Staphylococcus carnosus with high salt tolerance and good fermentation characteristics and application thereof

By providing highly salt-tolerant Staphylococcus aureus XUCSB 022, the problems of insufficient salt tolerance and fermentation characteristics in meat product fermentation are solved, achieving nitrite degradation and unique flavor formation in high-salt environments, thus improving the quality and safety of fermented meat products.

CN120843342BActive Publication Date: 2026-03-27HEFEI UNIV OF TECH
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510981434.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-16
Publication Date
2026-03-27
Estimated Expiration
2045-07-16

AI Technical Summary

Technical Problem

Existing Staphylococcus aureus strains have limited salt tolerance and fermentation characteristics in the production of meat products under different salt concentrations, making it difficult to adapt to processing conditions with varying salt content.

Method used

A strain of Staphylococcus aureus XUCSB 022 (CGMCC No. 34991) is provided. This strain is highly salt-tolerant, can grow under conditions of ≥18% NaCl, and has the ability to degrade nitrite, reduce nitrate, hydrolyze proteins and fats. It is catalase positive, non-hemolytic, non-viscosifying, acid-producing but not gas-producing, non-NH3-producing, non-H2S-producing, and non-bioamine-producing. It is acid-resistant (pH 4.5) and low-temperature resistant (10℃), and can be used in meat fermentation inoculants.

Benefits of technology

Staphylococcus aureus XUCSB 022 can effectively degrade nitrite in high-salt environments, reduce nitrite residue in fermented meat products, promote the formation of unique sensory flavors, and improve the quality and safety of fermented meat products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843342B_ABST
    Figure CN120843342B_ABST
Patent Text Reader

Abstract

The application provides a Staphylococcus carnosus strain with high salt tolerance and good fermentation characteristics and application thereof, and belongs to the technical field of microbial application and meat product processing. The Staphylococcus carnosus strain is Staphylococcus carnosus XUCSB 022, which is preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 24, 2025, and the strain preservation number is CGMCC No. 34991. The Staphylococcus carnosus XUCSB 022 strain has the ability to tolerate 18% salt concentration, and has the ability to degrade nitrite in fermented meat. After the meat product is fermented for 15 days, the average residual amount of nitrite is 9.77 mg / kg, which is reduced by 39.77% compared with a CK group, and flavor substances including aldehydes, ketones, alcohols, esters, acids and other substances are produced, the Staphylococcus carnosus XUCSB 022 strain has high safety characteristics, excellent fermentation ability and fermentation flavor-producing capacity when inoculating fermented meat, and provides a strain resource for producing fermented meat products.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microbial application and meat processing, and particularly relates to a highly salt-tolerant Staphylococcus carnosus with good fermentation characteristics and application thereof. BACKGROUND

[0002] The flavor, texture and safety of fermented meat products (such as salami, dry-cured ham, bacon, sausage, etc.) are highly dependent on microbial activities. In the traditional fermentation process, microorganisms produce enzymes such as proteases and lipases through metabolism, decompose muscle proteins and fats, and generate polypeptides, free amino acids, fatty acids and volatile flavor substances (such as aldehydes and ketones), which give the product a unique flavor and improve the texture (such as tenderization and reduced hardness). However, natural fermentation relies on environmental microbial communities, and there are problems such as long fermentation period (usually several months or even more than a year), unstable quality (such as loose texture due to excessive hydrolysis), and unguaranteed food safety (such as potential contamination by pathogenic bacteria). In food industry production, high-quality strains screened by inoculation are usually used as meat fermentation agents, which can effectively shorten the fermentation period of meat products, improve product quality, and ensure the safety and controllability of the fermentation process. The microorganisms used for meat fermentation mainly include molds, yeasts, coagulase-negative staphylococci (CNS) and lactic acid bacteria, which can improve the taste, texture, flavor, color of meat products, inhibit the growth of miscellaneous bacteria, give fermented meat products a unique flavor and quality, and improve the nutritional value of fermented meat products.

[0003] Staphylococcus carnosus, as one of coagulase-negative staphylococci (CNS), exists in a variety of different fermented meats and is currently used in food. Since the 1950s, S. carnosus has been used as a starter culture for fermented meats, such as salami sausages, dry-cured hams, etc. It has many advantages, such as forming a desirable red color and stabilizing it by nitrate reduction (e.g., generating nitroso-metmyoglobin), peroxidase-positive extending storage, breaking down proteins and fats in meat, and having salt and nitrite resistance, etc. In the update announcement of the National Health Commission of the People's Republic of China on the list of strains that can be used for food and the list of strains that can be used for infant food (2022, No. 4), S. carnosus belongs to the microorganisms that can be used for food processing, and the main use is fermented meat products. The most promising microorganisms used as meat fermentation starters usually exist in the microbial community of fermented meat substrates, which are adapted to the environment and conditions of fermented meat, and therefore may have stronger growth characteristics and fermentation characteristics. The growth of the strain is easily affected by the processing environment of fermented meat products, especially the salt, nitrite and acidity in the product. The most commonly used ingredient in the production of fermented meat products is sodium chloride, which plays an important role in quality (dissolution of myofibrillar proteins and salty taste) and safety (reducing water activity to inhibit microbial growth). For example, 100 grams of fermented sausage may contain 230 to 3300 milligrams of sodium, and these fermented meat products are an important dietary source of sodium. Fermented meat products under different traditional curing processes usually contain different salt contents, but the reported S. carnosus has limited fermentation and salt tolerance characteristics. The present application provides a S. carnosus strain with ultra-high salt tolerance and good fermentation characteristics, which can be used for the production of different types of fermented meat products under different salt content processing conditions.

[0004] The patent application with publication number CN109868251A discloses a S. carnosus B1-2 with color development and its application in salami sausages. The S. carnosus can realize color development to replace nitrite. The strain B1-2 was studied for the conversion of metmyoglobin in a shake flask MRS medium, but the NOS expression of the strain B1-2 was induced using the toxic reagent methanol. In addition, the salami sausage was inoculated and fermented for 21 days, and no nitrite was added to achieve the purpose of promoting the fermentation and maturation of salami sausage without adding nitrite. However, the S. carnosus of the patent does not have high salt tolerance.

