Specific nano antibody targeting bovine TLR7 protein as well as screening method and application of specific nano antibody
By constructing a highly diverse library using phage display technology, high-purity and high-specificity nanobodies targeting bovine TLR7 protein were screened, solving the problem that traditional antibodies have difficulty targeting intracellular TLR7 and achieving efficient diagnosis and immunotherapy for bovine viral diarrhea.
Patent Information
- Application Number
- CN202510968779.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-14
- Publication Date
- 2025-10-28
AI Technical Summary
In the existing technology, traditional antibodies are difficult to effectively target intracellular TLR7 proteins, and there is a lack of efficient methods to screen highly antigenic epitopes of bovine TLR7, which has limited the development of specific nanoantibodies.
A highly diverse library was constructed using phage display technology. Through a multi-parameter synergistic epitope screening system, high-purity and highly specific nanobodies targeting bovine TLR7 protein were screened out. The long CDR3 structure unique to VHH (Varicella vesicles) of the Camelidae family was utilized to achieve precise targeting and high penetration.
High-purity, high-specificity nanobodies were successfully designed, revealing the division of labor mechanism of TLR7 in intracellular immunity and secretory antiviral therapy, providing theoretical support for the diagnosis and immunotherapy of diseases such as bovine viral diarrhea.
Smart Images

Figure CN120842403A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to a specific nanobody targeting bovine TLR7 protein, its screening method, and its application. Background Technology
[0002] In the global livestock industry, cattle farming, as an important economic pillar, faces severe challenges from frequent outbreaks of various viral infectious diseases such as bovine viral diarrhea and foot-and-mouth disease. These diseases cause billions of dollars in economic losses annually. Toll-like receptors (TLRs), as key components of the innate immune system, have a member called TLR7, which is mainly located in endosomes and is responsible for recognizing viral single-stranded RNA. By activating nuclear factor κB (NF-κB) and interferon regulatory factor signaling pathways, it induces the production of antiviral cytokines and is an important line of defense for bovine antiviral immunity. However, current research on the structural characteristics, functional mechanisms, and immunomodulatory effects of bovine TLR7 protein is still insufficient, and breakthroughs are urgently needed to utilize it to enhance bovine disease resistance.
[0003] Traditional monoclonal or polyclonal antibodies suffer from drawbacks such as poor tissue penetration due to their molecular weight of approximately 150 kDa, high production costs and long cycles due to reliance on hybridoma technology, and poor stability under extreme conditions, making it difficult to effectively target intracellular TLR7 proteins. In contrast, nanobodies (Nb) derived from the variable region fragment (VHH) of natural heavy chain antibodies from camels have advantages such as a molecular weight of approximately 15 kDa, high tissue penetration, strong stability, simple and low-cost preparation, and the ability to be genetically engineered. Currently, the lack of a precise identification and efficient screening system for the highly antigenic epitope of bovine TLR7 limits the development of specific nanobodies. Summary of the Invention
[0004] This invention aims to provide a specific nanobody targeting bovine TLR7 protein, its screening method and application. The specific nanobody targeting bovine TLR7 protein has strong stability, high specificity and super affinity.
[0005] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:
[0006] A specific nanobody targeting bovine TLR7 protein, wherein the nanobody is capable of specifically binding to a B-cell antigenic epitope of bovine TLR7 protein, the B-cell antigenic epitope being selected from SEQ ID NO:1 and / or SEQ ID NO:2.
[0007] Preferably, the nucleotide sequence of the nanobody is one of the following:
[0008] Nb-TLR7-1, as shown in SEQ ID NO:3;
[0009] Nb-TLR7-2, as shown in SEQ ID NO:4;
[0010] Nb-TLR7-3, as shown in SEQ ID NO:5.
[0011] This invention also provides a method for constructing a phage display library for screening the nanobodies, comprising the following steps:
[0012] S1. The B cell antigen is conjugated with hemocyanin to obtain an immunogen;
[0013] S2. Immunize alpacas with the immunogen obtained in S1, isolate peripheral blood lymphocytes and extract total RNA.
[0014] S3. The VHH gene fragment was amplified by nested PCR and cloned into the pCANTAB-5E vector to obtain the recombinant vector;
[0015] S4. Transform the recombinant vector obtained in S3 into ER2738 competent cells to construct a library with a volume ≥1.02×10⁻⁶. 8 A phage display library with a capacity of CFU / mL.
