culture was allowed to stand at 37°C (5% CO2) for 30 minutes to stain all cells and living cells, and the images were taken using a confocal microscope (YOKOGAWA ELECTRIC CORPORATION, CQ1). The number of viable cells was calculated from the imaging data and normalized by setting the number of viable cells in the wells to which 30 ng / mL bFGF was added as 100 and the number of viable cells in the negative control wells as 0. The evaluation results are shown in FIG. Figure 3 middle.

[0618] The cyclic peptide complex (SEQ ID NO: 458) exhibited a bovine myoblast proliferation effect of approximately 40% of that of 30 ng / mL bFGF, indicating that the cyclic peptide complex of the present invention can also be used for the culture of bovine myoblasts.

Claims

1. A cyclic peptide or a salt thereof, comprising an amino acid sequence represented by X1-Xm-X2-Xn-X3 and comprising a cyclized portion cyclized by a covalent bond, wherein the cyclized portion comprises a structure represented by formula (2), [Chemical Formula 1] X1 represents a glutamine residue or a histidine residue, Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues, X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue, Xn represents an amino acid residue or a peptide residue containing 1 to 3 arbitrary amino acid residues, X3 represents an amino acid residue containing an aromatic residue in the side chain, Z1 and Z2 each independently represent a linking group, m represents an integer of 1 to 10.

2. The cyclic peptide or a salt thereof according to claim 1, which is represented by the following formula (1-1) or formula (1-2), [Chemical Formula 2] Where, W represents -Xm-X1-Y1- or Xk, where Xm is bonded to X2, Y1 is bonded to CO, In the case where W is -Xm-X1-Y1, V represents -NH-Y3, and L0 represents L, or V represents R, and L0 represents L1, In the case where W represents Xk, V represents -NH-X1-Y5, and L0 represents L, V1 represents -NH-Y3 or R, When V1 represents -NH-Y3, L0 represents L. When V1 represents R, L0 represents L1. X1 represents a glutamine residue or a histidine residue, Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues, Xk represents a peptide residue comprising 1 to 3 arbitrary amino acid residues, X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue, Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues, Xi represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues, X3 represents an amino acid residue containing an aromatic residue in the side chain, Y1 represents a single bond or an amino acid residue or peptide residue containing 1 to 10 arbitrary amino acid residues, Y2 represents a single bond or an amino acid residue or peptide residue containing 1 to 12 arbitrary amino acid residues, Y3 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, Y4 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, Y5 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, Y6 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, L and L1 represent the cyclization part, R represents the side chain structure of the amino acid, The amino terminal of X1 is bonded to the carboxyl terminal of Y1, and the carboxyl terminal of X1 is bonded to the amino terminal of Xm.

3. The cyclic peptide or a salt thereof according to claim 1, which is represented by the following formula (1A), formula (1B) or formula (1C), [Chemical Formula 3] Where, X1 represents a glutamine residue or a histidine residue, Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues, Xk represents a peptide residue comprising 1 to 3 arbitrary amino acid residues, X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue, Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues, Xi represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues, X3 represents an amino acid residue containing an aromatic residue in the side chain, Y1 represents a single bond or an amino acid residue or peptide residue containing 1 to 10 arbitrary amino acid residues, Y2 represents a single bond or an amino acid residue or peptide residue containing 1 to 12 arbitrary amino acid residues, Y3 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, Y4 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, Y5 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, Y6 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, V represents -NH-Y3 or R. When V is -NH-Y3, L0 represents L. When V is R, L0 represents L1. V1 represents -NH-Y3 or R. When V1 is -NH-Y3, L0 represents L. When V1 is R, L0 represents L1. L and L1 represent the cyclization part, R represents the side chain structure of the amino acid, The amino terminal of X1 is bonded to the carboxyl terminal of Y1, and the carboxyl terminal of X1 is bonded to the amino terminal of Xm.

4. The cyclic peptide or a salt thereof according to claim 1, which is represented by the following formula (1A1), formula (1A2), formula (1B), formula (1C1) or formula (1C2), [Chemical Formula 4] Where, X1 represents a glutamine residue or a histidine residue, Xm represents a peptide residue comprising 2 to 4 arbitrary amino acid residues, Xk represents a peptide residue comprising 1 to 3 arbitrary amino acid residues, X2 represents an alanine residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, a glutamine residue, a serine residue, a threonine residue, an asparagine residue, a glutamic acid residue, an arginine residue or a histidine residue, Xn represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues, Xi represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues, X3 represents an amino acid residue containing an aromatic residue in the side chain, Y1 represents a single bond or an amino acid residue or peptide residue containing 1 to 10 arbitrary amino acid residues, Y2 represents a single bond or an amino acid residue or peptide residue containing 1 to 12 arbitrary amino acid residues, Y3 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, Y4 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, Y5 represents a hydrogen atom, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, Y6 represents OH, or represents an amino acid residue or peptide residue containing 1 to 7 arbitrary amino acid residues, L and L1 represent the cyclization part, R represents the side chain structure of the amino acid, The amino terminal of X1 is bonded to the carboxyl terminal of Y1, and the carboxyl terminal of X1 is bonded to the amino terminal of Xm.