[0005] Currently, there is no reported S. carnosus strain that can cope with the production of fermented meat products under different salt concentration environments. SUMMARY

[0006] The technical problem solved by the present application is how to provide a Staphylococcus carnosus with high salt tolerance and good fermentation characteristics and its application.

[0007] The present application solves the above technical problems by the following technical means:

[0008] The first aspect of the present application provides a Staphylococcus carnosus with high salt tolerance and good fermentation characteristics, and the preservation number is CGMCC No.34991.

[0009] The Staphylococcus carnosus is Staphylococcus carnosus XUCSB 022, which has been preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 24, 2025, with the strain preservation number CGMCC No.34991 and the classification name Staphylococcus carnosus.

[0010] Preferably, the 16S rDNA sequence of the Staphylococcus carnosus is shown in SEQ ID NO.1.

[0011] The second aspect of the present application provides the application of the above-mentioned Staphylococcus carnosus in the fermentation preparation of meat products.

[0012] The present application also provides the application of the above-mentioned Staphylococcus carnosus in the preparation of meat fermentation agents.

[0013] The third aspect of the present application provides a meat fermentation agent with excellent salt tolerance and fermentation flavor, which mainly contains one or more of the above-mentioned Staphylococcus carnosus, fermentation supernatant of Staphylococcus carnosus, and Staphylococcus carnosus lysate.

[0014] Preferably, the fermentation supernatant is obtained by culturing the Staphylococcus carnosus in the culture medium for a period of time, and then removing the bacterial cells by centrifugation.

[0015] Preferably, the lysate is obtained by culturing the Staphylococcus carnosus in the culture medium for a period of time, ultrasonic disruption, and removing the bacterial cells by centrifugation.

[0016] The fourth aspect of the present application provides a method for improving the sensory flavor of meat fermentation products, which comprises the following steps: adding the above-mentioned meat fermentation agent in the preparation process of meat fermentation products, and the rest is normal process operation.

[0017] Preferably, the meat includes but is not limited to pork, beef, mutton, or heart, liver, lung, kidney, etc.

[0018] Preferably, the meat fermentation product includes but is not limited to bacon, sausage, sausage, ham, etc.

[0019] Preferably, the main component of the meat fermentation agent is the above-mentioned Staphylococcus carnosus, and the added concentration is 0.5-1.5×10 7 CFU / g.

[0020] Preferably, the following steps are included: grinding the meat into particles, then adding 0.5-1.5% of glucose, 0.005-0.015% of sodium nitrite, and 2-3% of salt by mass of the meat; and adding Staphylococcus carnosus XUCSB 022, so that the concentration is 0.5-1.5×10 7 CFU / g; chopping and mixing uniformly, curing for 1.5-2.5h, then stuffing, and hanging into a sterilized constant-temperature and constant-humidity box to perform the fermentation drying and maturation process of the sausage; the program is: natural air drying at 22-27℃ for 20-28h, with a relative humidity of 40-50%; fermentation at 22-27℃ for 2-4d, with a relative humidity of 70-80%; drying and maturation at 16-20℃ for 10-15d, with a relative humidity of 60-70%.

[0021] The present application has the following beneficial effects:

[0022] 1. The present application provides a Staphylococcus carnosus XUCSB 022 strain, with a preservation number of CGMCC NO:34991. The strain is characterized in that it can grow in a NaCl environment with a concentration of ≥18%, has the ability to degrade nitrite, and has good fermentation characteristics. The strain has the abilities of nitrate reduction, protein and fat hydrolysis, hydrogen peroxide enzyme positivity, non-hemolysis, non-stick production, acid production without gas production, non-NH3 production, non-H2S production, non-biogenic amine production, tolerance to 150mg / L Na2NO2, acid tolerance (pH4.5), and low-temperature tolerance (10℃).

[0023] 2. The Staphylococcus carnosus of the present application has the abilities of nitrate reductase, hydrogen peroxide enzyme, protein hydrolysis enzyme, and fat hydrolysis enzyme, can produce acid by utilizing glucose, is acid-tolerant, nitrite-tolerant, and low-temperature-tolerant. The strain is beneficial to enriching the types of microbial resources in high-salt environments, and is suitable for the production of fermented meat of different salt concentration types, and the adaptive evolution mechanism of the microorganism is also studied.

[0024] 3. Breakthrough in salt tolerance, realize high-salt and low-nitrite

[0025] The Staphylococcus carnosus XUCSB 022 strain of the application has the ability to tolerate 18% limit salt concentration, and has the ability to degrade nitrite in fermented meat, and the average residual amount of nitrite in the fermented meat product is 9.77 mg / kg after 15 days of fermentation, which is reduced by 39.77% compared with the CK group, and is much lower than the 30 mg / kg of residual nitrite in fermented meat products, indicating that the Staphylococcus carnosus XUCSB 022 has good ability to degrade nitrite.

[0026] 4, the ability to produce aroma and color is outstanding, and unique sensory flavor is formed

[0027] The Staphylococcus carnosus of the application is inoculated into fermented sausages, and after 15 days of fermentation, the redness value a* is 15.96±0.80, which is increased by 1.27 compared with the CK group. There are 21 kinds of volatile flavor substances, more than 11 kinds in the CK group, among which alcohol substances, unsaturated hydrocarbon substances, aromatic hydrocarbon substances and acid substances are unique to the inoculated Staphylococcus carnosus XUCSB 022, which makes the flavor of the fermented sausage more complex and layered, and promotes the formation of unique sensory flavor characteristics of the fermented sausage. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 It is the MSA solid plate morphological characteristics and microscope gram staining of the Staphylococcus carnosus XUCSB 022 in Example 1 of the application.

[0029] Figure 2 It is the phylogenetic tree of the Staphylococcus carnosus XUCSB 022 (referred to as C22) in Example 1 of the application.

[0030] Figure 3 It is the viable cell count of the Staphylococcus carnosus XUCSB 022 (referred to as C22) in Example 1 of the application under different salt concentrations in MSA medium; Note: different letters indicate statistical difference (P<0.05). Error bar represents standard deviation (SD).