[0016] This invention also provides a method for screening bovine TLR7-specific nanobodies, comprising the following steps:
[0017] T1. Using bovine TLR7 protein as the target, the constructed phage display library was subjected to at least four rounds of biological screening.
[0018] T2. Positive clones were screened by phage ELISA and their binding affinity was determined;
[0019] T3. Select nanobody clones that specifically bind to bovine TLR7 protein.
[0020] The present invention also provides a biological reagent comprising the aforementioned nanobody for detecting the expression level of TLR7 protein in bovine tissue or body fluid samples.
[0021] The present invention also provides an antiviral pharmaceutical composition comprising the aforementioned nanobody and a pharmaceutically acceptable carrier for the prevention or treatment of bovine viral diarrhea virus infection.
[0022] The present invention also provides the application of the nanobody as described in the preparation of a bovine TLR7 protein detection kit.
[0023] Compared with the prior art, the present invention has the following advantages and technical effects:
[0024] This invention discloses a specific nanobody targeting bovine TLR7 protein, its screening method, and its application. A novel multi-parameter synergistic epitope screening system (flexibility / hydrophilicity / random coil conformation / deamide residue removal) was established, successfully designing high-purity (>90%), highly specific antigenic epitopes (TLR7: 618-631 / 484-497). Based on phage display technology, a highly diverse library was constructed, and a nanobody with super affinity (Nb-TLR7-1, KD<1nM) was screened. This nanobody utilizes the unique long CDR3 structure of camelid VHH to achieve precise targeting, exhibiting both high penetration and stability. This not only reveals the division of labor mechanism of TLR7 in intracellular immunity and secretory antiviral therapy but also provides theoretical support and technical reserves for the portable diagnosis of bovine viral diarrhea and other diseases, the design of RNA vaccine adjuvants, and the development of immunotherapy delivery systems.
[0025] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0026] Figure 1 The chromatogram and mass spectrum of the immunogen prepared in Example 1, wherein, Figure 1 In this context, A represents a chromatogram. Figure 1 B in the image represents the mass spectrum.
[0027] Figure 2 The results of the alpaca serum antibody titer determination in Example 2 are shown.
[0028] Figure 3 The results of total RNA detection by agarose gel electrophoresis in Example 2 are shown.
[0029] Figure 4 Example 2 shows the results of VHH nested PCR amplification, in which... Figure 4 In the diagram, A represents the result of the first round of PCR amplification. Figure 4 B in the diagram represents the result of the second round of PCR amplification;
[0030] Figure 5 The results of Sfil enzyme digestion of the pCANTAB5E-ccdb vector in Example 2;
[0031] Figure 6 This refers to the VHH library capacity in Example 2;
[0032] Figure 7 The abundance of VHH in Example 2;
[0033] Figure 8 The results of the positive rate identification of the VHH library in Example 2;
[0034] Figure 9 The results of ELISA for 96 single clones of TLR7 protein in Example 3;
[0035] Figure 10 The amplification results of the Nb gene in Example 4 are shown, where M is DL500, 1 is Nb-TLR7-1, 2 is Nb-TLR7-2, 3 is Nb-TLR7-3, and 4 is blank.
[0036] Figure 11 The results are the bacterial culture PCR results in Example 4, where M is DL1000, 1 is Nb-TLR7-1 bacterial culture, 2 is Nb-TLR7-2 bacterial culture, 3 is Nb-TLR7-3 bacterial culture, and 4 is blank.
[0037] Figure 12 The following are the SDS-PAGE results of antibody proteins Nb-TLR7-1, Nb-TLR7-2, and Nb-TLR7-3 in Example 4. In this table, M represents the protein mark, 1 represents the control (without IPTG), 2-3 represent the supernatant and precipitate of Nb-TLR7-1 induced lysate, 4-5 represent the supernatant and precipitate of Nb-TLR7-2 induced lysate, and 6-7 represent the supernatant and precipitate of Nb-TLR7-3 induced lysate.
[0038] Figure 13 The results show the purification of Nb-TLR7-1, where M is the protein marker, 1 is the lysis buffer, 2 is the flow buffer, 3-4 are the denaturing lysis buffer washes, 5-6 are the denaturing washes, and 7-9 are the elution buffers.