5. The cyclic peptide or a salt thereof according to claim 1, wherein Xm represents a group represented by -Xo-X4-, Xo represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues, X4 represents an alanine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue.

6. The cyclic peptide or a salt thereof according to claim 1, wherein Xm represents a group represented by -Xo-X4-, Xo represents an amino acid residue or peptide residue containing 1 to 3 arbitrary amino acid residues, X4 represents an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue, Xk represents a group represented by -Xj-X4-, Xj represents a single bond or an amino acid residue or peptide residue containing 1 to 2 arbitrary amino acid residues.

7. The cyclic peptide or a salt thereof according to claim 1, wherein Xm represents a group represented by -X5-X6-X4-, X5 represents an alanine residue, a proline residue, a leucine residue, an isoleucine residue, a valine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a serine residue, a glutamine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue, a methionine residue, an amino acid residue containing a thiol group forming a cyclization portion, or an amino acid residue containing a halocarboxyl group forming a cyclization portion, X6 represents any amino acid residue, X4 represents an alanine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue.

8. The cyclic peptide or a salt thereof according to claim 1, wherein Xm represents a group represented by -X5-X6-X4-, X5 represents an alanine residue, a proline residue, a leucine residue, an isoleucine residue, a phenylalanine residue, a tyrosine residue, a tryptophan residue, an asparagine residue, a glutamine residue, a threonine residue, an aspartic acid residue, a glutamic acid residue, an arginine residue, a histidine residue or a methionine residue, X6 represents any amino acid residue, X4 represents an isoleucine residue, a phenylalanine residue, a tyrosine residue, an asparagine residue, a histidine residue or a methionine residue, Xk represents a group represented by -X6-X4-.

9. The cyclic peptide or a salt thereof according to claim 4, wherein L represents [Chemical Formula 5] or [Chemical Formula 6] The cyclization part represented by , Z11 and Z12 each independently represent a linking group, m represents an integer from 1 to 10, * represents the position of the α carbon atom of the amino acid main chain, L1 represents the [Chemical Formula 7] represents the cyclization portion, Z12 represents a linking group, m represents an integer of 1 to 10, and * represents the position of the α-carbon atom of the amino acid main chain.

10. The cyclic peptide or a salt thereof according to claim 1, wherein The number of amino acid residues constituting the loop is 10 to 22.

11. The cyclic peptide or a salt thereof according to claim 1, wherein The cyclized portion contains a homocysteine ​​residue.

12. The cyclic peptide or salt thereof according to claim 1, comprising any one of the amino acid sequences of SEQ ID NOs. 37 to 450 and SEQ ID NOs. 452 to 454 described in Tables 4 to 6, or An amino acid sequence comprising 1 to 4 amino acids substituted, deleted, or inserted into any of the amino acid sequences of SEQ ID NOs: 37 to 450 and SEQ ID NOs: 452 to 454 described in Tables 4 to 6, and having the ability to bind to FGFR protein.

13. The cyclic peptide or salt thereof according to claim 1, comprising SEQ ID NOs: 37 to 51, 53 to 55, 57 to 61, 63 to 68, 70 to 89, 92 to 93, 103 to 104, 106 to 109, 114 to 115, 117, 119, 121 to 123, 125 to 133, 136 to 181, 187 to 189, 194 to 199, 201 to 203, 205 to 207, 211 to 218, 220 to 235, 236 to 240 any one of the amino acid sequences of SEQ ID NOs: 7-250, SEQ ID NOs: 254-270, SEQ ID NO: 272, SEQ ID NOs: 275-276, SEQ ID NOs: 278-291, SEQ ID NOs: 293-324, SEQ ID NOs: 328-337, SEQ ID NO: 339, SEQ ID NOs: 341-354, SEQ ID NO: 356, SEQ ID NOs: 358-360, SEQ ID NOs: 385-386, SEQ ID NOs: 391-392, SEQ ID NOs: 394-398, SEQ ID NO: 400, SEQ ID NOs: 402-403, SEQ ID NOs: 406-407, SEQ ID NOs: 409-411, SEQ ID NO: 430, SEQ ID NOs: 433-435, SEQ ID NOs: 437-444, SEQ ID NOs: 446-450, and SEQ ID NO: 452, or Including sequence numbers 37 to 51, sequence numbers 53 to 55, sequence numbers 57 to 61, sequence numbers 63 to 68, sequence numbers 70 to 89, sequence numbers 92 to 93, sequence numbers 103 to 104, sequence numbers 106 to 109, sequence numbers 114 to 115, sequence number 117, sequence number 119, sequence numbers 121 to 123, sequence numbers 125 to 133, sequence numbers 136 to 181, sequence numbers 187 to 189, sequence numbers 194 to 199, sequence numbers 201 to 203, sequence numbers 205 to 207, sequence numbers 211 to 218, sequence numbers 220 to 235, sequence numbers 237 to 250, sequence numbers 254 to 270, sequence number 272, sequence number 275 An amino acid sequence in which 1 to 4 amino acids are substituted, deleted, or inserted in any one of the amino acid sequences of SEQ ID NOs: 276, 278-291, 293-324, 328-337, 339, 341-354, 356, 358-360, 385-386, 391-392, 394-398, 400, 402-403, 406-407, 409-411, 430, 433-435, 437-444, 446-450, and 452, and has the ability to bind to FGFR protein.