[0031] Figure 4 It is the effect of inoculating Staphylococcus carnosus XUCSB 022 (referred to as C22) on the redness value (a*) of fermented sausage in Example 1 of the application; Note: different letters indicate statistical difference (P<0.05). Error bar represents standard deviation (SD).

[0032] Figure 5 The nitrite content of Staphylococcus carnosus XUCSB 022 (referred to as C22) inoculated into fermented sausages for 15 days in the embodiment of the present application; Note: different letters indicate statistical differences (P < 0.05). Error bars represent standard deviation (SD). DETAILED DESCRIPTION

[0033] In order to make the purpose, technical scheme and advantages of the embodiments of the present application clearer, the technical scheme in the embodiments of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application. Unless otherwise defined, the professional terms used below are consistent with the meanings understood by those skilled in the art.

[0034] The test materials and reagents used in the following embodiments, unless otherwise specified, can be obtained commercially or prepared by known methods.

[0035] Unless otherwise specified, the quantitative tests in the following embodiments are set up with more than three repeated experiments, and the results are averaged.

[0036] Preservation of strains

[0037] The Staphylococcus carnosus is Staphylococcus carnosus XUCSB 022, which is preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 24, 2025, with the strain preservation number CGMCC No. 34991, and the address is No. 3, Beichen West Road, Chaoyang District, Beijing.

[0038] Embodiment 1: A Staphylococcus carnosus with high salt tolerance and good fermentation characteristics and its application

[0039] 1. Experimental materials:

[0040] Sample: Hunan Changsha bacon.

[0041] MSA liquid medium: beef extract 3 g, peptone 10 g, NaCl 10 g, D-mannitol 10 g, distilled water 1000 mL, pH adjusted to 7.2. Sterilized at 121℃ for 15 min.

[0042] MSA solid culture medium: 3g beef extract, 10g peptone, 10g NaCl, 10g D-mannitol, 1000mL distilled water, 18g agar powder, adjust pH to 7.2. Sterilize at 121℃ for 15min.

[0043] 2. Experimental Methods

[0044] 2.1 Sequencing of the strain's 16S rDNA

[0045] Primer 7F was used: CAGAGTTTGATCCTGGCTCAG (SEQ ID NO.2)

[0046] PCR amplification was performed using primer 1540R: AGGAGGTGATCCAGCCGCA (SEQ ID NO.3). The PCR amplification conditions were: 95℃, 5 min; 95℃, 15 s, 55℃, 15 s, 72℃, 1 min 30 s, 34 cycles; 72℃, 5 min; stored at 4℃. The amplified DNA fragments were detected using 1% agarose gel and sent to Shanghai Sangon Biotech for sequencing.

[0047] 2.2 Sample preparation:

[0048] Samples of cured pork were collected from local residents in Changsha, Hunan Province. 25g of cured pork was taken with sterile scissors, chopped, and added to 225mL of physiological saline (0.9% NaCl solution). The mixture was homogenized using a sterile homogenizer (SCIENTZ-09) (SCIENTZ, Ningbo, China) at a speed of 12 times / second for 2 minutes. 1ml of sample was then collected and serially diluted 10-fold with physiological saline. 100µL of each appropriate serial dilution was spread onto MSA solid medium, screened for bacteria at 30℃, and incubated for 72 hours. Colonies with inconsistent morphology were randomly selected and streaked three times until purified.

[0049] 2.3 Determination of physicochemical properties of Staphylococcus carnosus XUCSB 022:

[0050] 2.3.1 Screening for hemolysis characteristics

[0051] Using a sterile inoculating loop, streak activated pure bacteria from MSA liquid medium onto Columbia blood agar plates and incubate at 37°C for 48 hours. Observe whether there is a hemolytic zone around the colony. If a transparent hydrolyzed area appears around the colony, it is β-hemolysis; if a partially hydrolyzed or dark green area appears, it is α-hemolysis; if there is no obvious change around the colony, it is γ-hemolysis (non-hemolysis).

[0052] 2.3.2 Viscosity Generation Experiment

[0053] The single colony cultured on MSA solid medium was directly picked up with a inoculation needle. If no thread-pulling phenomenon occurred, the strain was not mucoid.

[0054] 2.3.3 Nitrate reductase activity

[0055] Preparation of nitrate reductase solid medium: 0.2% potassium nitrate was added to the MSA medium and sterilized.

[0056] The isolated and purified colony was inoculated on the nitrate reductase solid medium and incubated at 37°C for 8 h. 1 mL of reagent A and 1 mL of reagent B of the Griess reagent were poured into the medium. After one minute of reaction, the remaining liquid was poured out. Whether a red color development ring appeared around the colony was observed, and the size of the color development ring was compared. The size of the red color development ring could reflect the relative size of the nitrate reductase activity of the strain to some extent.

[0057] 2.3.4 Protease activity

[0058] On the basis of MSA solid enrichment medium, 5% skimmed milk powder (SM medium) was added and sterilized at 115°C for 20 min. The single colony was inoculated on the SM medium and incubated at 37°C for 48 h. The decomposition of the transparent ring was observed.

[0059] 2.3.5 Lipase activity

[0060] On the basis of MSA solid enrichment medium, 1% tributyrin was added. The soluble material was dissolved uniformly by ultrasonic and sterilized at 115°C for 20 min. The single colony was inoculated on the tributyrin medium and incubated at 37°C for 72 h. The decomposition of the transparent ring was observed.

[0061] 2.3.6 Catalase experiment

[0062] A clean glass slide was taken and a drop of 3% hydrogen peroxide solution was dropped on it. The single colony of the strain to be tested was picked up with an inoculation needle and smeared on the hydrogen peroxide solution. Whether bubbles were produced was observed. If bubbles were produced, the catalase reaction of the strain was positive, and if no bubbles were produced, the catalase reaction of the strain was negative.