[0039] Figure 14 The results show the purification of Nb-TLR7-2, where M is the protein marker, 1 is the lysis buffer, 2 is the flow buffer, 3-4 are the washing buffer, and 5-8 are the elution buffer.
[0040] Figure 15 The results show the purification of Nb-TLR7-3, where M is the protein mark, 1 is the lysis buffer, 2 is the flow buffer, 3-4 are the denaturing lysis buffer washes, 5-7 are the denaturing washes, and 8-9 are the elution buffers.
[0041] Figure 16 The results of Western Blot identification of Nb-TLR7-1, Nb-TLR7-2, and Nb-TLR7-3 are shown. M is the protein mark, 1 is the purified Nb-TLR7-1, 2 is the purified Nb-TLR7-2, and 3 is the purified Nb-TLR7-3.
[0042] Figure 17 ELISA analysis of antibody-protein affinity statistics;
[0043] Figure 18The results show the thermostability of Nb-TLR7-1, Nb-TLR7-2, and Nb-TLR7-3 nanobodies. Detailed Implementation
[0044] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0045] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.
[0046] Source of experimental materials:
[0047] In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.
[0048] Example 1
[0049] The screening and synthesis of bovine TLR7 protein B-cell antigenic epitopes are described below:
[0050] Bioinformatics analysis: The IEDB platform was used to comprehensively predict the flexibility (Bnorm>1.0), hydrophilicity (GRAVY<0), surface accessibility (Emini>1.0), and antigenic index (Jameson-Wolf>1.0) of bovine TLR7 protein (NP_001028933.1) to screen out highly antigenic regions.
[0051] The amino acid sequence from position 618 to 631 is ATSTSRTMESESLQ (SEQ ID NO:1);
[0052] The amino acid sequence from position 484 to 497 is RSKSKEPPSFLPLN (SEQ ID NO:2).
[0053] Transmembrane domains were excluded using TMHMM, random coil conformations (avoiding α-helices) were verified using the SOPMA algorithm, and ProtParam was used to evaluate the removal of easily deamide residues (N / Q). Finally, the above epitopes were determined as immunogen targets.
[0054] Antigen preparation:
[0055] Immunogens were prepared by conjugating the polypeptide sequences of SEQ ID NO:1 and SEQ ID NO:2 to hemocyanin (KLH) via Fmoc solid-phase synthesis. Purity was verified by HPLC, and molecular weight was verified by mass spectrometry. Results are as follows: Figure 1 .
[0056] Depend on Figure 1 As can be seen from A in the data, the purity of the immunogens is all >90%; Figure 1 As indicated by B in the figure, the mass spectrometry analysis shows that the deviation between the measured value and the theoretical value is <0.1%, which meets the requirements of the immunoassay experiment.
[0057] Example 2:
[0058] Construction of a bovine TLR7-specific nanobody phage display library
[0059] Immunization of alpacas and antibody titer testing:
[0060] An adult male alpaca in good condition, not recently vaccinated, was selected and immunized with the immunogen prepared in Example 1 via subcutaneous multi-site injection. This immunization program consisted of four immunizations, each with an antigen dose of 200 μg, and the interval between immunizations was two weeks. For the first immunization, the antigen was diluted and emulsified with an equal volume of complete Freund's adjuvant before being injected at multiple sites. For subsequent immunizations, incomplete Freund's adjuvant was used instead of complete Freund's adjuvant for emulsification.
[0061] Peripheral blood samples were collected from the experimental alpacas after the fourth immunization, and serum was separated. TLR7-specific antibodies were detected by indirect ELISA. The results are as follows: Figure 2 .
[0062] Depend on Figure 2 It can be seen that the antibody titer of alpaca serum reaches 1:204800, which is significantly higher than the threshold standard required for library construction and fully meets the experimental requirements for subsequent nanobody library construction.
[0063] Lymphocyte isolation and VHH gene amplification:
[0064] Peripheral blood lymphocytes were isolated from alpacas, and total RNA was extracted from the lymphocytes using Trizol reagent. 1 μg of RNA was analyzed by agarose gel electrophoresis. Results are as follows: Figure 3 .
[0065] Depend on Figure 3 As can be seen, agarose gel electrophoresis showed clear 28S and 18S ribosomal RNA bands, accompanied by a weaker 5S band.