14. The cyclic peptide or salt thereof according to claim 1, comprising SEQ ID NOs: 37 to 42, SEQ ID NO: 45, SEQ ID NOs: 47 to 51, SEQ ID NOs: 53 to 55, SEQ ID NOs: 60 to 61, SEQ ID NO: 63, SEQ ID NOs: 65 to 68, SEQ ID NOs: 71 to 88, SEQ ID NOs: 92 to 93, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NOs: 114 to 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NOs: 125 to 133, SEQ ID NOs: 136 to 170, SEQ ID NOs: 172 to 180, SEQ ID NOs: 187 to 188, SEQ ID NOs: 194 to 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NOs: 205 to 207, SEQ ID NOs: 211 to 212, SEQ ID NO: 214 any one of the amino acid sequences of SEQ ID NOs: 21-220, 220-235, 237-250, 254-260, 262-270, 272, 275, 278-290, 293, 295-324, 328-337, 339, 341-354, 356, 358-360, 391-392, 395, 397, 400, 402, 406, 409-411, 430, 433-435, 437-443, 446-450, and 452, or Serial numbers 37 to 42, 45, 47 to 51, 53 to 55, 60 to 61, 63, 65 to 68, 71 to 88, 92 to 93, 106, 108, 114 to 115, 117, 119, 121, 123, 125 to 133, 136 to 170, 172 to 180, 187 to 188, 194 to 199, 201, 203, 205 to 207, 211 to 212, 214 to 218, 220 to 235, 237 to 250, 251 to 257 An amino acid sequence in which 1 to 4 amino acids are substituted, deleted, or inserted in any of the amino acid sequences of SEQ ID NOs: 254-260, SEQ ID NOs: 262-270, SEQ ID NO: 272, SEQ ID NO: 275, SEQ ID NOs: 278-290, SEQ ID NO: 293, SEQ ID NOs: 295-324, SEQ ID NOs: 328-337, SEQ ID NO: 339, SEQ ID NOs: 341-354, SEQ ID NOs: 356, SEQ ID NOs: 358-360, SEQ ID NOs: 391-392, SEQ ID NO: 395, SEQ ID NO: 397, SEQ ID NO: 400, SEQ ID NO: 402, SEQ ID NO: 406, SEQ ID NOs: 409-411, SEQ ID NO: 430, SEQ ID NOs: 433-435, SEQ ID NOs: 437-443, SEQ ID NOs: 446-450, and SEQ ID NO: 452, and having the ability to bind to FGFR protein. The cyclic peptide or a salt thereof according to claim 1 , which is modified with other substances. A cyclic peptide complex or a salt thereof, which is composed of two or more molecules of the cyclic peptide or a salt thereof according to any one of claims 1 to 15 connected via a linker. 17 . A cyclic peptide complex or a salt thereof, which is formed by linking two molecules of the cyclic peptide or a salt thereof according to claim 1 through a linker. The cyclic peptide complex or a salt thereof according to claim 16, which is modified with other substances. A culture medium composition or culture medium additive comprising the cyclic peptide or a salt thereof according to any one of claims 1 to 15.

20. A material for purification, comprising the cyclic peptide or a salt thereof according to any one of claims 1 to 15. A labeling material comprising the cyclic peptide or a salt thereof according to any one of claims 1 to 15.

22. A cell control material comprising the cyclic peptide or a salt thereof according to any one of claims 1 to 15.

23. An integration material comprising the cyclic peptide or a salt thereof according to any one of claims 1 to 15. A culture medium composition or culture medium additive comprising the cyclic peptide complex or a salt thereof according to claim 16. A material for purification, comprising the cyclic peptide complex or a salt thereof according to claim 16. A labeling material comprising the cyclic peptide complex or a salt thereof according to claim 16 . A cell control material comprising the cyclic peptide complex or a salt thereof according to claim 16.

28. An integration material comprising the cyclic peptide complex or a salt thereof according to claim 16.

Images