[0063] 2.3.7 Glucose gas and acid production detection

[0064] Fermentation glucose gas production medium: proteose peptone 1 g, NaCl 0.5 g, glucose 1 g, distilled water 100 mL, pH 7.4, add trace 1.6% bromocresol purple solution (0.16 g dissolved in 10 mL 95% ethanol solution) to the solution until it is purple, distribute the test tubes, each containing 10 mL, place the inverted Durham tube into the test tube and empty the air, sterilize at 121°C for 15 min. Then, inoculate 1% bacterial solution into the test tube, cultivate at 37°C for 24 h. Set up a blank control group. If bubbles are produced in the Durham tube, it indicates that the bacteria inoculated ferment glucose to produce gas, and if the color turns yellow, it indicates that acid is produced.

[0065] 2.3.8 NH3 production detection

[0066] Arginine ammonia production medium: proteose peptone 5 g, yeast extract powder 5 g, beef extract 5 g, NaCl 2.5 g, glucose 0.5 g, ammonium citrate 2 g, potassium phosphate dibasic 2 g, L-arginine 10 g, dissolved in 1000 mL of distilled water, pH 5.3, distribute the test tubes, each containing 10 mL, add an inverted Durham tube, empty the air, sterilize at 121°C for 15 min. Inoculate the test strain with 1% bacterial solution into the test tube containing the NH3 production medium, add sterile liquid paraffin to cover the medium surface, cultivate at 37°C for 24 h. Observe whether bubbles are produced in the Durham tube, and if bubbles are produced, it is NH3 production positive.

[0067] 2.3.9 Biogenic amine production detection

[0068] Amino acid decarboxylase detection medium: proteose peptone 5 g, beef extract powder 3 g, glucose 1 g, bromocresol purple 0.02 g, amino acid (use L-lysine, L-ornithine respectively) 5 g, dissolved in 1000 mL of distilled water, pH 6.8, distribute the test tubes, each containing 10 mL, sterilize at 121°C for 15 min. Inoculate the test strain with 1% bacterial solution into the test tube containing different amino acids, cover with sterile liquid paraffin, cultivate at 37°C for 48 h. Observe whether there is a color change, and if the color first turns yellow and then turns purple, it is positive.

[0069] 2.3.10 H2S production detection

[0070] Ferrous sulfate agar medium: beef extract 0.3 g, yeast extract 0.3 g, proteose peptone 1 g, ferrous sulfate 0.02 g, sodium thiosulfate 0.03 g, NaCl 0.5 g, agar 1.2 g, dissolved in 100 mL of distilled water, pH 7.4, sterilize at 121°C for 15 min, after sterilization, take it out and place it upright, and wait for it to solidify into a uniform solid state.

[0071] 2.3.11 NaNO2 tolerance detection

[0072] Inoculate 1% of the third generation of activated bacteria into 150mg / L MSA liquid medium, observe turbidity after 24h and detect OD 600 .

[0073] 2.3.12 Acid resistance test

[0074] Inoculate 1% of the third generation of activated bacteria into MSA liquid medium with pH of 4.5, 5, 5.5, observe turbidity after 48h and detect OD 600 .

[0075] 2.3.13 Low temperature resistance test

[0076] Inoculate 1% of the third generation of activated bacteria into MSA liquid medium, cultivate at 10℃ for 48h, observe turbidity and detect OD 600 .

[0077] 2.4 Antibiotic sensitivity test

[0078] K-B method paper disc agar diffusion method was used to determine the antibiotic sensitivity of the screened strains. That is, 100uL of test bacteria suspension of the third generation of activated bacteria grown to the end of the logarithmic phase was uniformly coated on MSA solid medium. After the surface of the plate was slightly dry, antibiotic paper discs containing a certain amount of antibiotic were attached to the plate containing the coated bacteria. There were 8 kinds of antibiotics (rifampicin (5μg), chloramphenicol (30μg), kanamycin (30μg), streptomycin (10μg), tetracycline (10μg), penicillin (10μg), vancomycin (30μg), gentamicin (10μg)). The plates were incubated at 37℃, and the size of the inhibition zone could reflect the sensitivity of the screened bacteria to the tested drugs. The diameter of the inhibition zone (mm) was measured after 48h.

[0079] 2.5 PCR method for determining enterotoxin gene and amine-producing gene test

[0080] PCR technology was used to directly confirm the presence of pathogenic genes and biological amine genes. Including sea, seb, sec, sed and see enterotoxin genes, hdc (histidine decarboxylase gene), odc (ornithine decarboxylase gene), tdc (tyrosine decarboxylase gene) and ldc (lysine decarboxylase gene).

[0081] 2.6 Salt tolerance test

[0082] Inoculate 1% of the third generation of activated bacteria into MSA liquid enrichment medium containing 2%-18%, cultivate at 37℃ for 48h, observe turbidity and detect viable bacteria using MSA solid medium.

[0083] 2.7 Application of S. carnosa in fermented sausages

[0084] 2.7.1 Preparation of fermented sausages

[0085] Pork raw material is selected from the rear leg of the farm pig, and is ground into granules by a meat grinder with a fat-to-lean ratio of 2:8 (m / m) and ingredients are added. The ingredients are 1% glucose, 0.01% sodium nitrite, and 2.5% salt. Among them, the control group is added with 5% sterile water, and the experimental group is added with bacterial liquid mixed with 5% sterile water, and the addition concentration of the bacterial liquid of a single bacterial species is 1 x 10 7 CFU / g. After mixing, low-temperature curing is performed for 2 h, and then the sausages are stuffed, hung into a pre-sterilized constant temperature and humidity box, and subjected to fermentation, drying, and maturation of the sausages. The program is: natural air drying at 25°C for 24 h with a relative humidity of 45%; fermentation at 25°C for 3 d with a relative humidity of 75%; and drying and maturation at 18°C with a humidity of 65% for 11 d. The sampling time is 0, 3, 6, 9, 12, and 15 d.

[0086] 2.7.2 Color change of fermented sausages

[0087] The fat is removed, the sample is cut, mixed, and pressed into a slice with a thickness of 1.5 cm and a diameter of 2.5 cm. The colorimeter instrument is calibrated, and the redness value (a*) of the sausage is measured by the colorimeter. Three groups are determined in parallel.