[0066] The results of RNA concentration and purity testing are as follows:
[0067] The TLR7 protein RNA concentration was 212 ng / μL, the A260 / A280 ratio was 2, and the A260 / A230 ratio was 2.14. All ratios were within the standard range, indicating that the extracted total RNA was of good integrity and met the requirements for subsequent experiments.
[0068] according to cDNA was synthesized using the IIGreen One-Step qRT-PCR SuperMix Green One-Step qRT-PCR Kit according to the instructions. The concentration, A260 / A280, and A260 / A230 of the cDNA were measured using a spectrophotometer. The results are as follows:
[0069] The TLR7 protein cDNA concentration was 1100 ng / μL, with an A260 / A280 ratio of 1.85 and an A260 / A230 ratio of 2.02, indicating a high concentration and good purity.
[0070] Nested first-round PCR amplification was performed using reverse-transcribed cDNA as a template. After amplification according to the system and conditions, the results were identified using a 1.5% agarose gel. Figure 4 As shown in A, the fragment around 700bp was recovered. Using the recovered product from the first round as a template, a second round of nested PCR amplification was performed under the same conditions. The identification results are shown below. Figure 4 As shown in B, the amplification product is the VHH fragment, which is approximately 350 bp in size, consistent with expectations. The target gene fragment was recovered by gel extraction.
[0071] Library construction and quality assessment:
[0072] The pCANTAB5E-ccdb vector and the VHH gene fragment were double-digested with the restriction endonuclease SfiI. After purification by agarose gel electrophoresis, the vector and gene fragment were ligated using T4 DNA ligase. By optimizing the molar ratio of vector to insert fragment in the ligation system, the recombinant vector was obtained, such as... Figure 5 As shown.
[0073] The recombinant vector was added to ER2738 competent cells, and electroporation was performed at 1800V, 200Ω, and 5ms. After adding culture medium and shaking, the cells were centrifuged, and 100 μL of the bacterial suspension was taken to measure the library volume. The remaining bacterial suspension was plated and incubated overnight. The next day, the bacterial plaques were collected and resuspended, and 100 μL was taken to measure the library abundance. The suspension was then stored at -80℃ with 60% glycerol, successfully constructing the VHH phage display library. To evaluate the library volume and abundance, a serial dilution method was used. The experimental protocol was as follows: 100 μL of the electroporated bacterial suspension was taken and serially diluted. First, 100 μL of the bacterial suspension was added to 900 μL of culture medium and mixed well, resulting in a concentration of 10:10. -1 Then, take 100 μL of the bacterial culture and add it to another tube containing 900 μL of culture medium, mix well, and the concentration will be 10. -2 Dilute sequentially, with the lowest concentration being 10. -8 The samples were coated onto plates, incubated overnight at 37°C, and then the storage volume was measured. Results are as follows: Figures 6-7 .
[0074] Depend on Figure 6 It can be seen that 10-6 A total of 102 single-clone colonies were detected on the dilution plate, based on which the library volume was calculated to be 1.02 × 10⁻⁶. 8 This result demonstrates that the constructed VHH phage display library possesses high diversity and abundance, providing a solid foundation for subsequent antigen screening and antibody research.
[0075] Depend on Figure 7 It can be seen that the 10 -8 There were 30 single-clone colonies on the dilution plate. The abundance of the phage display library was calculated to be 3.0 × 10⁻⁶. 10 CFU / mL. This provides a sufficient material basis for subsequent screening and functional studies, ensuring that multiple potential antibody sequences in the library can be covered during the screening process, thereby improving screening efficiency and success rate.
[0076] In the first round of screening, immunotubes were coated with 20 μg / mL TLR7 protein, followed by primary library phage rescue. After culturing, infection, and precipitation, rescued phages were obtained. The next day, the tubes were washed and sealed, then incubated with phages to wash away the infecting bacteria. The bacterial suspension was plated, colonies were collected, and glycerol was added to a 15% concentration to prepare a primary library, which was then cryopreserved at -70°C. In the second round of screening, the TLR7 antigen coating concentration was reduced to 10 μg / mL, and the binding and washing conditions were improved to prepare a secondary library. In the third and fourth rounds of screening, the antigen coating concentration was adjusted to 5 μg / mL, and the library amplification and washing conditions were optimized to prepare tertiary and quaternary libraries. After the fourth round of screening, 48 single clones were randomly selected for colony PCR identification. The results are as follows: Figure 8 .