[0088] 2.7.3 Determination of nitrite residue in fermented sausages

[0089] The spectrophotometric method in the national standard GB 5009.33-2016 is used for detection.

[0090] 2.7.4 GC-MS determination

[0091] (1) Sample pretreatment

[0092] 2.0 g of the cut sample is weighed into a 20 mL headspace bottle, and 10 uL of 2,4,6-trimethylpyridine with a concentration of 0.1 g / L is added as an internal standard. Headspace solid phase microextraction (SPME) is used. For the first time, an empty needle is used for sampling, and the SPME extraction head is first aged in the GC sampling port (250°C) for 20 min. Then, the microextraction needle is inserted into the headspace bottle, and after extraction for 30 min, the sample is manually sent to the GC-MS, desorbed for 5 min, and analyzed for volatile flavor substances.

[0093] (2) GC conditions: The chromatographic column was DB-5MS capillary column (60 m x 0.32 mm, 1 μm); the carrier gas was high-purity helium; the flow rate was 0.8 mL / min; the injection port temperature was 250 °C, and a split mode was used with a split ratio of 5:1 and a split flow of 4 mL / min. The retention time was 2 min. The initial column temperature was 40 °C, which was maintained for 5 min. The temperature was raised at a rate of 2 °C / min to 90 °C, maintained for 0 min, raised at a rate of 5 °C / min to 100 °C, maintained for 0 min, raised at a rate of 10 °C / min to 230 °C, and maintained for 8 min.

[0094] (3) MS conditions: The full scan mode was used, and the mass spectrometer scanned the mass at m / z 45-500. The ion source was EI, the ion source temperature was 230 °C, the electron energy was 70 eV, and the front injection port temperature was 250 °C.

[0095] The content of each volatile component (the internal standard was 2,4,6-trimethylpyridine with a concentration of 100 ppm, and the use amount was 10 uL) was calculated according to the following formula:

[0096] The amount of flavor substance (mg / kg) = (C0*V0 / m)*(A1 / A2), wherein C0 is the concentration of the internal standard (mg / L), V0 is the injection volume of the internal standard (uL), m is the mass of the chopped sample (g). A1 is the peak area of the substance, and A2 is the peak area of the internal standard.

[0097] 3. Experimental results

[0098] 3.1 Isolation and purification of Staphylococcus carnosus and 16S rDNA sequencing

[0099] The morphological characteristics of Staphylococcus carnosus XUCSB 022 on the MSA plate and the results of 60 times magnification observation under a microscope after Gram staining are shown in Figure 1 . The diameter was about 0.15 ± 0.05 cm, the colony was not transparent, was light yellow, the surface and edge were smooth and wet, the middle was slightly convex, and was purple by Gram staining, indicating that Staphylococcus carnosus XUCSB 022 was a positive bacterium.

[0100] The sequencing sequence of 16S rDNA of Staphylococcus carnosus XUCSB 022 is:

[0101] (SEQ ID NO. 1)

[0102]

[0103] The NCBI alignment with Staphylococcus carnosus HSP-S10 has 99.79% sequence similarity, in order to further clarify the relationship and classification status of the strain, the phylogenetic tree is constructed, the results show that Staphylococcus carnosus XUCSB 022 (referred to as C22) and Staphylococcus carnosus HSP-S10 are clustered into a branch in the phylogenetic tree, and the phylogenetic tree is shown as Figure 2 Therefore, it is identified as Staphylococcus carnosus.

[0104] 3.2 Physicochemical properties of Staphylococcus carnosus XUCSB 022

[0105] The physicochemical properties of Staphylococcus carnosus XUCSB 022 are determined as shown in the following table. As shown in the table, using agar plate color reaction, Staphylococcus carnosus XUCSB 022 has high nitrate reduction ability, and nitrate reductase activity plays an important role in the formation of red color and flavor of fermented meat, and the diameter of red circle is 4.25±0.16cm. Through the agar plate hydrolysis circle test, Staphylococcus carnosus XUCSB 022 also has good proteolytic and lipolytic ability, protease can decompose protein to form free amino acid, and lipase can decompose fat to form fatty acid, which plays an important role in the special aroma and flavor of fermented meat. At the same time, it also has the ability to adapt to the environment of fermented meat, and can survive under the conditions of low temperature, high sodium chloride (see the result description of salt tolerance experiment), high nitrite sodium addition concentration and acidic pH 4.5-5.5.

[0106] The fermentation physicochemical properties of Staphylococcus carnosus XUCSB 022 are as follows:

[0107]

[0108]

[0109] Note: "+" and "-" represent whether it is a positive reaction. The number is the OD 600 absorbance under.

[0110] 3.3 Antibiotic sensitivity experiment of Staphylococcus carnosus

[0111] The results of antibiotic sensitivity experiment of Staphylococcus carnosus XUCSB 022 are shown in the following table. As can be seen from the table, using drug sensitive sheet method to study the drug resistance of bacteria, Staphylococcus carnosus XUCSB 022 has inhibition zone to all conventional antibiotics tested in this study, and has sensitive characteristics. Among them, the inhibition zone of penicillin, rifampicin and chloramphenicol is the largest, and the sensitivity is the highest. It shows that Staphylococcus carnosus XUCSB 022 belongs to non-drug resistant bacteria, which will not cause drug resistance gene pollution to the environment, meets the GRAS standard, and also ensures the safety of fermented food.

[0112] Drug sensitivity of Staphylococcus carnosus XUCSB 022

[0113]

[0114] 3.4 Detection of virulence genes of Staphylococcus carnosus

[0115] The results of PCR detection of enterotoxin genes and amine-producing genes of Staphylococcus carnosus XUCSB 022 are shown in the following table. As can be seen from the PCR results of the experiment, Staphylococcus carnosus XUCSB 022 does not contain virulence genes, including Staphylococcus enterotoxin encoding genes sea, seb, sec, sed and see, and biological amine forming genes such as histamine gene hdc, cadaverine gene ldc, putrescine gene odc, tyramine gene tdc, etc. Therefore, through further safety detection, it shows that Staphylococcus carnosus XUCSB 022 has the potential to be applied in fermented meat with relatively safe application.

[0116] PCR detection of enterotoxin genes and biological amine-producing genes of Staphylococcus carnosus XUCSB 022

[0117]

[0118] Note: "+" and "-" represent whether it is a positive phenomenon.

[0119] 3.5 Salt tolerance of Staphylococcus carnosus

[0120] The salt tolerance of Staphylococcus carnosus XUCSB 022 is as followsFigure 3 The viable cell count of Staphylococcus carnosus XUCSB 022 was not significantly different when the MSA liquid medium contained 2%-12% salt concentration, decreased by 3.30 times when the salt concentration was 14%, and was not significantly different when the salt concentration was 14%-16%. When the salt concentration was 18% and the culture time was 24 h, the viable cell count of Staphylococcus carnosus XUCSB 022 decreased sharply but still survived, with a survival number of 3.56-3.70 log CFU / mL. This indicates that Staphylococcus carnosus XUCSB 022 has excellent salt tolerance and survival ability and can cope with different salt concentrations in the process of fermented meat production.

[0121] 3.6 Characteristics of Staphylococcus carnosus applied to fermented sausages

[0122] 3.6.1 Change in color

[0123] The effect of inoculation of Staphylococcus carnosus XUCSB 022 on the redness value (a*) of fermented sausages for 15 days was detected by a colorimeter, and the results are shown in Figure 4 As a food additive, nitrite has multiple effects on improving the color of meat products. The color of fermented sausages is formed by the action of microbial nitrate reductase on nitrite, and the reduction product, nitric oxide (NO), interacts with myoglobin in meat to form the red pigment, nitrosylmyoglobin. As can be seen from Figure 4 The redness value of fermented sausages inoculated with Staphylococcus carnosus XUCSB 022 was significantly higher than that of the control group without inoculation from the 3rd day to the 15th day of fermentation. At the 15th day, the redness value a* was 15.96 ± 0.80, which was 1.27 higher than that of the CK group. This indicates that Staphylococcus carnosus XUCSB 022 has the effect of promoting the formation of red color in fermented sausages.

[0124] 3.6.2 Detection of nitrite residue in fermented sausages

[0125] After 15 days of fermentation, the nitrite residue in fermented sausages was detected, and the results are shown in Figure 5The average nitrite residue of fermented sausages inoculated with Staphylococcus carnosus XUCSB 022 group was 9.77 mg / kg, and the average nitrite residue of CK group was 16.22 mg / kg, which was reduced by 39.77%, and was lower than the 30 mg / kg of nitrite residue in fermented meat products. It showed that Staphylococcus carnosus XUCSB 022 had good ability to degrade nitrite.

[0126] 3.6.3 Detection of volatile flavor substances in fermented sausages

[0127] The flavor substances of fermented sausages come from a series of physical and biochemical changes of fat, protein and carbohydrate in sausages during the production process of sausages and the added spices. It is mainly related to the presence of volatile substances such as aldehydes, ketones, esters, alcohols, acids and phenols. The following table is the result of detecting volatile substances in fermented sausages inoculated with Staphylococcus carnosus XUCSB 022 by GC-MS. A total of 24 volatile substances were identified. A total of 20 volatile chemical substances were detected in Staphylococcus carnosus XUCSB 022 group, including 2 aldehydes, 1 alcohol, 10 esters, 3 unsaturated hydrocarbons, 2 aromatic hydrocarbons and 2 acids. In CK group, a total of 11 volatile chemical substances were detected, including 1 aldehyde, 2 ketones and 8 esters. Compared with CK group, the volatile chemical substances of Staphylococcus carnosus XUCSB 022 were more abundant, which contributed greatly to the richness and level of sausage flavor. Among them, alcohol substances such as 2-methyl-3-butyn-2-ol, ester substances such as ethyl cyanate, methyl propionate, methyl butyrate and methyl isovalerate, unsaturated hydrocarbon substances such as limonene, styrene and 1,3-hexadiene-5-alkyne, acid substances such as isooctanoic acid and 2-oxovaleric acid, and aromatic hydrocarbon substances such as ethylbenzene and o-xylene were unique to Staphylococcus carnosus XUCSB 022.

[0128] Staphylococcus carnosus XUCSB 022 inoculated in fermented sausages

[0129]

[0130]

[0131]

[0132] Note: Different lower case letters indicate a significant difference (P < 0.05) among sample groups for the data in the same row; ND means the corresponding compound was not detected

[0133] Esters are produced by esterification of alcohols and acids, and most of them have aromatic flavor. Esters containing short-chain acids (<C6) mostly have fruit aroma, and esters containing long-chain acids (C14-C18) mostly have a light greasy taste. Free fatty acids produced by fat hydrolysis can also react with alcohols to form esters, which contribute significantly to the unique flavor of sausages. The total content of esters in the CK group was 3151.91 ± 276.35 μg / kg, higher than that in the Staphylococcus carnosus XUCSB 022 group (1679.88 ± 257.60 μg / kg). However, the number of ester substances was less than that in the Staphylococcus carnosus XUCSB 022 group. The top three ester substances in the CK group were mainly reflected in methyl acetate, ethyl acetate, and methyl octanoate. The top three ester substances in the Staphylococcus carnosus XUCSB 022 group were mainly reflected in ethyl acetate, methyl acetate, and methyl butyrate. Aldehydes contribute significantly to the formation of the unique flavor of fermented meat products and can reflect the degree of fat oxidation. The content of aldehydes in the Staphylococcus carnosus XUCSB 022 group was more than that in the CK group, but the threshold was lower, and it was a minor contributor. Ketones are generally produced by the Maillard reaction and have a buttery flavor. Two ketone substances were only detected in the CK group, but ketone substances are minor contributors to meat flavor. Alcohol substances are generally derived from carbohydrate metabolism, fat oxidation, and amino acid catabolism. Most unsaturated alcohols have good fruit and grassy aroma. The presence of unsaturated hydrocarbons such as alkenes, alkynes, and aromatic hydrocarbons in the Staphylococcus carnosus XUCSB 022 group can improve the complexity of the aroma, impart fruit flavor, nutty flavor, and buttery flavor to fermented sausages, but the threshold is low, and it is a minor contributor to aroma. Acid substances in fermented sausages are mainly produced by microbial metabolism of carbohydrates. Isooctanoic acid has a slight cheese and fat aroma. 2-oxovaleric acid is a keto acid with fruit, sweet, or slightly acidic taste. The Staphylococcus carnosus XUCSB 022 group contains acid substances, while the CK group does not. Acid substances are representative in fermented sausages and play an important role in the formation of ester substances. The presence of acid substances can enrich the taste and aroma of fermented sausages, making the flavor of sausages more complex and layered, and promoting the formation of the unique sensory flavor characteristics of fermented sausages.