[0077] Depend on Figure 8 The insertion rate reached 100%. Sequencing of 96 positive clones and alignment with NCBI showed that all sequences were highly homologous to alpaca VHH, with diverse nucleotide compositions, fully demonstrating the diversity of the VHH gene. The experimental results confirmed that the constructed phage display library contained abundant VHH variants, providing high-quality gene resources for subsequent specific antibody screening, and the library quality met experimental requirements.
[0078] Example 3
[0079] Screening and identification of bovine TLR7-specific nanobodies
[0080] To screen VHH phages that specifically bind to bovine TLR7 protein from the VHH phage library, four consecutive rounds of biopanning were performed using phage ELISA coated with bovine TLR7 protein as the antigen. During the phage display library panning process, the enrichment dynamics of specific VHH phages were systematically evaluated by quantitatively analyzing the titer levels of recombinant phages after each round of panning. The number of phages rescued was recorded as the input, and the number of phages eluted was recorded as the output. The recovery rate reflected the efficiency of the specific interaction, and the results are shown in Table 1.
[0081] Table 1. Enrichment of TLR7 protein by four-round phage panning
[0082] Number of times of sifting Input Output Recovery rate First round of screening <![CDATA[3.2×10 11 ]]> <![CDATA[2.4×10 3 ]]> <![CDATA[7.5×10 -9 ]]> Second round of screening <![CDATA[3.2×10 11 ]]> <![CDATA[1.1×10 4 ]]> <![CDATA[3.43×10 -8 ]]> Third round of screening <![CDATA[3.6×10 11 ]]> <![CDATA[3.1×10 6 ]]> <![CDATA[8.611×10 -6 ]]> Fourth round of screening <![CDATA[3.6×10 11 ]]> <![CDATA[5.0×10 6 ]]> <![CDATA[1.389×10 -5 ]]>
[0083] As shown in Table 1, the phage recovery rate increased continuously after four rounds of screening, indicating that the specific VHH phage of TLR7 protein was continuously enriched.
[0084] Positive clone screening and sequencing:
[0085] After the phages eluted in the fourth round of screening were used to infect ER2738 bacterial culture, they were serially diluted and plated, and 96 single clones were randomly selected. The specific binding ability of the phage supernatant of each clone to the TLR7 protein was determined using an indirect ELISA method to screen for high-affinity positive clones, ensuring accurate selection of functionally active candidate clones from the library. The results of the indirect ELISA are shown below. Figure 9 .
[0086] Positive clones with high binding affinity to TLR7 protein were selected and sequenced by Sangon Biotech, successfully obtaining 20 valid sequences. The amino acid sequences of three TLR7-specific nanobodies (TLR7-Nb1, TLR7-Nb2, and TLR7-Nb3) were obtained, including:
[0087] The Nb-TLR7-1 nucleotide sequence is shown in SEQ ID NO:3;
[0088] TTGCAGCTCGTGGAGTCAGGTGGAGGCTTGGTGCAGGCTGGGGGGTCTCTGATACCCTCCTGTGAATACTCCGGATTCATATCCGATGACTATGGCATAGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGTGAGGGGCTCGCATCTATCAGTATTACAGATGGTCAGCGGTACTATGCAGGCTCCGTGCAGGGCCGATTCACCATTTCCAGTGACAACGCCAAGAACACGGTGTATCTGCAAATAAACAGCCTGAAACCTGAGGACACGGGCGTTTATTATTGTGCAGCAGACAGATCCGCGACTGCTCAGAGTATGGGTCTCATGATCCAGATGGGCCTTTCTTATGCGTATGACTACTGGGGCCAGGGGATCCAGGTCACCGTCTCCTCAGCGCACCACAGCGAAGACCCCAGCTCC
[0089] The nucleotide sequence of Nb-TLR7-2 is shown in SEQ ID NO:4;
[0090] TTGCAGCTCGTGGAGTCAGGTGGAGGCTTGGTGCAGGCTGGGGGGTCTCTGAGACTCTCCTGTGTAGTCTCTGGATTCAGTCTCGATGATTATTTAATAGGCTGGTTCCACCAGGCCCCAGGGAAGGAGCGTAAGTTGGTCTCATGTATTAATAGCCAATGGAATATGACATATTATGAAGACTCCGTGGAGGGCCGATTCACCATCTCCAGTGACAAAGCCAAGAACATGGTCGATCTGCAAATGAACAATTTAAAGCCTGAGGACACGGCCATTTATTACTGTGCAGCAGCCCGAGGGCTCCATATTGTCCCGCCGCCCCTCGACGATTATACCTACTGGGGTCAGGGGACGCAGGTCACCGTCTCCTCAGCGCACCACAGCGAAGACCCCAGCTCC
[0091] The nucleotide sequence of Nb-TLR7-3 is shown in SEQ ID NO:5.
[0092] TTGCAGCTCGTGGAGTCCGGAGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGCAGCCTCAACAAATCATCGACGAGACCAAAGTTATGGCTTGGTACCGTCAGGCTCCAGGGAAAGAGCGCGAATTGGTCGCGACGATTGCCTCTGGGGGACGTATGTACTATACGAACTCCGTGAAGG GCCGATTCACCATCTCCATCGACAACGCCAGGAGGACGGTATATCTGCGGATGGACAGCCTGAAATCTGAGGACACTGCCGTCTATTATTGTAACATGGGGACTACGGGTCCCTGGGTTGGTCCTGAGTACTGGGGCCAGGGGGACCCAGGTCACCGTCTCGTCAGCGCACCACAGCGAAGACCCCAGCTCC
[0093] Example 4
[0094] Prokaryotic expression and purification of nanobodies
[0095] Construction of recombinant vectors:
[0096] First, select positive monoclonal bacteria. Inoculate and culture the correctly sequenced monoclonal strains, extract the pET-30a(+) plasmid as a template, and design primers for PCR amplification, such as... Figure 10 The amplified product showed a single specific band at approximately 400 bp, consistent with expectations. The target gene was then recovered via gel electrophoresis. The empty vector was digested with double enzymes and recovered via gel electrophoresis. The Nb gene and vector were ligated using a seamless cloning method, and the mixture was transformed into DH5α competent cells. Single colonies were then identified by PCR. The results are as follows: Figure 11 .
[0097] Depend on Figure 11 The sequencing of the positive bacterial culture and the alignment with Megalign showed that the results were consistent with the target sequence, indicating that the recombinant plasmid was successfully constructed, laying the foundation for subsequent research on VHH gene expression and function.
[0098] Soluble expression and purification of Nb:
[0099] The recombinant plasmid was transformed into BL21(DE3) competent cells. After expansion culture, expression was induced at 16℃ with a final concentration of 0.5 mM IPTG. Induction was performed at 16℃ for 16 h, with an empty vector as a control. After induction, the bacterial culture was collected, centrifuged, and the supernatant was discarded. The liquid culture medium was washed with PBS, and the cells were resuspended in PBS. The cells were then sonicated at 4℃ on ice (4 sec, 6 sec interval, 100 W), centrifuged, and the supernatant was collected. 40 μL of the supernatant was transferred to a centrifuge tube, 10 μL of 5× protein loading buffer was added, and the mixture was thoroughly mixed. The tube was then boiled in 100℃ water for 10 min, centrifuged, and the supernatant was analyzed by SDS-PAGE to detect VHH protein expression. The results are as follows: Figure 12 .
[0100] Depend on Figure 12 It was found that Nb-TLR7-1 and Nb-TLR7-3 were expressed in inclusion bodies, and Nb-TLR7-2 was expressed in both the supernatant and inclusion bodies. SDS-PAGE analysis confirmed the expression of Nb-TLR7-1 and Nb-TLR7-3. Figures 13-15 As shown.
[0101] Depend on Figures 13-15 As can be seen, the target proteins appearing on the gel are all consistent with the expected size, indicating that Nb-TLR7-1, Nb-TLR7-2, and Nb-TLR7-3 proteins have all been successfully purified.
[0102] The concentrations of purified Nb-TLR7-1, Nb-TLR7-2, and Nb-TLR7-3 proteins were determined using the Bradford method with BSA as a standard. The results showed that the concentrations of Nb-TLR7-1, Nb-TLR7-2, and Nb-TLR7-3 were 3.324 μg / μL, 0.678 μg / μL, and 0.728 μg / μL, respectively. All target proteins were effectively purified, and their concentrations met the requirements for subsequent experiments.