[0134] In summary, Staphylococcus carnosus XUCSB 022 is a highly salt-tolerant and fermentation-characteristic meat ferment with good prospects for use.

[0135] The strain is derived from traditional fermented food Hunan bacon (China, Hunan, Changsha), and the screening method includes nitrate reduction capacity, protein and fat hydrolysis capacity, hydrogen peroxide enzyme positive, hemolytic characteristics, sticky production, gas and acid production, NH3 production, H2S production, biogenic amine production, Na2NO2 tolerance, acid tolerance, low temperature tolerance, etc.

[0136] 2.16S rDNA molecular biology identification and phylogenetic tree construction, determined as Staphylococcus carnosus.

[0137] Breakthrough technical features:

[0138] 1. Ultra-high salt tolerance: still active under 18% salt concentration for 24h. Through MSA solid plate detection, the viable cell count of Staphylococcus carnosus XUCSB 022 is still 7.57 log CFU / mL under 16% salt concentration. The salt tolerance is comparable to known patents, but the viable cell count under 16% salt concentration exceeds the viable cell count of Staphylococcus carnosus M43 recorded in known patents, which starts to decline at 12% salt concentration.

[0139] 2. Color development ability: inoculate 1×10 7 CFU / g of Staphylococcus carnosus XUCSB 022, from the 3rd day to the 15th day of fermented sausage maturation, the redness value of fermented sausage inoculated with Staphylococcus carnosus XUCSB 022 is significantly higher than that of the control group without inoculation. At the 15th day, the redness value a* is 15.96±0.80, which is 1.27 higher than that of the CK group. This indicates that Staphylococcus carnosus XUCSB 022 has the effect of promoting red color formation in fermented sausage.

[0140] 3. Nitrite degradation ability: the initial nitrite content of fermented sausage is 100mg / kg, after 15 days of fermentation, the average residual amount of nitrite in fermented sausage of Staphylococcus carnosus XUCSB 022 group is 9.77mg / kg, which is 39.77% lower than that of the CK group, and is lower than the 30mg / kg of nitrite residual amount in fermented meat products. This indicates that Staphylococcus carnosus XUCSB 022 has good ability to degrade nitrite.

[0141] 4. Fragrance-producing ability: inoculate 1 x 10 7 CFU / g of Staphylococcus carnosus XUCSB 022, analyze volatile substances by GC-MS, compared with 11 kinds of CK group, the volatile flavor substances of Staphylococcus carnosus XUCSB 022 are more abundant, there are 21 kinds. Among them, alcohol, unsaturated hydrocarbon, aromatic hydrocarbon and acid are unique to the fermented sausage inoculated with Staphylococcus carnosus XUCSB 022.

[0142] 5. Safety: no hemolytic characteristics; no enterotoxin and amine-producing genes verified by PCR; antibiotic sensitivity of the screened strain was determined by K-B method paper disc agar diffusion method, which was sensitive to 8 kinds of antibiotics, meeting the GRAS standard.

[0143] Comparative Example 1:

[0144] (1) The strain with publication number CN109868251A was inoculated into salami sausage to ferment and mature, and the redness value increased to about 16, which was equivalent to the redness value of the fermented meat product inoculated with the strain Staphylococcus carnosus XUCSB 022 of the present example. However, this technical solution has not provided the test of the fermentation ability of the strain itself and the safety test. In addition, the appropriate use of nitrite not only has color, but also can be used as a preservative to inhibit lipid oxidation, and also has antibacterial effect to inhibit the growth of harmful microorganisms such as Clostridium botulinum. When B1-2 strain was used for fermented sausage for 21 days (longer than the time of using Staphylococcus carnosus XUCSB 022 strain of the present patent for fermented sausage until mature for 15 days), the flavor of salami sausage without adding nitrite was unknown, the sensory evaluation was unknown, and whether the mature salami sausage was easy to store and deteriorate was also not clear. In addition, whether the characteristics of this strain can be applied to more fermented meat products with different salt content processing technology is also not clear.

[0145] (2) The invention patent application with publication number CN110846260A discloses a strain of Staphylococcus carnosus M43 that can reduce biogenic amines and its application in soybean paste. The strain is screened from soybean paste, and the degradation of eight biogenic amines in the medium is studied. The results show that the degradation rate of different biogenic amines is 1.51%-100%. After inoculating soybean paste, the biogenic amine content is measured, and eight biogenic amines can be degraded, with a degradation rate of 8.69%-100%. In addition, the viable count of different salt concentrations is measured, and the strain can grow at a salt concentration of 0%-18%, but the viable count has decreased significantly at a salt concentration higher than 12%, with a value lower than 7.25 log CFU / mL. The growth adaptation temperature of Staphylococcus carnosus M43 is between 20℃ and 45℃, so it cannot adapt to outdoor soybean paste fermentation in cold winter. The patent also does not test the fermentation ability and safety of the strain itself, nor does it study the aroma contribution of other fermented foods such as fermented meat products.

[0146] (3) The invention patent application with publication number CN118516286A discloses a composite starter culture (Staphylococcus xylosus YB-12, Staphylococcus carnosus S10, and Bovine animal S11) that can improve the color of fermented meat products and reduce the additional addition of nitrite in meat products to reduce the residual nitrite in fermented meat products, thereby improving the safety and quality of meat products. Among them, Staphylococcus carnosus S10 has the functions of color protection and aroma enhancement, promotes color development by producing nitrate reductase, and its metabolites release more aroma substances by decomposing proteins and fats, playing an important role in the formation of flavor in fermented meat products.

[0147] (4) The literature (Shi Zhijia, Zang Mingwu, Lv Yu. Effect of Staphylococcus carnosus on sausage color [J]. Meat research, 2012, 26(02): 4-7.) uses Staphylococcus carnosus with nitrate reductase activity to study the effect of different factors on the color of sausage (redness value) and optimizes the color development process conditions. The optimal color development conditions of Staphylococcus carnosus are as follows: nitrate addition amount is 0.005%, iso-VC-Na addition amount is 0.01%, Staphylococcus carnosus freeze-dried powder addition amount is 0.25%, incubation temperature is 30℃, and incubation time is 3h.

[0148] (5) The document (Muller, A. et al., Safety assessment of selected Staphylococcus carnosus strains with regard to their application as meat starter culture. Food Control 2016, 66, 93-99.) analyzed the safety risks of 39 different strains of S. carnosus, including virulence and pathogenicity determinants. Of these, only two strains were resistant to more than one antibiotic. None of the strains tested were PCR positive for staphylococcal enterotoxin genes, exfoliative toxin genes, or toxic shock syndrome toxin genes. None of the strains tested produced cadaverine, putrescine, and histamine. This study screening evaluated the safety and feasibility of S. carnosus strains, ensuring their safe application as fermenting agents in fermented foods.

[0149] (6) The document (Zhou, H. M., Zhang, S. L., Zhao, B., et al. Effects of mixed starter culture of Staphylococcus xylosus and Staphylococcus carnosus on the quality of cured meat [J]. Food Science, 2018, 39(22): 32-38.) reported the use of Staphylococcus carnosus and Staphylococcus xylosus as a mixed starter culture from KocHansen (Beijing) Trade Co., Ltd., in which the highest salt tolerance of Staphylococcus carnosus was 16%, it did not produce acid, it had nitrate reductase and catalase, proteolytic enzymes and lipolytic enzymes.

[0150] Example 2:

[0151] A method for improving the sensory flavor of fermented sausages, comprising the following steps:

[0152] Pork is ground into granules, then 0.5% of its mass of glucose, 0.005% of sodium nitrite, and 2% of salt are added; and Staphylococcus carnosus XUCSB 022 is added to a concentration of 0.5 x 10 7 CFU / g; after mixing well, the sausages are stuffed and hung in a sterilized constant temperature and humidity box for the fermentation, drying, and maturation process of the sausages; the program is: natural air drying at 22°C for 20h, with a relative humidity of 40%; fermentation at 22°C for 2d, with a relative humidity of 70%; drying and maturation at 16°C for 10d, with a relative humidity of 60%.

[0153] Example 3:

[0154] A method for improving the sensory flavor of fermented sausages, comprising the following steps:

[0155] The pork is ground into granules, then 1.5% of glucose, 0.015% of sodium nitrite and 3% of salt by mass of the pork are added; and Staphylococcus carnosus XUCSB 022 is added to make the concentration of the bacteria 1.5×10 7 CFU / g; after mixing, the sausage is fermented and dried for 2.5 hours, then stuffed, and hung in a sterilized constant temperature and humidity box for fermentation, drying and maturation; the process is as follows: natural drying at 27℃ for 27 hours with a relative humidity of 50%; fermentation at 27℃ for 4 days with a relative humidity of 80%; drying and maturation at 20℃ for 15 days with a relative humidity of 70%.

[0156] The above examples are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that the technical solutions described in the foregoing examples can be modified, or some of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A strain of Staphylococcus carnosus which is highly salt tolerant and has good fermentation characteristics, characterized in that: The preservation number is CGMCC No. 34991.

2. The S. equi of claim 1, characterized in that: The 16S rDNA sequence of the Staphylococcus carnosus is shown as SEQ ID NO.

1.

3. The Staphylococcus carnosus of claim 1 is applied in the preparation of meat products by fermentation or in the preparation of meat fermentation agents.

4. A meat fermentation agent with excellent salt tolerance and fermentation flavor, characterized in that: The main component comprises the Staphylococcus carnosus of claim 1.

5. A method of improving the sensory flavor of a fermented meat product, characterized in that: The method comprises the following steps: In the preparation process of the meat fermentation product, the meat fermentation agent of claim 4 is added.

6. The method of claim 5, wherein: The meat includes pork, beef, mutton or its heart, liver, lung, kidney; the meat fermentation product includes bacon, sausage, sausage, ham.

7. The method of claim 5, wherein: The added concentration of S. carnosa in the meat fermentation agent is 0.5-1.5 x 10 7 CFU / g.

8. The method of claim 7, wherein: The added concentration of S. carnosa in the meat fermentation agent is 1.0 x 10 7 CFU / g.

9. The method of claim 7, wherein: The added concentration of S. carnosa in the meat fermentation agent is 1.5 x 10 7 CFU / g.

10. The method of claim 5, wherein: The method comprises the following steps: The meat is ground into granules, then 0.5-1.5% of glucose, 0.005-0.015% of sodium nitrite and 2-3% of salt are added in the mass of the meat; and the S. equinus of claim 1 is added at a concentration of 0.5-1.5 x 10 7 CFU / g; after mixing well, the sausages are stuffed and hung in a sterilized constant temperature and humidity box for fermentation, drying and maturation; the process is as follows: natural drying at 22-27℃ for 20-28h with a relative humidity of 40-50%; fermentation at 22-27℃ for 2-4d with a relative humidity of 70-80%; drying and maturation at 16-20℃ for 10-15d with a relative humidity of 60-70%.

Citation Information

Patent Citations

  • Staphylococcus carnosus capable of lowering biogenic amine and application of Staphylococcus carnosus

    CN110846260A

  • Green leavening agent and application

    CN118516286A

  • Staphylococcus camosus B1-2 with chromogenic effect and application thereof

    CN109868251A

  • Composite starter for improving fermentation quality of sausages and application

    JP2025027465A