[0103] Western blot verification was performed, and the results are as follows: Figure 16 As shown.
[0104] Depend on Figure 16 The recombinant nanobody proteins exhibited clear, specific bands at their expected molecular weight positions, confirming the purified nanobody's good biological activity and reactivity. These results, obtained through Western blotting, visually validated the functional integrity of the target protein, providing crucial experimental evidence for subsequent studies on its interaction with antigens and its immunological applications.
[0105] Identification of the specificity and thermal stability of Nb
[0106] To identify the specificity of Nb, indirect ELISA was performed using TLR7 protein as the coating antigen, with other proteins and PBS as controls. The results are as follows: Figure 17 .
[0107] Depend on Figure 17 As can be seen from the ELISA titer assay results, the Nb-TLR7-1 nanobody exhibits significantly higher reactivity than other clones, and its titer level shows a stronger signal intensity in the detection system.
[0108] Temperature stability analysis of three nanobodies was performed: Nb-TLR7-1, Nb-TLR7-2, and Nb-TLR7-3 were incubated in water baths at 4℃, 30℃, 40℃, 50℃, 60℃, 70℃, 80℃, and 90℃ for 2 hours, respectively. After dilution to 5 μg / mL, the remaining binding activity was detected by ELISA. Results are as follows: Figure 18 .
[0109] Depend on Figure 18 It can be seen that the thermal stability of nanobodies varies significantly. The activity of Nb-TLR7-1 decreases significantly with increasing temperature, and the decrease intensifies after 40℃, indicating poor thermal stability. The activity of Nb-TLR7-2 is generally stable, with the strongest temperature tolerance and the best thermal stability. The activity of Nb-TLR7-3 reaches its peak at 60℃, and decreases rapidly above this temperature. The above results indicate that the thermal stability of different nanobodies varies significantly, providing key activity evaluation criteria for their application in different temperature environments (such as high temperature or room temperature scenarios), and helping to screen nanobodies suitable for specific temperature conditions.
[0110] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A specific nanobody targeting bovine TLR7 protein, characterized in that, The nanobody can specifically bind to the B-cell antigenic epitope of bovine TLR7 protein, wherein the B-cell antigenic epitope is selected from SEQ ID NO:1 and / or SEQ ID NO:
2.
2. The nanobody according to claim 1, characterized in that, The nanobody nucleotide sequence is one of the following: Nb-TLR7-1, as shown in SEQ ID NO:3; Nb-TLR7-2, as shown in SEQ ID NO:4; Nb-TLR7-3, as shown in SEQ ID NO:
5.
3. A method for constructing a phage display library, characterized in that, The screening of nanobodies according to any one of claims 1-2 includes the following steps: S1. The B cell antigen described in claim 1 is conjugated with hemocyanin to obtain an immunogen; S2. Immunize alpacas with the immunogen obtained in S1, isolate peripheral blood lymphocytes and extract total RNA. S3. The VHH gene fragment was amplified by nested PCR and cloned into the pCANTAB-5E vector to obtain the recombinant vector; S4. Transform the recombinant vector obtained in S3 into ER2738 competent cells to construct a library with a volume ≥1.02×10⁻⁶. 8 A phage display library with a capacity of CFU / mL.
4. A method for screening bovine TLR7-specific nanobodies, characterized in that, The steps include: T1. Using bovine TLR7 protein as the target, perform at least four rounds of biological screening on the phage display library constructed in claim 3; T2. Positive clones were screened by phage ELISA and their binding affinity was determined; T3. Select nanobody clones that specifically bind to bovine TLR7 protein.
5. A biological reagent comprising the nanobody according to any one of claims 1-2, for detecting the expression level of TLR7 protein in bovine tissue or body fluid samples.
6. An antiviral pharmaceutical composition comprising the nanobody as described in any one of claims 1-2 and a pharmaceutically acceptable carrier, for the prevention or treatment of bovine viral diarrhea virus infection.
7. The application of the nanobody as described in claim 1 in the preparation of a bovine TLR7 protein detection kit.
Citation Information
Cited By
Goat sperm specific tlr7 nanobody, coding gene, carrier and application thereof
CN122541570A